In-Situ Thermoresponsive Hydrogel Containing Resveratrol-Loaded Nanoparticles as a Localized Drug Delivery Platform for Dry Eye Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Physico-Chemical Characterization of RSV-Loaded Nanoparticles (RSV-NPs)
2.3. Mucoadhesion of RSV-NPs
2.4. Preparation of RSV-Loaded Hydrogels (RSV@Tgels)
2.5. RSV@Tgels Characterization
2.5.1. Rheological and Mechanical Studies
2.5.2. Gelation Time
2.5.3. Short-Term Stability Studies
2.6. In Vitro RSV Release and Permeation Studies
2.7. In Vitro Cell Studies
2.7.1. Cells Culture and In Vitro Dry Eye Model
2.7.2. Intracellular Antioxidant Activities
2.7.3. Enzyme-Linked Immunosorbent Assay (ELISA)
2.7.4. RNA Isolation, Reverse Transcription, and Quantitative Real-Time PCR (qRT-PCR)
2.8. Measurement of Cellular Respiration
2.9. Western Blotting
2.10. Statistical Analysis
3. Results and Discussion
3.1. Preparation and Characterization of RSV-NPs
3.2. Rheological and Mechanical Characterization of Hydrogel Formulations (RSV@Tgel)
3.3. RSV Release from RSV@Tgel
3.4. RSV@Tgel Protection of Corneal Cells from Oxidative Damage
3.5. Effect of RSV@Tgel on HCEC Mitochondrial Bioenergetics
3.6. RSV@Tgel Suppression of Inflammatory Response under Hyperosmotic Stress
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Berg, E.J.; Ying, G.S.; Maguire, M.G.; Sheffield, P.E.; Szczotka-Flynn, L.B.; Asbell, P.A.; Shen, J.F.; Group, D.S.R. Climatic and Environmental Correlates of Dry Eye Disease Severity: A Report From the Dry Eye Assessment and Management (DREAM) Study. Transl. Vis. Sci. Technol. 2020, 9, 25. [Google Scholar] [CrossRef] [PubMed]
- Dogru, M.; Kojima, T.; Simsek, C.; Tsubota, K. Potential Role of Oxidative Stress in Ocular Surface Inflammation and Dry Eye Disease. Investig. Ophthalmol. Vis. Sci. 2018, 59, DES163–DES168. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, T. Inflammatory Response in Dry Eye. Investig. Ophthalmol. Vis. Sci. 2018, 59, DES192–DES199. [Google Scholar] [CrossRef]
- Shimazaki, J. Definition and Diagnostic Criteria of Dry Eye Disease: Historical Overview and Future Directions. Investig. Ophthalmol. Vis. Sci. 2018, 59, DES7–DES12. [Google Scholar] [CrossRef] [PubMed]
- Gurnani, B.; Kaur, K. Current approach in surgical management of dry eyes—Dry eye review II. TNOA J. Ophthalmic Sci. Res. 2021, 59, 241–249. [Google Scholar] [CrossRef]
- Mohamed, H.B.; Abd El-Hamid, B.N.; Fathalla, D.; Fouad, E.A. Current trends in pharmaceutical treatment of dry eye disease: A review. Eur. J. Pharm.Sci. Off. J. Eur. Fed. Pharm. Sci. 2022, 175, 106206. [Google Scholar] [CrossRef]
- De Luca, I.; Di Cristo, F.; Valentino, A.; Peluso, G.; Di Salle, A.; Calarco, A. Food-Derived Bioactive Molecules from Mediterranean Diet: Nanotechnological Approaches and Waste Valorization as Strategies to Improve Human Wellness. Polymers 2022, 14, 1726. [Google Scholar] [CrossRef]
- Xu, Z.; Sun, T.; Li, W.; Sun, X. Inhibiting effects of dietary polyphenols on chronic eye diseases. J. Funct. Foods 2017, 39, 186–197. [Google Scholar] [CrossRef]
- Bungau, S.; Abdel-Daim, M.M.; Tit, D.M.; Ghanem, E.; Sato, S.; Maruyama-Inoue, M.; Yamane, S.; Kadonosono, K. Health Benefits of Polyphenols and Carotenoids in Age-Related Eye Diseases. Oxidative Med. Cell. Longev. 2019, 2019, 9783429. [Google Scholar] [CrossRef]
- Choi, W.; Lee, J.B.; Cui, L.; Li, Y.; Li, Z.; Choi, J.S.; Lee, H.S.; Yoon, K.C. Therapeutic Efficacy of Topically Applied Antioxidant Medicinal Plant Extracts in a Mouse Model of Experimental Dry Eye. Oxidative Med. Cell. Longev. 2016, 2016, 4727415. [Google Scholar] [CrossRef]
- Favero, G.; Moretti, E.; Krajčíková, K.; Tomečková, V.; Rezzani, R. Evidence of Polyphenols Efficacy against Dry Eye Disease. Antioxidants 2021, 10, 190. [Google Scholar] [CrossRef]
- Abu-Amero, K.K.; Kondkar, A.A.; Chalam, K.V. Resveratrol and Ophthalmic Diseases. Nutrients 2016, 8, 200. [Google Scholar] [CrossRef]
- Bryl, A.; Falkowski, M.; Zorena, K. The Role of Resveratrol in Eye Diseases-A Review of the Literature. Nutrients 2022, 14, 2974. [Google Scholar] [CrossRef]
- Gao, Y.; Fu, R.; Wang, J.; Yang, X.; Wen, L.; Feng, J. Resveratrol mitigates the oxidative stress mediated by hypoxic-ischemic brain injury in neonatal rats via Nrf2/HO-1 pathway. Pharm. Biol. 2018, 56, 440–449. [Google Scholar] [CrossRef]
- Vivero-Lopez, M.; Sparacino, C.; Quelle-Regaldie, A.; Sánchez, L.; Candal, E.; Barreiro-Iglesias, A.; Huete-Toral, F.; Carracedo, G.; Otero, A.; Concheiro, A.; et al. Pluronic®/casein micelles for ophthalmic delivery of resveratrol: In vitro, ex vivo, and in vivo tests. Int. J. Pharm. 2022, 628, 122281. [Google Scholar] [CrossRef]
- Castro, B.F.M.; Fulgêncio, G.D.O.; Domingos, L.C.; Cotta, O.A.L.; Silva-Cunha, A.; Fialho, S.L. Positively charged polymeric nanoparticles improve ocular penetration of tacrolimus after topical administration. J. Drug Deliv. Sci. Technol. 2020, 60, 101912. [Google Scholar] [CrossRef]
- Conte, R.; De Luise, A.; Valentino, A.; Di Cristo, F.; Petillo, O.; Riccitiello, F.; Di Salle, A.; Calarco, A.; Peluso, G. Hydrogel Nanocomposite Systems: Characterization and Application in Drug-Delivery Systems. In Nanocarriers for Drug Delivery: Nanoscience and Nanotechnology in Drug Delivery; Elsevier: Amsterdam, The Netherlands, 2018; pp. 319–349. [Google Scholar]
- Hamcerencu, M.; Desbrieres, J.; Popa, M.; Riess, G. Thermo-sensitive gellan maleate/N-isopropylacrylamide hydrogels: Initial “in vitro” and “in vivo” evaluation as ocular inserts. Polym. Bull. 2020, 77, 741–755. [Google Scholar] [CrossRef]
- Conte, R.; Finicelli, M.; Borrone, A.; Margarucci, S.; Peluso, G.; Calarco, A.; Bosetti, M. MMP-2 Silencing through siRNA Loaded Positively-Charged Nanoparticles (AcPEI-NPs) Counteracts Chondrocyte De-Differentiation. Polymers 2023, 15, 1172. [Google Scholar] [CrossRef]
- Valentino, A.; Conte, R.; De Luca, I.; Di Cristo, F.; Peluso, G.; Bosetti, M.; Calarco, A. Thermo-Responsive Gel Containing Hydroxytyrosol-Chitosan Nanoparticles (Hyt@tgel) Counteracts the Increase of Osteoarthritis Biomarkers in Human Chondrocytes. Antioxidants 2022, 11, 1210. [Google Scholar] [CrossRef]
- Dyawanapelly, S.; Koli, U.; Dharamdasani, V.; Jain, R.; Dandekar, P. Improved mucoadhesion and cell uptake of chitosan and chitosan oligosaccharide surface-modified polymer nanoparticles for mucosal delivery of proteins. Drug Deliv. Transl. Res. 2016, 6, 365–379. [Google Scholar] [CrossRef]
- Matthew, J.E.; Nazario, Y.L.; Roberts, S.C.; Bhatia, S.R. Effect of mammalian cell culture medium on the gelation properties of Pluronic F127. Biomaterials 2002, 23, 4615–4619. [Google Scholar] [CrossRef]
- Khattab, A.; Marzok, S.; Ibrahim, M. Development of optimized mucoadhesive thermosensitive pluronic based in situ gel for controlled delivery of Latanoprost: Antiglaucoma efficacy and stability approaches. J. Drug Deliv. Sci. Technol. 2019, 53, 101134. [Google Scholar] [CrossRef]
- Amaghnouje, A.; Mechchate, H.; Es-Safi, I.; Boukhira, S.; Aliqahtani, S.A.; MNoman, O.; ANasr, F.; Conte, R.; Calarco, A.; Bousta, D. Subacute Assessment of the Toxicity and Antidepressant-Like Effects of Origanum majorana L. Polyphenols in Swiss Albino Mice. Molecules 2020, 25, 5653. [Google Scholar] [CrossRef]
- Bao, Q.; Newman, B.; Wang, Y.; Choi, S.; Burgess, D.J. In vitro and ex vivo correlation of drug release from ophthalmic ointments. J. Control. Release 2018, 276, 93–101. [Google Scholar] [CrossRef]
- Shetty, R.; Subramani, M.; Murugeswari, P.; Anandula, V.R.; Matalia, H.; Jayadev, C.; Ghosh, A.; Das, D. Resveratrol Rescues Human Corneal Epithelial Cells Cultured in Hyperosmolar Conditions: Potential for Dry Eye Disease Treatment. Cornea 2020, 39, 1520–1532. [Google Scholar] [CrossRef]
- Di Cristo, F.; Valentino, A.; De Luca, I.; Peluso, G.; Bonadies, I.; Calarco, A.; Di Salle, A. PLA Nanofibers for Microenvironmental-Responsive Quercetin Release in Local Periodontal Treatment. Molecules 2022, 27, 2205. [Google Scholar] [CrossRef]
- Conte, R.; De Luca, I.; Valentino, A.; Cerruti, P.; Pedram, P.; Cabrera-Barjas, G.; Moeini, A.; Calarco, A. Hyaluronic Acid Hydrogel Containing Resveratrol-Loaded Chitosan Nanoparticles as an Adjuvant in Atopic Dermatitis Treatment. J. Funct. Biomater. 2023, 14, 82. [Google Scholar] [CrossRef]
- De Luca, I.; Di Salle, A.; Alessio, N.; Margarucci, S.; Simeone, M.; Galderisi, U.; Calarco, A.; Peluso, G. Positively charged polymers modulate the fate of human mesenchymal stromal cells via ephrinB2/EphB4 signaling. Stem Cell Res. 2016, 17, 248–255. [Google Scholar] [CrossRef]
- Di Cristo, F.; Calarco, A.; Digilio, F.A.; Sinicropi, M.S.; Rosano, C.; Galderisi, U.; Melone, M.A.B.; Saturnino, C.; Peluso, G. The Discovery of Highly Potent THP Derivatives as OCTN2 Inhibitors: From Structure-Based Virtual Screening to In Vivo Biological Activity. Int. J. Mol. Sci. 2020, 21, 7431. [Google Scholar] [CrossRef]
- Melone, M.A.B.; Calarco, A.; Petillo, O.; Margarucci, S.; Colucci-D’Amato, L.; Galderisi, U.; Koverech, G.; Peluso, G. Mutant huntingtin regulates EGF receptor fate in non-neuronal cells lacking wild-type protein. Biochim. Biophys. Acta (BBA)—Mol. Basis Dis. 2013, 1832, 105–113. [Google Scholar] [CrossRef]
- Di Cristo, F.; Finicelli, M.; Digilio, F.A.; Paladino, S.; Valentino, A.; Scialò, F.; D’Apolito, M.; Saturnino, C.; Galderisi, U. Meldonium improves Huntington’s disease mitochondrial dysfunction by restoring peroxisome proliferator-activated receptor γ coactivator 1α expression. J. Cell. Physiol. 2019, 234, 9233–9246. [Google Scholar] [CrossRef] [PubMed]
- Gorantla, S.; Rapalli, V.K.; Waghule, T.; Singh, P.P.; Dubey, S.K.; Saha, R.N.; Singhvi, G. Nanocarriers for ocular drug delivery: Current status and translational opportunity. RSC Adv. 2020, 10, 27835–27855. [Google Scholar] [CrossRef] [PubMed]
- Mohsen, A.M. Cationic Polymeric Nanoparticles for Improved Ocular Delivery and Antimycotic Activity of Terconazole. J. Pharm. Sci. 2022, 111, 458–468. [Google Scholar] [CrossRef] [PubMed]
- Rivas, C.; Tarhini, M.; Badri, W.; Miladi, K.; Greige-Gerges, H.; Nazari, Q.A.; Galindo, S.; Alvarez Roman, R.; Fessi, H.; Elaissari, A. Nanoprecipitation process: From encapsulation to drug delivery. Int. J. Pharm. 2017, 532, 66–81. [Google Scholar] [CrossRef]
- Chen, Z.; Tai, Z.; Gu, F.; Hu, C.; Zhu, Q.; Gao, S. Aptamer-mediated delivery of docetaxel to prostate cancer through polymeric nanoparticles for enhancement of antitumor efficacy. Eur. J. Pharm. Biopharm. 2016, 107, 130–141. [Google Scholar] [CrossRef]
- Chhonker, Y.S.; Prasad, Y.D.; Chandasana, H.; Vishvkarma, A.; Mitra, K.; Shukla, P.K.; Bhatta, R.S. Amphotericin-B entrapped lecithin/chitosan nanoparticles for prolonged ocular application. Int. J. Biol. Macromol. 2015, 72, 1451–1458. [Google Scholar] [CrossRef]
- Georgiev, G.A.; Eftimov, P.; Yokoi, N. Contribution of Mucins towards the Physical Properties of the Tear Film: A Modern Update. Int. J. Mol. Sci. 2019, 20, 6132. [Google Scholar] [CrossRef]
- Holland, E.J.; Darvish, M.; Nichols, K.K.; Jones, L.; Karpecki, P.M. Efficacy of topical ophthalmic drugs in the treatment of dry eye disease: A systematic literature review. Ocul. Surf. 2019, 17, 412–423. [Google Scholar] [CrossRef]
- Pereira, G.G.; Dimer, F.A.; Guterres, S.S.; Kechinski, C.P.; Granada, J.E.; Cardozo, N.S.M. Formulation and characterization of poloxamer 407®: Thermoreversible gel containing polymeric microparticles and hyaluronic acid. Química Nova 2013, 36, 1121–1125. [Google Scholar] [CrossRef]
- Carlfors, J.; Edsman, K.; Petersson, R.; Jörnving, K. Rheological evaluation of Gelrite in situ gels for ophthalmic use. Eur. J. Pharm. Sci. Off. J. Eur. Fed. Pharm. Sci. 1998, 6, 113–119. [Google Scholar] [CrossRef]
- Sharifi, S.; Islam, M.M.; Sharifi, H.; Islam, R.; Koza, D.; Reyes-Ortega, F.; Alba-Molina, D.; Nilsson, P.H.; Dohlman, C.H.; Mollnes, T.E.; et al. Tuning gelatin-based hydrogel towards bioadhesive ocular tissue engineering applications. Bioact. Mater. 2021, 6, 3947–3961. [Google Scholar] [CrossRef] [PubMed]
- Rupenthal, I.D.; Green, C.R.; Alany, R.G. Comparison of ion-activated in situ gelling systems for ocular drug delivery. Part 1: Physicochemical characterisation and in vitro release. Int. J. Pharm. 2011, 411, 69–77. [Google Scholar] [CrossRef]
- Alruwaili, N.K.; Zafar, A.; Imam, S.S. Stimulus Responsive Ocular Gentamycin-Ferrying Chitosan Nanoparticles Hydrogel: Formulation Optimization, Ocular Safety and Antibacterial Assessment. Int. J. Nanomed. 2020, 15, 4717–4737. [Google Scholar] [CrossRef]
- Mandell, J.T.; Idarraga, M.; Kumar, N.; Galor, A. Impact of Air Pollution and Weather on Dry Eye. J. Clin. Med. 2020, 9, 3740. [Google Scholar] [CrossRef]
- Park, B.; Jo, K.; Lee, T.G. Polydatin Inhibits NLRP3 Inflammasome in Dry Eye Disease by Attenuating Oxidative Stress and Inhibiting the NF-κB Pathway. Nutrients 2019, 11, 2792. [Google Scholar] [CrossRef] [PubMed]
- Deng, R.; Hua, X.; Li, J.; Chi, W.; Zhang, Z.; Lu, F.; Zhang, L.; Pflugfelder, S.C.; Li, D.Q. Oxidative stress markers induced by hyperosmolarity in primary human corneal epithelial cells. PLoS ONE 2015, 10, e0126561. [Google Scholar] [CrossRef]
- Wakamatsu, T.H.; Dogru, M.; Ayako, I.; Takano, Y.; Matsumoto, Y.; Ibrahim, O.M.; Okada, N.; Satake, Y.; Fukagawa, K.; Shimazaki, J.; et al. Evaluation of lipid oxidative stress status and inflammation in atopic ocular surface disease. Mol. Vis. 2010, 16, 2465–2475. [Google Scholar] [PubMed]
- Zheng, Q.; Ren, Y.; Reinach, P.S.; She, Y.; Xiao, B.; Hua, S.; Qu, J.; Chen, W. Reactive oxygen species activated NLRP3 inflammasomes prime environment-induced murine dry eye. Exp. Eye Res. 2014, 125, 1–8. [Google Scholar] [CrossRef]
- Wang, H.H.; Chen, W.Y.; Huang, Y.H.; Hsu, S.M.; Tsao, Y.P.; Hsu, Y.H.; Chang, M.S. Interleukin-20 is involved in dry eye disease and is a potential therapeutic target. J. Biomed. Sci. 2022, 29, 36. [Google Scholar] [CrossRef] [PubMed]
- Shi, Q.; Vaillancourt, F.; Côté, V.; Fahmi, H.; Lavigne, P.; Afif, H.; Di Battista, J.A.; Fernandes, J.C.; Benderdour, M. Alterations of metabolic activity in human osteoarthritic osteoblasts by lipid peroxidation end product 4-hydroxynonenal. Arthritis Res. Ther. 2006, 8, R159. [Google Scholar] [CrossRef]
- Cabrera, M.P.; Chihuailaf, R.H. Antioxidants and the integrity of ocular tissues. Vet. Med. Int. 2011, 2011, 905153. [Google Scholar] [CrossRef]
- Bhuyan, K.C.; Bhuyan, D.K. Catalase in Ocular Tissue and Its Intracellular Distribution in Corneal Epithelium. Am. J. Ophthalmol. 1970, 69, 147–153. [Google Scholar] [CrossRef] [PubMed]
- Cejková, J.; Ardan, T.; Simonová, Z.; Cejka, C.; Malec, J.; Dotrelová, D.; Brunová, B. Decreased expression of antioxidant enzymes in the conjunctival epithelium of dry eye (Sjögren’s syndrome) and its possible contribution to the development of ocular surface oxidative injuries. Histol. Histopathol. 2008, 23, 1477–1483. [Google Scholar] [CrossRef] [PubMed]
- Pintea, A.; Rugină, D.; Pop, R.; Bunea, A.; Socaciu, C.; Diehl, H.A. Antioxidant effect of trans-resveratrol in cultured human retinal pigment epithelial cells. J. Ocul. Pharmacol. Ther. Off. J. Assoc. Ocul. Pharmacol. Ther. 2011, 27, 315–321. [Google Scholar] [CrossRef]
- Yang, Y.; Wu, Z.Z.; Cheng, Y.L.; Lin, W.; Qu, C. Resveratrol protects against oxidative damage of retinal pigment epithelium cells by modulating SOD/MDA activity and activating Bcl-2 expression. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 378–388. [Google Scholar] [CrossRef]
- Uchino, Y.; Kawakita, T.; Miyazawa, M.; Ishii, T.; Onouchi, H.; Yasuda, K.; Ogawa, Y.; Shimmura, S.; Ishii, N.; Tsubota, K. Oxidative stress induced inflammation initiates functional decline of tear production. PLoS ONE 2012, 7, e45805. [Google Scholar] [CrossRef]
- Seen, S.; Tong, L. Dry eye disease and oxidative stress. Acta Ophthalmol. 2018, 96, e412–e420. [Google Scholar] [CrossRef]
- Chen, Y.; Zhang, H.; Ji, S.; Jia, P.; Chen, Y.; Li, Y.; Wang, T. Resveratrol and its derivative pterostilbene attenuate oxidative stress-induced intestinal injury by improving mitochondrial redox homeostasis and function via SIRT1 signaling. Free Radic. Biol. Med. 2021, 177, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Mimura, T.; Kaji, Y.; Noma, H.; Funatsu, H.; Okamoto, S. The role of SIRT1 in ocular aging. Exp. Eye Res. 2013, 116, 17–26. [Google Scholar] [CrossRef]
- Zhou, M.; Luo, J.; Zhang, H. Role of Sirtuin 1 in the pathogenesis of ocular disease (Review). Int. J. Mol. Med. 2018, 42, 13–20. [Google Scholar] [CrossRef]
- Sheu, S.J.; Liu, N.C.; Ou, C.C.; Bee, Y.S.; Chen, S.C.; Lin, H.C.; Chan, J.Y. Resveratrol stimulates mitochondrial bioenergetics to protect retinal pigment epithelial cells from oxidative damage. Investig. Ophthalmol. Vis. Sci. 2013, 54, 6426–6438. [Google Scholar] [CrossRef] [PubMed]
- Averilla, J.N.; Oh, J.; Kim, J.-S. Carbon Monoxide Partially Mediates Protective Effect of Resveratrol Against UVB-Induced Oxidative Stress in Human Keratinocytes. Antioxidants 2019, 8, 432. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhang, W.; Zheng, Y.; Xu, Y. Ameliorative Potential of Resveratrol in Dry Eye Disease by Restoring Mitochondrial Function. Evid.-Based Complement. Altern. Med. 2022, 2022, 1013444. [Google Scholar] [CrossRef]
- Corrales, R.M.; Luo, L.; Chang, E.Y.; Pflugfelder, S.C. Effects of osmoprotectants on hyperosmolar stress in cultured human corneal epithelial cells. Cornea 2008, 27, 574–579. [Google Scholar] [CrossRef]
- Baudouin, C.; Aragona, P.; Messmer, E.M.; Tomlinson, A.; Calonge, M.; Boboridis, K.G.; Akova, Y.A.; Geerling, G.; Labetoulle, M.; Rolando, M. Role of hyperosmolarity in the pathogenesis and management of dry eye disease: Proceedings of the OCEAN group meeting. Ocul. Surf. 2013, 11, 246–258. [Google Scholar] [CrossRef]
- Minagawa, T.; Okui, T.; Takahashi, N.; Nakajima, T.; Tabeta, K.; Murakami, S.; Yamazaki, K. Resveratrol suppresses the inflammatory responses of human gingival epithelial cells in a SIRT1 independent manner. J. Periodontal Res. 2015, 50, 586–593. [Google Scholar] [CrossRef]
- Goutham, G.; Manikandan, R.; Beulaja, M.; Thiagarajan, R.; Arulvasu, C.; Arumugam, M.; Setzer, W.N.; Daglia, M.; Nabavi, S.F.; Nabavi, S.M. A focus on resveratrol and ocular problems, especially cataract: From chemistry to medical uses and clinical relevance. Biomed. Pharmacother. 2017, 86, 232–241. [Google Scholar] [CrossRef] [PubMed]
- Hsu, Y.A.; Chen, C.S.; Wang, Y.C.; Lin, E.S.; Chang, C.Y.; Chen, J.J.; Wu, M.Y.; Lin, H.J.; Wan, L. Anti-Inflammatory Effects of Resveratrol on Human Retinal Pigment Cells and a Myopia Animal Model. Curr. Issues Mol. Biol. 2021, 43, 716–727. [Google Scholar] [CrossRef]
- Luna, C.; Li, G.; Liton, P.B.; Qiu, J.; Epstein, D.L.; Challa, P.; Gonzalez, P. Resveratrol prevents the expression of glaucoma markers induced by chronic oxidative stress in trabecular meshwork cells. Food Chem. Toxicol. 2009, 47, 198–204. [Google Scholar] [CrossRef]
Gene | Accession Number | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|---|
IL-6 | NM_000600.5 | CGCCTTCGGTCCAGTTGCC | GCCAGTGCCTCTTTGCTGCTTT |
IL-8 | NM_000584.4 | CTCTTGGCAGCCTTCCTGATTTC | TTTTCCTTGGGGTCCAGACAGAG |
TNF-α | NM_000594.4 | AACATCCAACCTTCCCAAACGC | TGGTCTCCAGATTCCAGATGTCAGG |
Sirt1 | NM_012238.2 | GCCTCACATGCAAGCTCTAGTGAC | TTCGAGGATCTGTGCCAATCATAA |
ACTB | NM_001101.5 | ACTCTTCCAGCCTTCCTTCC | CGTACAGGTCTTTGCGGATG |
Sample | Polymer (mg) | RSV (mg) | Z-Average (nm) | Zeta Potential (mV) | Polydispersity Index (PDI) | Encapsulation Efficiency (EE %) |
---|---|---|---|---|---|---|
NPs | 100 | 0 | 96.3 ± 0.8 | 21.9 ± 1.6 | 0.21 ± 0.6 | |
RSV1-NPs | 100 | 5 | 89.2 ± 0.9 | 20.7 ± 1.9 | 0.19 ± 0.9 | 46.8 ± 2.8 |
RSV2-NPs | 100 | 10 | 125.4 ± 1.3 | 22.1 ± 1.3 | 0.16 ± 0.3 | 78.3 ± 4.9 |
RSV3-NPs | 100 | 20 | 148.7 ± 2.2 | 21.6 ± 1.8 | 0.22 ± 1.2 | 66.4 ± 5.9 |
RSV-NPs (0 Day) | RSV-NPs (14 Days) | RSV@Tgel (0 Day) | RSV@Tgel (14 Days) | |||||
---|---|---|---|---|---|---|---|---|
4 °C | 25 °C | 4 °C | 25 °C | 4 °C | 25 °C | 4 °C | 25 °C | |
Average particle size (nm ± S.D.) | 126.7 ± 9.1 | 129.6 ± 3.1 | 169.18 ± 19.2 | 176.6 ± 11.4 | 135.4 ± 9.0 | 138.7 ± 6.4 | 137.6 ± 5.3 | 139.1 ± 4.3 |
PDI | 0.15 ± 0.0 | 0.17 ± 0.0 | 0.4 ± 0.0 | 0.5 ± 0.0 | 0.11 ± 0.0 | 0.14 ± 0.0 | 0.13 ± 0.0 | 0.12 ± 0.0 |
pH | 6.7 ± 0.2 | 6.6 ± 0.2 | 6.6 ± 0.1 | 6.7 ± 0.1 | 6.8 ± 0.2 | 6.7 ± 0.3 | 6.7 ± 0.2 | 6.7 ± 0.6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Luca, I.; Di Cristo, F.; Conte, R.; Peluso, G.; Cerruti, P.; Calarco, A. In-Situ Thermoresponsive Hydrogel Containing Resveratrol-Loaded Nanoparticles as a Localized Drug Delivery Platform for Dry Eye Disease. Antioxidants 2023, 12, 993. https://doi.org/10.3390/antiox12050993
De Luca I, Di Cristo F, Conte R, Peluso G, Cerruti P, Calarco A. In-Situ Thermoresponsive Hydrogel Containing Resveratrol-Loaded Nanoparticles as a Localized Drug Delivery Platform for Dry Eye Disease. Antioxidants. 2023; 12(5):993. https://doi.org/10.3390/antiox12050993
Chicago/Turabian StyleDe Luca, Ilenia, Francesca Di Cristo, Raffaele Conte, Gianfranco Peluso, Pierfrancesco Cerruti, and Anna Calarco. 2023. "In-Situ Thermoresponsive Hydrogel Containing Resveratrol-Loaded Nanoparticles as a Localized Drug Delivery Platform for Dry Eye Disease" Antioxidants 12, no. 5: 993. https://doi.org/10.3390/antiox12050993