The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia

Abstract

Inadequate hygienic conditions and poor handling are the primary causes of contamination in abattoirs. This study aimed to identify and molecularly detect pathogenic bacteria in sheep meat at slaughterhouses in Riyadh City, Saudi Arabia. Additionally, the study evaluated the sensitivity of these bacteria to various antimicrobials. In total, 150 samples were collected three times every two months from November 2021 to March 2022 from four abattoirs located in the south, west, east, and north of Riyadh. Pathogenic bacteria were separated using selective media, and the Vitek 2 system was utilized to identify all species and test their response to antibiotics. PCR was employed to detect virulence genes. The four pathogenic bacteria identified in all samples were Escherichia coli (12%), Klebsiella pneumoniae (9.3%), Salmonella enterica (7.3%), and Pseudomonas aeruginosa (6.6%). Abattoir D had a high number of bacteria isolated in January. K. pneumoniae and S. enterica exhibited resistance to ampicillin. S. enterica also demonstrated resistance to gentamicin, ciprofloxacin, and trimethoprim/sulfamethoxazole. P. aeruginosa was resistant to tigecycline. PCR results indicated positive tests for the E. coli gene FimH, the P. aeruginosa genes plcH and toxA, and the K. pneumoniae gene mrkD. Pathogenic bacteria with positive results for virulence genes have the potential to cause contamination and human diseases. To improve quality and reduce contamination, the government must address the issue of providing adequate and safe water for activities in all abattoirs in Riyadh City.

1. Introduction

Foodborne infections indicate the presence of bacteria or other microorganisms that cause illness in humans after eating. The possibility of food contamination has increased recently due to the accelerated globalization of food production [1]. To produce meat hygienically, a standard slaughterhouse with adequate facilities is required. However, the slaughterhouse can also become a potential source of bacterial contamination. As a vital part of the livestock industry that provides meat for millions of people worldwide [2,3,4], it is crucial to address several aspects of slaughterhouses’ health and safety procedures. These aspects, including butchering and preparing animals on bare floors contaminated with blood and feces, pose a risk to the public [5,6,7,8]. Studying meat microbes can help determine which slaughtering techniques are most successful in minimizing and controlling contaminants during the process. Additionally, the microbiological characteristics of meat can serve as a good indicator of its sanitary value [8,9,10]. The lack of proper slaughtering facilities, sanitation, and corpse processing may be responsible for the elevated levels of bacteria in meat.

In most cases, the level of bacteria found on corpses significantly affects the condition of livestock before slaughter and manufacturing, as well as the sanitation of slaughterhouses, preparation areas, and commercialization facilities. To ensure meat safety, it is crucial to only slaughter healthy and generally clean animals. Obtaining clean and pathogen-free meat from sick and dirty animals is extremely challenging [11,12]. Food contamination can occur through contact with meat surfaces, such as the hands and clothes of meat handlers outside the slaughterhouse, hardwood tables, cutting blades, weighing scales, and water-holding equipment such as metal and plastic containers, carts, and meat elevators. Therefore, the number of bacteria in a sample is often used as a measure of potential danger to humans [13,14,15]. Underdeveloped nations are particularly vulnerable to foodborne infections due to widespread food and hygiene negligence, insufficient food safety regulations, inadequate governance structures, lack of funding for secure facilities, and inadequate training for food handlers [14,16,17]. When slaughterhouses are not properly controlled, they can significantly contribute to microbial contamination [18,19,20].

It has been reported that approximately 30% of the total population in industrialized countries suffers from foodborne illness annually [21]. Globally, there are an estimated 76 million cases of foodborne illnesses per year, resulting in around 325,000 hospitalizations and 5000 deaths [22]. The level of contamination and the nature of the microbe also depend on whether it originates from animals or plants.

The most common pathogenic bacteria that contaminate food are Escherichia coli and Salmonella species. Typically, water-contaminated food is how these bacteria spread to humans [23]. E. coli is particularly dangerous as it can cause diseases in humans, such as urinary tract infections, sepsis, and neonatal meningitis [24]. Salmonella infection is a significant public health concern globally as a foodborne illness. In 2019, there were 90,105 recorded cases of human salmonellosis in the European Union (EU), with 9718 of those cases reported in the United Kingdom (UK). Each year, gastroenteritis caused by Salmonella species results in 93.8 million cases of illness and 155,000 fatalities worldwide [25].

Contaminated meat is one of the main sources of foodborne illnesses and deaths caused by ingested agents. This is a complex issue due to underlying causes that can be related to microbiology. Despite advancements in food science and technology, food spoilage remains a global problem [26]. Such spoilage results in significant economic losses for producers, retailers, and consumers [27]. The transmission of pathogens can occur through the fecal–oral route, either through direct contact with the feces of infected individuals at wastewater treatment facilities or through contaminated water or food, leading to serious health consequences [28,29].

Klebsiella has been associated with environmental contaminants in patient groups, often colonizing the oropharynx and gastrointestinal tract of humans. Once inside the body, these bacteria can exhibit high levels of virulence and antibiotic resistance [30]. This study aimed to isolate and molecularly detect pathogenic bacteria from sheep meat in slaughterhouses in Riyadh City, Saudi Arabia. Additionally, the sensitivity of these bacteria to various antimicrobials was evaluated. The slaughtering process involves multiple crucial steps that impact meat quality. This study will benefit various organizations, including the government, municipality, and health sector, by assessing, revising, and improving meat processing methods to control potential food poisoning outbreaks.

2. Materials and Methods

2.1. Experimental Study Design

This study aimed to assess the bacterial contamination in slaughterhouses that can lead to meat spoilage. In total, 150 samples (85 swabs and 65 water samples) were collected three times, every two months, from November 2021 to March 2022. The samples were obtained from four abattoirs located in different directions of Riyadh: south, west, east, and north.

2.2. Collection and Preparation of Samples

2.2.1. Collection of Water Samples from Various Sources in the Abattoirs

The samples were collected from four abattoirs situated in different regions of Riyadh: abattoir A (south), abattoir B (west), abattoir C (east), and abattoir D (north). The collection took place during the early morning hours, specifically between 7 a.m. and 10 a.m. Sterile 500 mL glass tubes with dust-proof screw-on stoppers were used for sample collection. At the slaughterhouses, wastewater samples were collected from the discharge point, which was located 100 mm below the surface. The samples were taken from a well-mixed point close to the discharge location. Additionally, samples were taken from the receiving water body, both 100 m upstream and downstream, before and after the combination of slaughterhouse wastewater. The water bottles were filled to a height of approximately 3 cm. To ensure proper preservation, the samples were stored on ice during transportation to the testing facility, which was the Microbiology Laboratory of the Department of Botany and Microbiology at King Saud University in Riyadh. The collected samples were promptly refrigerated until they were ready for analysis.

2.2.2. Collection of Swab Samples from Carcasses and Tools from Abattoirs

Physical examinations were conducted at each abattoir to assess their overall characteristics and butchering methods. The researchers carefully observed the methods of slaughter, blood removal procedures, meat-slicing techniques, handling of slaughtered animals, preparation of skin, manipulation during dissection, and removal of fat from subcutaneous layers. Swab samples were taken from the meat carcasses of sheep. At abattoir A, an average of 90 animals were slaughtered per day, 65 at abattoir B, 75 at abattoir C, and 90 at abattoir D. The numbers of workers at abattoirs A, B, C, and D were 68, 35, 37, and 42, respectively. Municipal inspection officers visited each abattoir every morning to observe the animals, and each abattoir had a group under the direction of an executive director. Samples were collected from various areas of the carcasses and tools used during the slaughter process, including animal cleaning, skin removal, removal of intestinal organs, and knives and saws used for cutting. Sterile cotton swabs with transfer media (FL Medical, Torreglia, Italy) were used and stored in an icebox. The collected samples were then transferred to the Microbiology Laboratory in the Department of Botany and Microbiology at King Saud University in Riyadh.

2.3. Isolation Procedures for Major Food- and Water-Borne Bacteria Using Selective Media

2.3.1. Swab Samples Procedure

Under aseptic conditions, each swab sample was placed in 9 mL of sterile buffered peptone water. The buffer composition included casein peptone at a concentration of 10 g/L, di-sodium hydrogen phosphate 12 H₂O at a concentration of 9 g/L, potassium dihydrogen phosphate at a concentration of 1.5 g/L, and sodium chloride at a concentration of 5 g/L (Merck KGaA, Darmstadt, Germany). The sample was thoroughly mixed using a vortex mixing device [31]. To create a series of ten-fold dilutions of 10–8, 1 mL of the original suspension was mixed with 9 mL of buffered peptone water. Eosin Methylene Blue agar (EMB) was used to isolate E. coli, Salmonella Shigella Agar (SSA) for Salmonella, Cetrimide Agar (CA) for Pseudomonas, and Baird Parker Agar (BPA) for Staphylococcus aureus (S. aureus) isolation. All selective media used in this study were purchased from Sigma-Aldrich, Burlington, MA, USA. The media were prepared according to the manufacturer’s instructions, poured into sterile Petri dishes, gently stirred, and allowed to set. Then, 0.1 mL of the diluted sample was spread on the prepared medium using the standard spread plate method. The plates were then turned over and kept at 37 °C for 48 to 72 h [32] to observe whether each successive dilution allowed aerobic growth.

2.3.2. Water Sample Procedure

The Most Probable Number (MPN) method, as recommended previously [33], was used with three tubes. To determine the MPN of coliforms, 10 mL, 1 mL, and 0.1 mL samples of water were added to lauryl tryptose broth medium (HiMedia Laboratories LLC, Mumbai, Maharashtra, India). An inverted Durham’s tube (Jiangsu Jingxin, Huangqiao, China) was included to count presumptive coliforms. The next step was to confirm the results using clean test tubes with brilliant green bile broth medium (Biokar Diagnostics, Solabia, Oise, France) and an upside-down Durham tube to identify positive tubes in the lauryl tryptose broth. Agars purchased from Sigma-Aldrich, Burlington, MA, USA, including sterilized EMB, SSA, CA, and BPA, were prepared according to the manufacturer’s recommendations. Once prepared, the agars were placed on sterile Petri dishes and allowed to set for 24 h. For E. coli MPN, a loopful from each positive brilliant green bile broth tube was streaked onto the surface of an EMB agar plate. After 24 h of incubation at 37 °C, the following observations were made: on the EMB agar, the E. coli isolates appeared black with a green metallic sheen; some had pink colonies, some had pink mucoid colonies, and some had no color; Klebsiella colonies appeared as brown, dark, centered, and mucoid colonies; Salmonella colonies appeared large and colorless to yellowish-brown [34]; Pseudomonas colonies appeared as blue-green and yellow-green.

2.4. Bacterial Identification and Antibiotic Sensitivity Assessment of the Bacteria by VITEK 2 System

In this study, the Vitek 2 system (bioMérieux, Marcy l’Etoile, France) was used to identify and test the antibiotic sensitivity of all species at Alborg Medical Laboratories in Riyadh City, Saudi Arabia, following the manufacturer’s instructions. Gram-negative identification (GNI) cards, Gram-positive identification (GPI) cards, and antibiotic susceptibility testing (AST) cards were utilized for this purpose. To conduct the identification technique, 2–3 fresh colonies were completely dissolved in a sterilized physiological salt solution (0.45% NaCl in water, pH 4.5 to 7.0). The McFarland turbidity was adjusted from 0.50 to 0.63 using DensiChekTM (BioMerieux, Marcy-l’Étoile, France). Five milliliters of the adjusted suspension were added to the Vitek 2 ID-GNI and ID-GPI cards. Finally, the Vitek 2 cassette with cards and suspension tubes was inserted into the device. The unidentified bacteria were compared with the reference strains recorded in Vitek 2 software to ensure correct identification. Similarly, the AST-GP67, AST-N292, and AST-N291 cards were used in the same manner of identification to determine the AST by replacing the ID cards with AST cards. Based on the interpretation guidelines provided by NCCLS [35], the MICs classified bacterial susceptibility into susceptible, moderate, or resistant categories.

2.5. Molecular Detection of Virulence Genes

2.5.1. DNA Extraction

In brief, 1.75 mL of each bacterial culture was added to a labeled 2 mL tube. The tubes were then rotated at 20,000× g for 5 min in a centrifuge, and the liquid was decanted. Next, 180 µL of enzymatic lysis buffer was added to each tube, which was then vortexed for 10–20 s and incubated at 37 °C for 30 min. Following this, 25 µL of proteinase K and 200 µL of Buffer AL were added to the tube. The mixture was properly vortexed and incubated at 56 °C for 30 min. Subsequently, 200 µL of 100% ethanol was added to the tube and thoroughly vortexed. Using a micropipette, the entire contents (approximately 600 µL) of the tube were transferred to a labeled spin column. The column was then centrifuged at 10,000× g for 1 min and removed from the collection tube. Next, 500 µL of buffer AW1 was added to the column and centrifuged at 10,000× g for 1 min. The column was once again removed from the collection tube and placed in a new one. Subsequently, 500 µL of buffer AW2 was added to the column and centrifuged at 20,000× g for 3 min. After carefully removing the tubes from the centrifuge, the column was transferred to a 1.5 mL tube. Then, 200 µL of buffer AE was added to the column and left to stand at room temperature for 1 min. The column was subsequently centrifuged at 10,000× g for 1 min. Finally, the column was discarded and the DNA was appropriately stored (4 °C for the short term, −20 °C for the long term).

2.5.2. Detection of Virulence Genes of Recovered Isolates

All primers used in the current study are shown in Table 1; they were synthesized by a Macrogen company (Gasan-dong, Seoul, South Korea). The E. coli target genes were Sfa/focDE (E1), papC (E2), and fimH (E3). The virulence factors of these genes are S and FIC fimbriae for Sfa/focDE, P fimbriae for papC, and type 1 fimbriae for fimH. Sequences were determined through multiplex PCR with a 60 °C annealing temperature; the amplified sequences are shown in Table 1 [36]. The K. pneumoniae virulence genes used in this study were rmpA (K1), which targets the regulator of mucoid phenotype A; ybtS (K2), which targets siderophore; and mrkD (K3), which targets adhesion type 3 fimbriae [37]. Sequences were determined through multiplex PCR with a 60 °C annealing temperature; the amplified sequences are shown in Table 1 [38].

The P. aeruginosa virulence genes used in this study were bifunctional enzymes (exoS) (P1) [39,40], hemolysin phospholipase (pclH) (P2), and enterotoxin gene toxA (P3). Sequences were determined through multiplex PCR with a 58 °C annealing temperature; the amplified sequences are shown in Table 1 [41]. The S. enterica virulence genes used in this study were aggregative fimbriae (agfA) (S1), Salmonella pathogenicity island-3 (misL) (S2), and Salmonella-specific invasive (invA) (S3) [42]. The reactions were performed either uniplex (invA) with a 57 °C annealing temperature or multiplex (misL and agfA) with a 63 °C annealing temperature, as described in Table 1.

Table 1. Bacteria virulence genes, primers sequences, amplicon size, and annealing temperature.

Organism	Gene	Primer 5–3	Annealing	Size	Reference
E. coli	Sfa/focDE (E1)	F: CTCCGGAGAACTGGGTGCATCTTAC R: CGGAGGAGTAATTACAAACCTGGCA	60 °C	410 bp	[36]
	papC (E2)	F: GACGGCTGTACTGCAGGGTGTGGCG R: ATATCCTTTCTGCAGGGATGCAATA		328 bp
	fimH (E3)	F: AACAGCGATGATTTCCAGTTTGTGTG R: ATTGCGTACCAGCATTAGCAATGTCC		465 bp
K. pneumoniae	rmpA (K1)	F: CATAAGAGTATTGGTTGACAG R: CTTGCATGAGCCATCTTTCA	60 °C	461 bp	[43]
	ybtS (K2)	F: GACGGAAACAGCACGGTAAA R: GAGCATAATAAGGCGAAAGA		242 bp
	mrkD (K3)	F: AAGCTATCGCTGTACTTCCGGCA R: GGCGTTGGCGCTCAGATAGG		340 bp
P. aeruginosa	exoS (P1)	F: CCTTCCCTCCTTCCCCCCGGCGATCTGGA R:AAAGAAATGCATCCTCAGGCGTACATCCT	58 °C	270 bp	[41]
	pclH (P2)	F: GAAGCCATGGGCTACTTCAA R: AGAGTGACGAGGAGCGGTAG		307 bp
	toxA (P3)	F: ATGGTGTAGATCGGCGACAT R: AAGCCTTCGACCTCTGGAAC		433 bp
S. enterica	agfA (S1)	F: TCCGGCCCGGACTCAACG R: CAGCGCGGCGTTATACCG	63 °C	261 bp	[42]
	misL (S2)	F: GACGTTGATAGTCTGCCATCCAG R: CAATGCCGCCAGTCTCCGTGC		986 bp
	invA (S3)	F: CTGCTTTCTCTACTTAACAGTGCTCG R: CGCATCAATAATACCGGCCTTC	57 °C	413 bp

Table 1. Bacteria virulence genes, primers sequences, amplicon size, and annealing temperature.

Organism	Gene	Primer 5–3	Annealing	Size	Reference
E. coli	Sfa/focDE (E1)	F: CTCCGGAGAACTGGGTGCATCTTAC R: CGGAGGAGTAATTACAAACCTGGCA	60 °C	410 bp	[36]
	papC (E2)	F: GACGGCTGTACTGCAGGGTGTGGCG R: ATATCCTTTCTGCAGGGATGCAATA		328 bp
	fimH (E3)	F: AACAGCGATGATTTCCAGTTTGTGTG R: ATTGCGTACCAGCATTAGCAATGTCC		465 bp
K. pneumoniae	rmpA (K1)	F: CATAAGAGTATTGGTTGACAG R: CTTGCATGAGCCATCTTTCA	60 °C	461 bp	[43]
	ybtS (K2)	F: GACGGAAACAGCACGGTAAA R: GAGCATAATAAGGCGAAAGA		242 bp
	mrkD (K3)	F: AAGCTATCGCTGTACTTCCGGCA R: GGCGTTGGCGCTCAGATAGG		340 bp
P. aeruginosa	exoS (P1)	F: CCTTCCCTCCTTCCCCCCGGCGATCTGGA R:AAAGAAATGCATCCTCAGGCGTACATCCT	58 °C	270 bp	[41]
	pclH (P2)	F: GAAGCCATGGGCTACTTCAA R: AGAGTGACGAGGAGCGGTAG		307 bp
	toxA (P3)	F: ATGGTGTAGATCGGCGACAT R: AAGCCTTCGACCTCTGGAAC		433 bp
S. enterica	agfA (S1)	F: TCCGGCCCGGACTCAACG R: CAGCGCGGCGTTATACCG	63 °C	261 bp	[42]
	misL (S2)	F: GACGTTGATAGTCTGCCATCCAG R: CAATGCCGCCAGTCTCCGTGC		986 bp
	invA (S3)	F: CTGCTTTCTCTACTTAACAGTGCTCG R: CGCATCAATAATACCGGCCTTC	57 °C	413 bp

2.5.3. PCR for the Detection of Virulence Genes in Isolated Bacteria

A multiplex PCR was conducted following the manufacturer’s instructions. The total reaction volume was 25 µL, which included 2 µL of bacterial genomic DNA, 12.5 µL of the master mix, 3.9 µL of deionized distilled water, and 0.2 pmol/µL for each primer (total concentrations of all primers = 2.4 pmol/μL) (see Table 1). The negative control contained 12.5 µL of the master mix and 12.5 µL of deionized distilled water. The PCR conditions were as follows: initial denaturation at 95 °C for 5 min; denaturation at 95 °C for 1 min; annealing temperature for E. coli virulence genes and K. pneumoniae virulence genes was multiplex at 60 °C for 1 min; P. aeruginosa virulence genes were multiplexed at 58 °C; and S. enterica was multiplexed at 63 °C and monoplexed at 57 °C for 1 min. Extension occurred at 72 °C for 1 min, and the final extension was at 72 °C for 5 min. The number of cycles from denaturation to extension was 35 cycles. PCR products were separated by electrophoresis on 2% agarose gels for two hours. After being stained with ethidium bromide, the amplification products were visualized under UV light.

3. Results

3.1. Phenotypic Identification of Bacterial Species

Based on the culturing technique, a total of 53 bacterial isolates were recovered from 150 abattoir samples, which consisted of 85 swabs and 65 water samples. As shown in

Table 2. The overall number of samples, number, and percentage (%) of pathogenic positive strains identified by culturing and biochemical methods.

Type of Specimens	No. of Specimens	E. coli	K. pneumoniae	S. enterica	P. aeruginosa
Swabs	85	4 (4.7%)	2 (2.3%)	11 (12.9%)	0 (0%)
Water	65	14 (21.5%)	12 (18.4%)	0 (0%)	10 (15.3%)
Total	150	18 (12%)	14 (9.3%)	11 (7.3%)	10 (6.6%)

, among these isolates, 18 (12%) were identified as E. coli, 14 (9.3%) as K. pneumoniae, 11 (7.3%) as S. enterica, and 10 (6.6%) as P. aeruginosa. Out of the 85 swab samples, 17 bacterial isolates were identified. The most common isolates were S. enterica (11, 12.9%), followed by 4 isolates of E. coli (4.7%), and 2 isolates of K. pneumoniae (2.3%). On the other hand, out of the 65 water samples, 36 isolates were identified, with 14 (21.5%) being E. coli, 12 (18.4%) being K. pneumoniae, and 10 (15.3%) being P. aeruginosa. These results indicate that E. coli, K. pneumoniae, and P. aeruginosa were detected in higher percentages in water samples compared with swab samples. Additionally, S. enterica was only detected in swab samples, while P. aeruginosa was only found in water samples.

Biochemical analysis of all bacterial isolates was carried out using the Vitek 2 Compact identification system; the results are reported as correctly identified, misidentified, or not identified. Based on our findings, the Vitek 2 Compact correctly identified ten species of Gram-negative and Gram-positive bacteria. Of these, seven were Gram-negative and three were Gram-positive. The seven Gram-negative isolates were named Citrobacter freundii, E. coli, K. pneumoniae, S. enterica, P. aeruginosa, Enterobacter cloacae complex, and P. aeruginosa. The three Gram-positive isolates were identified as Staphylococcus saprophyticus, Staphylococcus hominis, and Kocuria varians. Out of these strains, four were considered pathogenic: E. coli, Klebsiella pneumoniae, S. enterica, and P. aeruginosa. Table 2 shows the number and percentage of positive strains for each of these pathogenic bacteria.

3.2. Positive Samples According to Period and Abattoirs

The growth of pathogenic bacteria varied across different periods and abattoirs when samples were collected. When considering the types of abattoirs, out of the 53 bacterial isolates, 31 were detected in abattoir D. Additionally, 9 isolates were obtained from abattoir A, 7 from abattoir B, and 6 from abattoir C. The prevalence of bacteria in the four abattoirs (A, B, C, and D) was as follows: 2, 6, 1, and 9 for E. coli; 5, 0, 2, and 7 for K. pneumoniae; 0, 0, 3, and 8 for S. enterica; and 2, 1, 0, and 7 for P. aeruginosa, respectively. Regarding the period of sample collection (

Table 3. Positive samples according to period and abattoir.

Period	Abattoir A		Abattoir B		Abattoir C		Abattoir D		Total
	No. of Samples	No. of Positive E. coli	No. of Samples	No. of Positive E. coli	No. of Samples	No. of Positive E. coli	No. of Samples	No. of Positive E. coli
November 2021	12	0	13	2	12	0	13	3	5 (10%)
January 2022	12	2	13	3	12	1	13	3	9 (18%)
March 2022	12	0	13	1	12	0	13	3	4 (8%)
Total	36	2 (5.5%)	39	6 (15.3%)	36	1 (2.5%)	39	9 (25%)	18 (12%)
Period	Abattoir A		Abattoir B		Abattoir C		Abattoir D		Total
	No. of Samples	No. of Positive K. pneumoniae	No. of Samples	No. of Positive K. pneumoniae	No. of Samples	No. of Positive K. pneumoniae	No. of Samples	No. of Positive K. pneumoniae
November 2021	12	2	13	0	12	0	13	2	4 (8%)
January 2022	12	2	13	0	12	2	13	2	6 (12%)
March 2022	12	1	13	0	12	0	13	3	4 (8%)
Total	36	5 (13%)	39	0 (0%)	36	2 (5%)	39	7 (18%)	14 (9.3%)
Period	Abattoir A		Abattoir B		Abattoir C		Abattoir D		Total
	No. of Samples	No. of Positive S. enterica	No. of Samples	No. of Positive S. enterica	No. of Samples	No. of Positive S. enterica	No. of Samples	No. of Positive S. enterica
November 2021	12	0	13	0	12	0	13	0	0 (0%)
January 2022	12	0	13	0	12	3	13	5	8 (16%)
March 2022	12	0	13	0	12	0	13	3	3 (6%)
Total	36	0 (0%)	39	0 (0%)	36	3 (7.6%)	39	8 (22.2%)	11 (7.3%)
Period	Abattoir A		Abattoir B		Abattoir C		Abattoir D		Total
	No. of Samples	No. of Positive P. aeruginosa	No. of Samples	No. of Positive P. aeruginosa	No. of Samples	No. of Positive P. aeruginosa	No. of Samples	No. of Positive P. aeruginosa
November 2021	12	0	13	0	12	0	13	1	1 (2%)
January 2022	12	1	13	0	12	0	13	2	3 (6%)
March 2022	12	1	13	1	12	0	13	4	6 (12%)
Total	36	2 (5.5%)	39	1 (2.5%)	36	0 (0%)	39	7 (19.4%)	10 (6.6%)

), it appeared that samples taken in January and March 2022 indicated the largest number of bacteria isolated from abattoir D (Figure 1 and Figure 2).

3.3. Antibiotic Sensitivity Test by Vitek 2 System

Based on the interpretation guidelines provided by NCCLS [35], the Vitek 2 system classified bacterial susceptibility into susceptible, moderate, or resistant categories. According to the results obtained in this study, the identified bacteria showed variable susceptibility to the tested antibiotics. As shown in

Table 4. The antibiotic resistance and susceptibility profiles of E. coli, K. pneumoniae, S. enterica, and P. aeruginosa isolates from swab and water samples of various abattoirs.

AST	E. coli (n = 18)				K. pneumoniae (n = 14)				S. enterica (n = 11)				P. aeruginosa (n = 10)
	Resistant		Susceptible		Resistant		Susceptible		Resistant		Susceptible		Resistant		Susceptible
	No. of Isolates	%	No. of Isolates	%	No. of Isolates	%	No. of Isolates	%	No. of Isolates	%	No. of Isolates	%	No. of Isolates	%	No. of Isolates	%
Ampicillin	0	0	18	100	14	100	0	0	11	100	0	0	10	100	0	0
Amoxicillin/Clavulanic Acid	2	11.11	16	88.89	0	0	14	100	0	0	11	100	2	20	8	80
Piperacillin/Tazobactam	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Cefalotin	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Cefoxitin	0	0	18	100	0	0	14	100	0	0	11	100	2	20	8	80
Ceftazidime	0	0	18	100	3	21.43	11	78.57	0	0	11	100	0	0	10	100
Ceftriaxone	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Cefepime	3	16.67	15	83.33	0	0	14	100	0	0	11	100	3	30	7	70
Imipenem	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Meropenem	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Amikacin	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Gentamicin	2	11.11	16	88.89	0	0	14	100	11	100	0	0	0	0	10	100
Ciprofloxacin	3	16.67	15	83.33	0	0	14	100	11	100	0	0	0	0	10	100
Tigecycline	0	0	18	100	2	14.29	12	85.71	0	0	11	100	10	100	0	0
Nitrofurantoin	0	0	18	100	0	0	14	100	0	0	11	100	0	0	10	100
Trimethoprim/Sulfamethoxazole	0	0	18	100	3	21.43	11	78.57	11	100	0	0	0	0	10	100

, all E. coli isolates were 100% sensitive to ampicillin, piperacillin/tazobactam, cefalotin, cefoxitin, ceftazidime, ceftriaxone, imipenem, meropenem, amikacin, tigecycline, nitrofurantoin, and trimethoprim/sulfamethoxazole. However, some E. coli isolates showed a certain degree of resistance to cefepime (16.67%), ciprofloxacin (16.67%), amoxicillin/clavulanic acid (11.11%), and gentamycin (11.11%).

K. pneumoniae isolates were 100% resistant to ampicillin, with 16.67% resistance to ceftazidime, trimethoprim/sulfamethoxazole, and 14.29% resistance to tigecycline. On the other hand, all K. pneumoniae isolates were 100% sensitive to the remaining tested antibiotics. Regarding S. enterica, all isolates were resistant to ampicillin, gentamicin, ciprofloxacin, and trimethoprim/sulfamethoxazole, while showing 100% sensitivity to the remaining tested antimicrobial agents. P. aeruginosa exhibited a 100% resistance rate to ampicillin and tigecycline, with 30% resistance to cefepime and 20% resistance to both amoxicillin/clavulanic acid and cefoxitin.

3.4. Detection of Virulence Genes

A multiplex polymerase chain reaction (PCR) was used to detect virulence genes in four different species: E. coli, K. pneumoniae, P. aeruginosa, and S. enterica. Twelve genes, three for each species, were tested in this study (Table 1). The FimH (E3) gene was positive at 465 bp for all of the E. coli isolates that were tested. However, the Sfa/focDE (E1) and papC (E2) genes could not be found (Figure 3). In all K. pneumoniae isolates, the MrkD (K3) gene was detected at 340 bp. However, the other two genes, rmpA (K1) and ybtS (K2), were not found in any K. pneumoniae isolates. For all tested P. aeruginosa isolates, the pclH (P2) and toxA (P3) genes were identified at 307 bp and 433 bp, respectively. The exoS (P1) gene was not detected in any of the tested P. aeruginosa isolates (Figure 4). The genes agfA (S1), misL (S2), and invA (S3), which are specific to S. enterica, were not found in any of the isolates examined in this investigation. This indicates that not all of these genes contribute to virulence or are necessary for the pathogenicity of S. enterica. The results of this study are consistent with those of other studies that have demonstrated S. enterica can produce genes associated with virulence without the assistance of agfA, misL, or invA. It is possible that we could have obtained positive results if we had tested more Salmonella-specific virulence genes. However, due to financial limitations, we were only able to test three genes per species of bacteria under investigation.

4. Discussion

In the absence of foodborne hygiene measures, abattoirs contribute to an increased prevalence of foodborne illnesses and safety concerns [13,44]. The current investigation reveals that there is no clear distinction between the different stages of slaughtering, including stunning, bleeding, slicing, eviscerating, hanging, and carving or deboning. Additionally, local slaughterhouses lack protective measures against rodent and insect infestations, which aligns with previous studies conducted by Haileselassie et al. [45] and Bersisa et al. [13].

Bacteria, fungi, molds, and viruses are among the microbes that grow in food derived from animals and their processed products [46]. Many different microorganisms feed on meat, which can lead to contamination [47]. Microbial infections in livestock meat can potentially start when the skin is punctured during the removal of blood from the carcass [48]. This is especially true if workers’ instruments and supplies are not clean. Throughout the process of preparing meat, processing carcasses, slicing meat, manufacturing processed meat products, transporting, storing, and marketing meat products, the outermost layer of the meat can become contaminated [13,49]. Therefore, anything that comes into contact with meat, either directly or indirectly, may become infected with microbes.

According to the current study, E. coli (12%) was the most commonly recovered bacteria, followed by K. pneumoniae (9.3%), S. enterica (7.3%), and P. aeruginosa (6.6%). E. coli was found in all four abattoirs, as detailed in Table 3: abattoir A (5.5%), abattoir B (15.3%), abattoir C (2.5%), and abattoir D (25%). These findings are similar to those of Ogunnusi et al. [50] and Khalafalla et al. [34], who isolated E. coli from wastewater samples at a rate of approximately 33%. The danger of this bacterium is its ability to cause diseases in humans, such as urinary tract infections, sepsis, and neonatal meningitis [51]. E. coli is now internationally acknowledged as the most appropriate indicator of fecal pollution because the possible source of these bacteria is the intestines of humans or animals [52,53]. In this study, E. coli isolates were sensitive to the majority of tested antimicrobials, as shown in Table 4. This means that they are treatable with antibiotics. Similar results were obtained by Adzitey [54], who tested 45 E. coli isolates from beef samples at Wa abattoir in Ghana against commonly used antibiotics. The study found that 80% of the isolates were susceptible to amoxicillin/clavulanic acid, ceftriaxone, chloramphenicol, ciprofloxacin, gentamicin, sulfamethoxazole/trimethoprim, and ceftriaxone. However, Darwish et al. [55] indicated that E. coli isolated from Egyptian beef exhibited resistance to 23.8% of chloramphenicol, 42.8% of ciprofloxacin, 19.0% of gentamicin, and 80.9% of trimethoprim/sulfamethoxazole. The PCR results revealed a positive for FimH (E3), as shown in Figure 3. Similar results were found by Tiba et al. [56]. A previous investigation by Hojati et al. (2015) revealed that the FimH gene was present in 130 isolates (92.8%) of uropathogenic E. coli strains. Among the 130 FimH-positive isolates, 62 (47.7%) were associated with inpatient care and 68 (52.3%) were associated with outpatient care, respectively. This means that they may cause contamination and human diseases.

S. enterica was another important type of bacteria found in this study. It was found in abattoir C (7.6%) and abattoir D (22.2%), as described in Table 3. Similar results were obtained by Nyeleti et al. [57], who conducted a study testing 235 pieces of cattle meat for Salmonella contamination. They discovered that beef cuts, such as the diaphragm and abdominal muscles, had higher contamination rates. These findings indicate a significant risk of cross-infection during the slaughtering process. Another study performed by Tadesse et al. [58] revealed that the Salmonella species was found in 3.86% of goat carcasses, 4.53% of beef carcasses, 8.34% of minced beef, and 10.76% of milk. More than 2600 serovars of S. enterica have been identified so far; many of these serovars can infect both people and animals with disease [42]. Salmonella contamination and dissemination can occur from tainted milk, meat, eggs, and other agricultural products fertilized and grown in manure infected with Salmonella [59].

In this study, S. enterica demonstrated a higher degree of resistance (100%) to ampicillin, gentamicin, ciprofloxacin, and trimethoprim/sulfamethoxazole, as shown in Table 4. A previous study conducted by Al-Hindi et al. [60] assessed the antibiotic susceptibility of Salmonella isolates obtained from 112 chilled chicken carcasses in Jeddah, Saudi Arabia. The study found that fewer isolates were resistant to a single class of antibiotics, while the majority of isolates displayed resistance to multiple classes of antibiotics. Interestingly, despite being resistant to cephalosporins, most of the isolates remained susceptible to carbapenem. In another study, Wang et al. [61] collected chicken carcass samples from six different regions in China. The study highlighted the development of resistance to foodborne infections due to the widespread use of cephalosporin antibiotics in livestock feed. Similarly, in Malaysian broiler farms, Ibrahim and colleagues [62] documented a significant prevalence of multidrug-resistant E. coli and Salmonella species, attributing this to the excessive use of antimicrobial agents on the farms. The PCR test in this study revealed negative results for all S. enterica virulence genes, as shown in Figure 4. Interestingly, Mezal et al. [42] obtained different results after isolating 60 S. enterica isolates from 28 poultry houses and 32 clinical samples. They found that 12 or more of the 17 virulence genes (spvB, spiA, pagC, msgA, invA, sipB, prgH, spaN, orgA, tolC, iroN, sitC, IpfC, sifA, sopB, and pefA) were positive, while one gene was negative.

K. pneumoniae, an important type of bacteria, was found in this study. It was found in abattoir A (13%), abattoir C (5%), and abattoir D (18%), as described in Table 3. This finding aligns with those of Abebe Bersisa et al. [13]. K. pneumoniae is a pathogenic bacterium and a leading cause of hospital-acquired infections, including pneumonia and bloodstream infections [63]. Humans can be colonized by K. pneumoniae in the cutaneous, oropharyngeal, or gastrointestinal tract [64]. The most well-known virulence factors in K. pneumoniae are its siderophores, capsules, lipopolysaccharides (LPS), and fimbriae, which play important roles in adhesion, colonization, invasion, and infection growth [65].

In this study, K. pneumoniae displayed 100% resistance against ampicillin, followed by ceftazidime (16.67%), trimethoprim/sulfamethoxazole (16.67%), and tigecycline (14.29%), as shown in Table 4. In contrast, all K. pneumoniae isolates showed 100% sensitivity to amoxicillin/clavulanic acid, piperacillin/tazobactam, cefalotin, cefoxitin, ceftriaxone, cefepime, imipenem, meropenem, amikacin, gentamicin, ciprofloxacin, and nitrofurantoin. A similar finding was observed by Nakhaee et al. [66] in their investigation of antibiotic sensitivity to K. pneumoniae collected from a flock of 250 one-year-old canaries. They found that the K. pneumoniae isolates could be treated with ciprofloxacin and gentamicin as part of the considered protocol. Another study [67] identified isolates resistant to ampicillin, cefazolin, cefixime, erythromycin, chloramphenicol, and florfenicol, but responsive to gentamicin and ciprofloxacin.

Therefore, several factors, including species, age, infection route, environmental conditions, and bacterial resistance profiles, may contribute to these similar and contradictory findings regarding the antibiotic susceptibility of K. pneumoniae. Ampicillin is one of the most commonly used antibiotics today [68]; therefore, resistance to this antibiotic is a problem. The PCR results were positive for mrkD (K3), which is in agreement with previous reports [69,70,71], as shown in Figure 4. This indicates that ampicillin resistance may lead to contamination and human diseases.

P. aeruginosa, an important type of bacteria, was identified in this study. It was detected in abattoir A (5.5%), abattoir B (2.5%), and abattoir D (19.4%), as shown in Table 3. These findings align with the studies conducted by Igbinosa and Obuekwe [72] and Odjadjare et al. [73]. P. aeruginosa is known to contribute significantly to antibiotic resistance and nosocomial infections [74]. It is considered an opportunistic bacterium associated with healthcare infections, including ventilator-associated pneumonia, surgical site infections, urinary tract infections, burn wound infections, keratitis, and otitis media [75]. Additionally, it is commonly found in water systems [76,77]. In our study, P. aeruginosa only showed resistance to tigecycline, as indicated in Table 4. This antibiotic resistance is concerning. The PCR results confirmed the presence of plcH (P2) and toxA (P3), which is consistent with previous investigations [78,79], as shown in Figure 4. This indicates that P. aeruginosa may cause contamination and human diseases.

Previous research has shown that slaughterhouses with deteriorated floors and walls, as well as those lacking an automated chain, pose a higher risk of microbial contamination. Common microorganisms found in such slaughterhouses include E. coli and Salmonella species. Collobert et al. [80] suggest that the increased bacterial presence in these abattoirs indicates a lack of proper hygiene practices and inadequate sanitary policies. Floors can serve as a reservoir for contaminants, which can then be spread to workers’ footwear, allowing pathogenic bacteria to be carried from one area to another within the slaughterhouse. Furthermore, drains and floors can provide an ideal environment for the growth and multiplication of microbes, especially when cleaned with high-pressure water. This can potentially lead to the spread of germs through water droplets in the air [81].

Improper handling hygiene is a significant factor in the transmission of bacteria such as E. coli and Salmonella species. Bensid [82] states that these pathogenic bacteria are primarily found in the hair and feces of deceased animals. If the practitioners’ devices and supplies are not sanitary, bacterial infections may occur from the first cut in the skin, which is intended to remove blood from the animal. Lack of hygiene and incorrect evisceration can lead to rapid bacterial growth on corpses [83,84]. Consequently, blades, cutting tools, and other equipment may become contaminated, and dangerous microorganisms can spread to other corpses. Several authors have emphasized the importance of knife decontamination between carcasses to prevent cross-contamination [85,86]. It is also possible for meat to become tainted while being rinsed at abattoirs due to the use of water [87,88]. Abattoirs use drinking water for cleaning and preparing meat. Therefore, it is crucial to have sufficient potable water for operational and cleaning purposes. Regular analysis of the water is necessary to ensure its purity [89].

5. Conclusions

According to the current study, E. coli was the most commonly recovered bacteria, followed by K. pneumoniae, S. enterica, and P. aeruginosa. High numbers of bacteria were isolated from abattoir D in January. K. pneumoniae and S. enterica exhibited resistance to various types of tested antimicrobial agents, while E. coli did not display any resistance. Therefore, we can conclude that pathogenic bacteria resistant to antibiotics pose a danger. Additionally, pathogenic bacteria that tested positive for virulence genes may cause contamination and human diseases. The use of hygiene standards in slaughterhouses has been found to address some risk indicators for potential harmful bacterial contamination. Further research is necessary to identify all relevant risk factors and assess the effectiveness of remedial measures. There is an urgent need for monitoring and surveillance programs to ensure food safety and human health.