Next Article in Journal
Excessive Replacement of Fish Meal by Soy Protein Concentrate Resulted in Inhibition of Growth, Nutrient Metabolism, Antioxidant Capacity, Immune Capacity, and Intestinal Development in Juvenile Largemouth Bass (Micropterus salmoides)
Previous Article in Journal
Trehalose Protects against Superoxide Dismutase 1 Proteinopathy in an Amyotrophic Lateral Sclerosis Model
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 13
Issue 7
10.3390/antiox13070808
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hepatic Oxidative Stress and Cell Death Influenced by Dietary Lipid Levels in a Fresh Teleost

by
Lingjie He
1,†,
Yupeng Zhang
1,†,
Quanquan Cao
1,
Hongying Shan
1,
Jiali Zong
1,
Lin Feng
2,3,
Weidan Jiang
2,3,
Pei Wu
2,3,
Juan Zhao
2,
Haifeng Liu
1,* and
Jun Jiang
1,3,*
1
College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
2
Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, China
3
Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Ya’an 625014, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Antioxidants 2024, 13(7), 808; https://doi.org/10.3390/antiox13070808
Submission received: 30 May 2024 / Revised: 2 July 2024 / Accepted: 2 July 2024 / Published: 4 July 2024
(This article belongs to the Section Health Outcomes of Antioxidants and Oxidative Stress)
Browse Figures
Review Reports Versions Notes

Abstract

:
Ferroptosis is a form of regulated cell death characterized by iron-dependent lipid peroxidation, affecting physiological and pathological processes. Fatty liver disease associated with metabolic dysfunction is a common pathological condition in aquaculture. However, the exact role and mechanism of ferroptosis in its pathogenesis and progression remains unclear. In this study, an experiment was conducted using different dietary lipid levels in the feeding of largemouth bass (Micropterus salmoides) for 11 weeks. The results revealed that the growth performance and whole-body protein content significantly increased with the elevation of dietary lipid levels up to 12%. The activities of antioxidant enzymes as well as the content of GSH (glutathione) in the liver initially increased but later declined as the lipid levels increased; the contents of MDA (malondialdehyde) and GSSG (oxidized glutathione) demonstrated an opposite trend. Moreover, elevating lipid levels in the diet significantly increased liver Fe2+ content, as well as the expressions of TF (Transferrin), TFR (Transferrin receptor), ACSL4 (acyl-CoA synthetase long-chain family member 4), LPCAT3 (lysophosphatidylcholine acyltransferase 3), and LOX12 (Lipoxygenase-12), while decreasing the expressions of GPX4 (glutathione peroxidase 4) and SLC7A11 (Solute carrier family 7 member 11). In conclusion, the optimal lipid level is 12.2%, determined by WG-based linear regression. Excess lipid-level diets can up-regulate the ACSL4/LPCAT3/LOX12 axis, induce hepatic oxidative stress and cell death through a ferroptotic-like program, and decrease growth performance.

1. Introduction

Largemouth bass (Micropterus salmoides), as a carnivorous freshwater fish, has a key role in aquaculture [1]. It is highly prized by consumers for its delectable flesh, high protein content, and low lipid attributes, making it a species of considerable market value. However, the absence of high-quality, reasonably priced feed has emerged as a major constraint hindering aquaculture development [2]. Lipids play a crucial role in providing energy in fish feed. Fish can produce a range of saturated and monounsaturated fatty acids internally; in contrast, fish need to obtain certain essential polyunsaturated fatty acids, which necessitates their intake from dietary sources [3,4]. Previous research has explored the impact of changing dietary lipid levels on growth performance in largemouth bass. However, the results have shown significant variations, leading to confusion in production practices. Optimal feed lipid levels of 8–18% and crude protein levels of 45–51% have been identified in numerous studies for largemouth bass [5,6,7,8,9,10]. Nevertheless, there has been limited investigation into lipid levels in these studies, with more research focused on exploring the appropriate requirements for protein–lipid interactions. Additionally, discrepancies in these recommended lipid levels may be attributed to variations in largemouth bass body weight, lipid sources used in compound feed formulations, and dietary lipid levels. While prior studies have primarily focused on growth and feed utilization, few have investigated liver health and its influencing mechanisms.
The appropriate level of lipids in the diet is also conducive to enhancing the growth outcomes, health, and flesh quality of fish [11,12,13]. Yet, inadequate or excessive feed lipid levels can generate negative repercussions for both growth performance and overall health. Research has reported the adverse effects of a diet rich in lipids on health, including conditions like metabolic syndrome, liver impairment, and fatty liver disease. For example, excessive lipid levels can reduce the antioxidant capacity of largemouth bass [9], resulting in sustained hyperglycemia and decreased muscle quality of the Senegalese Sole (Solea senegalensis) [11] and a reduction in the growth performance of the juvenile spotted knifejaw [13]. Fatty liver disease begins with the accumulation of excess fat in the liver and progresses from mild steatosis to more critical situations, for instance steatohepatitis, cirrhosis, and hepatocellular carcinoma [14,15]. It has been indicated that consuming a high-lipid diet for extended periods of time leads to lipid accumulation and metabolic dysfunction-associated fatty liver [16]. However, the underlying causes and mechanisms of lipid metabolic dysfunction-linked fatty liver disease remain largely unclear. However, there is growing evidence that liver ferroptosis plays a role in the progression of fatty liver disease induced by a high-lipid diet [17,18]. Comparative transcriptomic analysis of fatty liver disease in gibel carp (Carassius auratus gibelio), which may involve ferroptosis, suggests potential activation [19], yet its mechanism requires further investigation. The involvement of ferroptosis in the onset and advancement of metabolic dysfunction-associated fatty liver disease remains incompletely understood.
Ferroptosis is a type of cell death that relies on iron and lipid hydroperoxides, recognized as a key initiator of inflammation in nonalcoholic steatohepatitis, thereby accelerating the progression of metabolic dysfunction-associated fatty liver disease [18]. Inhibiting ferroptosis is thus considered a crucial factor in preventing the advancement of hepatocyte death. Oxidative stress and excessive iron levels primarily induce ferroptosis by promoting the generation of intracellular reactive oxygen species (ROS). Under the influence of ACSL4, polyunsaturated fatty acids (PUFAs) undergo acylation to generate unsaturated fatty acids with coenzyme A, forming acyl-CoA (PUFAs-CoA). Subsequently, they interact with LPCAT3, an acyltransferase enzyme linked to phospholipids, to facilitate the formation of esterified compounds (PUFA-PL). Ultimately, these PUFA-PL molecules are directly oxidized by oxygenase, initiating lipid peroxidation and fostering ferroptosis [20,21]. Furthermore, GSH is a reducing substrate for GPX4 activity that reduces lipid peroxides to lipols, thereby protecting cells from oxidative stress damage, and SLC7A11 plays an integral role in maintaining intracellular GSH levels. Therefore, GPX4 and SLC7A11 serve as central regulators in ferroptosis by mitigating the formation of lipid peroxides [22,23]. Given that high-lipid diets disrupt the antioxidant system by inducing lipid metabolism disorders through excessive fatty acid intake, we hypothesize that ferroptosis may contribute to the development of metabolic fatty liver disease induced by high-fat diets. This involvement may be linked to the ACSL4-LPCAT3-mediated signaling pathway. Therefore, this study aims to assess the potential impact of varying lipid concentrations on growth outcomes, liver health effects, and potential mechanisms in largemouth bass. The findings from this study hold significant implications for formulating efficient feed and enhancing the health of cultured largemouth bass.

2. Materials and Methods

2.1. Experimental Diets

Table 1 outlines the formulations of experimental diets. Fish meal, chicken powder, pork powder, gluten, and fermented soybean meal were served as dietary protein sources. Cassava starch was used as the dietary starch source. Soybean oil and phospholipids were added as dietary lipid sources. Six isonitrogenous practical diets with graded levels of lipids (6%, 8%, 12%, 14%, 16%, and 18%, respectively) were formulated. The coarse ingredients were thoroughly pulverized using a vertical ultrafine feed machine (SWFL Series Vertical Shaft Pulverizer, Chengdu, China) and sifted through a sieve with a mesh size of 80. The components were uniformly mixed using a twin-shaft paddle batch mixer until thoroughly blended (SLHSJ05, Nanjing, China). Subsequently, each diet underwent extrusion using a twin-screw extruder (MY-165, Beijing, China) equipped with a 2 mm die. The processing parameters included a screw speed set at 100 rpm, a temperature of 127 °C, and a pressure ranging from 30 to 45 atm. The meals were allowed to air dry before being kept in plastic bags at −20 °C until needed.

2.2. Management and Feeding Practices for the Fish

The feeding experiment occurred at the Ya’an Experiment Station, affiliated with Sichuan Agricultural University. Fish were sourced from Sichuan Meishan Weiji Aquatic Seed Technology Co., Ltd. (Meishan, China) and acclimatized in tanks for four weeks. During this period, largemouth bass were fed a commercially available diet. A total of 900 fish with an average initial weight of 14.36 ± 0.10 g were randomly distributed into 18 concrete tanks (2 m × 1 m × 1.5 m), resulting in 50 fish per tank. The fish were fed their designated diets until satiation twice daily (8:00 am and 6:00 pm) for 11 weeks. Additionally, any remaining feed was collected, dried, and weighed to determine feed intake. Each tank was filled with fresh, dechlorinated water at a temperature between 23 and 27 °C and maintained with dissolved oxygen concentrations in the range of 6 to 6.5 mg/L and a pH of 7.0 to 7.5. The Animal Protection Advisory Committee of Sichuan Agricultural University approved the experimental protocol, license number DKY-2018202027.

2.3. Sample Collection

At the end of the feeding trial, a 50 mg/L benzocaine solution was applied to anesthetize the fish after a 24 h fasting period. Each group of 9 fish was anesthetized and frozen at −20 °C for the determination of the initial crude body composition, including protein, lipid, ash, and moisture content. Following measurements of length and weight, nine fish from each group had blood drawn using 1 mL syringes from their tail veins. After the drawn blood was placed in a test tube containing an anticoagulant, it was centrifuged at 3000 r for 10 min to extract plasma. The plasma was then frozen at −20 °C in preparation for further biochemical analysis. After the nine fish were dissected, the liver was extracted and precisely weighed. Fresh fish livers were immediately frozen with liquid nitrogen and stored at −80 °C for ensuing biochemical analysis, as well as quantitative Real-time PCR and Western blot analyses. Additionally, 9 fish from each treatment group were chosen and dissected to acquire fresh liver tissue for histological examination.

2.4. Biochemical Analysis

Using normal AOAC procedures, the diet moisture, crude lipid, crude protein, and ash contents were measured (AOAC, 2005). Each sample was put in a constant temperature oven at 105 °C for one day to determine the moisture content. The Kjeldahl and Soxhlet methods were used to determine crude protein and crude fat, respectively, and the ash content was determined by the Muffle furnace. Liver tissue samples were homogenized with an 86% ice-cold physiological saline solution to prepare for biochemical assays. After that, the homogenate was centrifuged for 10 min at 2500 r at 4 °C. The supernatant was then gathered and kept for use in additional biochemical tests at −80 °C. Utilizing commercial kits from the Jiancheng Bioengineering Institute, the following parameters were measured: the levels of triglyceride (TG), total cholesterol (TC), malondialdehyde (MDA), protein carbonyl (PC), oxidized glutathione (GSSG), reduced glutathione (GSH), and the activities of Aspartate transaminase (AST), Alanine aminotransferase (ALT), total superoxide dismutase (T-SOD), anti-superoxide anion (ASA), anti-hydroxyl radical (AHR), catalase (CAT), glutathione peroxidase (GPX), glutathione reductase (GR), and glutathione-S-transferase (GST) (Nanjing, China).

2.5. Quantitative Real-Time Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR)

The liver total RNA was extracted using RNAiso Plus kit (Takara, Dalian, China), followed by an assessment of RNA integrity via agarose gel (1%) electrophoresis and spectrophotometric analysis for quality evaluation. Subsequently, the RNA was reverse-transcribed into cDNA using a PrimeScript™ RT reagent Kit (Takara, Shiga, Japan). The sequences of all primers used in this study are listed in Table 2. The Real-time PCR reaction (10 μL) included 5 μL of ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), 3 μL of ddH2O, 0.5 μL of each primer, and 1 μL of cDNA. The qRT-PCR protocol in this study was conducted as follows: 95 °C for 2 min, followed by 40 cycles of denaturation 95 °C for 5 s, annealing at the melting temperature (Tm) for 30 s, then 95 °C for 5 s, extension at 65 °C for 5 s, and a final extension at 95 °C for 15 s. The qRT-PCR was performed using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The primers of largemouth bass are shown in Table 2. β-actin and 18S rRNA were chosen as internal reference genes for normalization. Using the 2−ΔΔCT technique, the results were computed once it was verified that the primers showed an amplification efficiency of about 100% [24].

2.6. Protein Extraction and WB Analysis

The liver tissue was homogenized in an ice-cold RIPA Lysis Buffer with PMSF and a protease inhibitor (Beyotime, Shanghai, China). The protein concentration was determined by a BCA protein detection kit (Beyotime, Shanghai, China). The protein samples were separated on an SDS/PAGE gel and subsequently transferred to a polyvinylidene fluoride (PVDF) membrane. After 5% skim milk powder was blocked for 1.5 h, it was incubated at 4 °C overnight with specific primary antibodies. The primary antibodies were as follows: Anti-β-actin (ZEN BIO, Chengdu, China, 380624, 1:2000), Anti-GPX4 (ZEN BIO, 381958, 1:1000), Anti-SLC7A11 (ZEN BIO, 382036, 1:1000), Anti-Transferrin (ABclonal, Chengdu, China, A1448, 1:1000), Anti-Transferrin Receptor (ABclonal, A21622, 1:1000), Anti-ACSL4 (ZEN BIO, R24265, 1:1000), Anti-LOX12 (ABclonal, Chengdu, China, A14703, 1:1000), and Anti-LPCAT3 (ABclonal, Chengdu, China, A17604, 1:2000). Then, the membranes were washed with PBST five times for five minutes each time and incubated with an Anti-rabbit IgG HPR-linked secondary antibody (Cell Signaling Technology, Beijig, China, #7074, 1:2000) for 1 h, followed by washing the membrane with PBST again five times, and then chemiluminescence detection was conducted using the e-BLOT Touch ImagerTM System (e-BLOT, Shanghai, China). The gray value was measured by Image J 1.52q software.

2.7. Fe2+ Content Assay

Liver tissue samples were added to a nine-times homogenate medium, centrifuged at 10,000× g for 10 min, and the supernatant was obtained for measurement. The Fe2+ concentration in liver tissues was evaluated utilizing a Biochemical Assay Kit (Elabscience, Wuhan, China, E-BC-K773-M) according to the product manual. Ultimately, Fe2+ in the liver was computed using the standard curve of the OD value, which was obtained at 593 nm in a microcoder.

2.8. Liver Histology

The liver tissue was removed and placed on a white disk using a camera. The tissues were then dehydrated using a succession of ethanol solutions of increasing concentrations, embedded in paraffin, and fixed in 4% paraformaldehyde for a week. Tissue samples were sectioned (4 μm thick), dewaxed, rehydrated, stained, and then closed with a neutral gel. These sections were subjected to microscope analysis.

2.9. Statistical Analysis

The data’s normal distribution was confirmed. Data recorded in Excel 2019 were analyzed using variance in SPSS 25.0 (IBM, Chicago, IL, USA). The results were reported as means ± the standard error (SD). Differences among multiple group means were evaluated using Duncan’s multiple-range test, and p < 0.05 indicated statistical significance. Guided by the coefficient of determination (R2) value, a broken-line model is implemented to estimate the correlation between dietary lipid levels and weight gain (WG), aiming to calculate the optimal dietary lipid level.

3. Results

3.1. Fish Growth Performance

Table 3 displays the growth performance and feed utilization of fish when they are fed diets containing changing levels of lipids. No differences were observed in initial survival rate (SR), body weight (IBW), PER, and CF among all the treatments (p > 0.05). The 12% group exhibited the highest final body weight (FBW), weight gain (WG), specific growth rate (SGR), feed intake (FI), and feed efficiency (FE) values with rising dietary lipid levels (p < 0.05). Conversely, the feed conversion ratio (FCR) reached the lowest value (p < 0.05). A broken-line analysis revealed that the most effective lipid supplementation level, as determined by weight gain (WG), was 12.2% for largemouth bass (Y = 11.575X + 407.95, R2 = 0.9969; Y = −17.765X + 766.25, R2 = 0.9129) (Figure 1). Additionally, the levels of the visceral body index (VSI) and hepatosomatic index (HSI) exhibited a gradual increase in tandem with the incremental supplementation of lipids and reached a maximum at 18% (p < 0.05).

3.2. Fish Proximate Composition

Table 4 shows the whole-body composition of fish as influenced by diets containing different levels of lipids. The lipid treatment had no effect on whole-body moisture content (p > 0.05). The whole-body protein contents exhibited an initial improvement, followed by a subsequent decline, while the whole-body lipid content increased significantly and ash content decreased gradually in response to increasing levels of lipids (p < 0.05).

3.3. Plasma and Liver Parameters

The biochemical parameters of largemouth bass plasma and liver in different lipid-supplemented diets were measured (Table 5). The activity of AST and ALT was associated with the increase in dietary lipid content (p < 0.05). When dietary lipid levels rose, the liver’s contents of TG and TC increased considerably, reaching a peak in diets supplied to fish that included 18% lipids (p < 0.05).

3.4. Liver Examination and Histology

The gross examination and histological appearances of the liver in largemouth bass are depicted in Figure 2. When the lipid content in the diet was below 14%, the liver of the largemouth bass appeared reddish-brown, while in diets with lipid contents of 14%, 16%, and 18%, localized whitening of the liver in largemouth bass was observed. In addition, when fish were fed with a diet containing less than 14% lipid levels, the shape and structure of hepatocytes appeared regular, with spherical nuclei containing nucleoli positioned predominantly in the center of the cells, exhibiting a relatively tight arrangement. In the dietary 14% and 16% lipid levels, the nuclei were observed to have moved towards the outer edge of the hepatocytes, along with instances of cell membrane lysis and a few enlarged cells. At the dietary 18% lipid level, a significant increase in cell enlargement and vacuolar degeneration cells was observed.

3.5. Liver Antioxidant Indicators

Substantial variances were noted in hepatic antioxidant indices among the fish consuming diets with varying lipid levels (Table 6). However, MDA and PC contents initially declined and subsequently increased with the increase in lipid level, and the contents in 12% and 14% lipid levels were lower than those in the other groups, respectively (p < 0.05). When fish were fed a diet containing 14% lipid levels, their livers showed considerably higher T-SOD activity than when fish were fed diets containing 16% and 18% lipid levels (p < 0.05). However, there were no notable variances detected in the activity of T-SOD among the remaining groups (p > 0.05). Fish fed with diets containing 12% lipid levels exhibited higher levels of liver CAT activity than those fed with others. The highest ASA and AHR contents in the liver were recorded in the fish fed diets with 14% lipid levels, and they were significantly higher than the other groups (p < 0.05). Furthermore, the relevant indexes of GSH-GSSG oxidation balance are shown in Figure 3. The GSH content, GPX4, and SLC7A11 mRNA and protein levels initially increased and then decreased with the rise in lipid levels in the diet, while the variation in GSSG content followed the opposite trend. Additionally, the activities of GPX, GR, and GST exhibited a similar trend to GSH content, reaching their maximum values at 14% and 12% dietary lipid levels.

3.6. Liver Fe2+ Concentration and the Expressions of TF and TFR

As depicted in Figure 4, the hepatic Fe2+ content in largemouth bass gradually increased with the elevation of dietary lipid levels. Moreover, in the group fed with a diet containing 18% lipid levels, the Fe2+ content reached its peak, significantly surpassing those in the 6–14% range (p < 0.05). Concurrently, the mRNA expressions of TF and TFR were significantly increased with the increase in lipid addition to the diet. Notably, the groups with 14% to 18% lipid content exhibited significantly higher TF mRNA expression compared to the remaining groups (p < 0.05), while the groups with 12% to 18% lipid contents demonstrated significantly higher TFR mRNA expression than the other groups (p < 0.05). Additionally, similar changes in protein levels were observed.

3.7. ACSL4/LPCAT3/LOX12 Axis

The different dietary lipid levels had a significant impact on the mRNA expressions and protein levels of the LOX12, LPCAT3, and ACSL4 axis in the liver of largemouth bass, as Figure 5 shows. The largemouth bass fed diets with 18% lipid levels had the highest mRNA expression of ACSL4, and this expression increased from 6% to 18% dietary lipid levels. Conversely, the mRNA expressions of LPCAT3 and LOX12 exhibited no notable variances among the groups consuming dietary lipid levels ranging from 6% to 18% (p > 0.05). However, consumption of 18% dietary lipid levels resulted in a significant upregulation of LPCAT3 mRNA expression compared to the 6% dietary lipid level group (p < 0.05). Similarly, 18% lipid levels led to a significant upregulation of LOX12 mRNA expression compared to the groups consuming 6% to 14% dietary lipid levels (p < 0.05). The protein levels and mRNA expressions of ACSL4, LPCAT3, and LOX12 exhibited a consistent trend with the varying lipid levels, peaking in the group with 18% lipid content. Similarly, the protein level peaked in the 14% lipid supplemental group, exhibiting a significant elevation compared to that seen in the 6%, 8%, 16%, and 18% lipid supplemental groups (p < 0.05).

4. Discussion

4.1. Effects of Lipid Levels on Growth Performance, Feed Utilization, and Body Composition of Largemouth Bass

As a carnivorous fish, the largemouth bass exhibits a low utilization rate of carbohydrates, necessitating more stringent requirements for alternative energy sources [25]. Lipids serve diverse physiological functions in the metabolism of fish and shrimp, constituting energy substances for their sustenance. In the current study (with 47% crude protein), the highest values for final body weight (FBW), weight gain (WG), specific growth rate (SGR), feed efficiency (FE), feed intake (FI), and lowest feed conversion rate (FCR) were observed in the fish fed the diet containing 12% lipid levels. Furthermore, the dietary group with 12.2% lipid levels (including 6.2% soybean oil) showed a noteworthy improvement in the growth performance of largemouth bass, according to the WG broken-line regression analysis. This aligns with reported crude lipid requirements of 12% [5] and 11.5–14% [8]. Guo et al. (2019) [10] recommended 18.42%, Li et al. (2020) determined it to be 10% [6], and Chen et al. (2023) found it to be 16% [7]. These disparate outcomes could stem from variations in fish size, protein concentrations within compound feed formulations, the lipid sources employed, and the levels of dietary lipids. Similar findings have been reported for several other species as well, such as 12.82% for seabream (Acanthopagrus schlegelii) [26], 12.69% for the Japanese seabass (Lateolabrax japonicas) [27], and 10.46% to 12.83% for the juvenile spotted knifejaw [13]. A low-lipid diet dramatically hindered the growth performance of largemouth bass, perhaps because it was deficient in important nutrients including fatty acids and fat-soluble vitamins [28]. Conversely, a high level of dietary lipid can hinder the growth performance of largemouth bass, possibly due to factors such as decreased secretion of growth hormones [29], reduced appetite [30], and metabolic dysregulation [31]. Similar findings were observed in other fish species, where excessive dietary lipid levels resulted in diminished growth performance [32].
Additionally, fish subjected to diets containing low and excessive lipid levels exhibited notably diminished food intake compared to other dietary regimens, likely due to the inherent tendency of fish to shun imbalanced or low-energy diets [33]. According to the study’s findings, FE significantly improved when dietary fat levels increased. However, the PER was leveled off with dietary lipid concentration, and the results were in line with earlier research on other fish [34,35,36], indicating that various lipid diets do not enhance the utilization of protein for the synthesis of body proteins in largemouth bass. On the other hand, several species, such as the juvenile spotted knifejaw [13] and the red spotted grouper (Epinephelus akaara) [37], showed a protein-sparing effect when fed different lipid diets. These varying results could be attributed to differences in the species and weight of the fish, the lipid sources used in compound feed formulations, and the dietary levels of lipids.
The crude lipid content of fish is a crucial parameter that impacts both the quality and nutritional value of fish, as well as serving as a pivotal determinant for the processing performance of aquatic products and the excessive accumulation of lipids in the visceral cavity, liver, and muscle tissues of fish [38]. Excessive lipid accumulation in fish has the potential to impact processing yields, product quality, and storage stability, thereby affecting its commercial value [11]. In this experiment, an elevated dietary lipid level led to a significant increase in the body lipid content of fish, while whole fish protein contents of dietary 12% and 14% lipid groups were significantly higher than other groups. These results align closely with those observed in grass carp [13], juvenile cobia [34], and the Senegalese Sole [39]. Furthermore, a negative correlation was observed between whole-body lipid and ash contents, while no significant difference was detected in the moisture content among fish with varying lipid levels. Additionally, the 12% dietary lipid level exhibited the highest proportion of whole-body protein, while the excessive lipid diet decreased the protein content of the fish’s body, in line with findings from prior research [10].

4.2. High Lipid Level Diet Can Up-Regulate the ACSL4/LPCAT3/LOX12 Axis and Promote Hepatic Oxidative Stress and Ferroptosis

Excessive lipid intake can lead to cellular swelling, nuclear translocation, the accumulation of lipid droplets, and enlarged hepatocytes with increased cell diameter [40]. These effects have been widely documented in various fish species [41], including those observed in the current investigation. Hepatic histopathological analysis in cases where dietary lipid levels surpassed 14% exhibited evident indications of liver injury, characterized by irregularly shaped cells, pronounced lipid vacuole formation, and noticeable hepatic nuclear polarization. Additionally, TC and TG contents in the liver were positively correlated with dietary lipid intake. These suggest that excessive consumption of dietary lipids may impair the liver’s ability to release lipids into the bloodstream and impede both lipoprotein secretion and fatty acid oxidation, thereby initiating a detrimental cycle [26]. The serum biochemical biomarkers of liver injury that are most sensitive are AST and ALT [42]. Assessing the levels of these markers directly contributes to the evaluation of liver health and function. The current investigation found that as dietary fat levels increased, so did the activities of AST and ALT in the serum, and these were significantly elevated when the lipid content exceeded 14%, implying that an overabundance of dietary lipid consumption in fish may result in liver damage. Meanwhile, the HSI is considered a crucial index for fish production, as elevated visceral fat levels may diminish commercial value [32,43]. Notably, it has been observed that the HSI is positively correlated with dietary lipid levels. These results imply that high dietary lipid consumption in fish may cause ectopic lipid accumulation, which in turn may cause liver injury.
Oxidative stress and subsequent lipid peroxidation are key factors in the pathogenesis of nutritional fatty liver disease [44,45,46]. The degree of intracellular oxidative stress can be determined by alterations in MDA, AHR, and ASA levels as well as the activity of antioxidant enzymes (SOD, CAT, GPX, GSH, GR, and GST) [47,48]. GSH is a reducing substrate of GPX4 activity that can reduce lipid peroxides to lipols, thereby protecting cells from oxidative stress damage. SLC7A11 plays an indispensable role in maintaining the intracellular GSH level. GSH depletion may be the primary cause of hepatic iron drooping, which relies on inhibiting GSH synthesis by suppressing the expression of SLC7A11 [49]. According to earlier research, optimal lipid levels in the diet can enhance antioxidant capacity. Experiments conducted both in vivo and in vitro have shown that the activation of oxidative stress signals results in elevated MDA levels and reduced activity of antioxidant enzymes like SOD and GPX [10,50,51]. This imbalance results in excessive ROS production in the body, ultimately leading to liver cell death [52]. Excessive ROS in the body can lead to lipid peroxidation, where MDA, a product of lipid oxidation, serves as a critical marker to assess the extent of lipid peroxidation and the resulting cellular damage [53]. As anticipated, compared to the group with 12% lipid levels, the high-lipid group (with 18% lipid levels) significantly increased MDA and GSSG contents, decreased the activities of T-SOD, GST, CAT, GPX, and GSH content, while inhibiting GPX4 and SLC7A11 mRNA level and protein expressions. These results clarify that fish fed with the ideal dietary lipid level may improve their antioxidant capacity. Conversely, an abundance of dietary lipid intake may prompt oxidative stress, a phenomenon confirmed in black sea bream (Acanthopagrus schlegelii) [54].
Ferroptosis is characterized as a type of programmed cell demise marked by the accumulation of lipid peroxides, setting it apart from apoptosis and necrosis [22]. The important role ferroptosis plays in the emergence of metabolic liver disorders has been demonstrated by earlier research, primarily associated with lipid peroxidation reactions triggered by two factors: iron overload and oxidative stress [55,56,57]. Iron plays a crucial physiological role, participating in various cellular processes such as oxygen storage and transport, mitochondrial respiration, DNA replication, and intercellular signaling [58]. In recent years, numerous studies have unearthed a profound correlation between an imbalance in hepatic iron homeostasis and metabolic diseases, particularly lipid metabolism disorders [59,60]. Elevated lipid levels can significantly induce the accumulation of lipids in hepatocytes, subsequently compromising liver function and disrupting the capacity of TF and TFR to efficiently store and transport iron. Consequently, this can result in the deposition of iron into the liver, leading to the exhibition of symptoms of iron overload. In rats fed a high-fat diet (HFD) and cells treated with fatty acids, the liver exhibits an augmented accumulation of iron, characterized by the upregulation of TFR-1 and its reliance on the Irp1 pathway [61]. In our study, we found that when the fat level in the diet is less than the dietary level of 14%, there was no significant change in Fe2+ concentration, followed by a significant increase. In other words, high-lipid induction significantly enhances iron accumulation. The nonheme iron, primarily existing in the insoluble Fe3+ form, requires reduction to Fe2+ for effective absorption. Once bound to TF, Fe3+ is recognized by the TFR situated on the cell membrane. Following absorption, iron reduction takes place within the endosome driven by metalloreductase. Subsequently, the DMT1-mediated release of Fe2+ from the endosome into the cytoplasm leads to an elevation in the level of free iron [62]. The abundant Fe2+ within cells fuels the Fenton reaction and enzymatic oxidation, facilitating the transformation of PUFAs into lipid peroxides, which ultimately triggers cell iron death and further aggravates fatty liver conditions [63]. It was revealed that the expression of the heat shock protein β-1 (HSPB1) can suppress the expression level of TFR, resulting in reduced iron intake and accumulation, thereby decreasing the sensitivity to ferroptosis [64]. Additionally, we verified that the changes in Fe2+ are positively correlated with the expression of TF and TFR. A high lipid diet induces metabolic disturbances in the hepatic tissue of largemouth bass, resulting in increased iron deposition. Ferroptosis may be one of the mechanisms underlying the pathogenesis of hepatic steatosis.
Soybean oil is a widely used lipid source in aquafeed due to its high levels of n-3 PUFAs, which are crucial to fish growth and reproduction [65]. However, excessive intake of polyunsaturated fatty acids can affect fish growth, lipid metabolism, and liver antioxidant capacity [66]. PUFAs are highly sensitive to lipid peroxidation [67], and various fatty acids may engage in the ferroptosis pathway [68]. Therefore, the content of PUFAs within cells may determine the status of lipid peroxidation, thereby determining the extent of ferroptosis. In studies involving the spotted knifejaw [13] and Atlantic cod Gadus morhua [69], the levels of LC-PUFAs in the liver and muscles increased significantly with rising dietary lipid levels. However, elevated dietary lipid levels had adverse effects on the deposition and synthesis of LC-PUFAs in fish. A gene screening identified two lipid metabolism regulatory factors, LPCAT3 and ACSL4, playing significant roles in driving ferroptosis processes [70]. ACSL4 is a member of the ACSL family, and PUFAs can be combined into PUFA-CoA under its action. Then, through LPCAT3 catalysis, these are transformed into esterified compounds (PUFA-PLs), which can subsequently undergo lipid peroxidation under the action of LOX12 [71,72,73,74]. Therefore, ACSL4 and LPCAT3 play crucial roles in the occurrence of iron death. This process reduces the production of free fatty acids, thereby decreasing lipid peroxidation and promoting intracellular lipid metabolism reactions, leading to a reduction in intracellular lipid accumulation and the protection of cell membranes from damage caused by oxidative reactions and iron death. Inhibition of ACSL4 and LPCAT3 expression may be a primary mechanism for reducing cellular sensitivity to iron death, regulated by multiple signaling pathways [21,75]. Our investigation uncovered a correlation between elevated dietary lipid levels and an upward trend in the mRNA expression and protein levels of ACSL4, LPCAT3, and LOX12. It has been confirmed that the ACSL4/LPCAT3/LOX12 axis is potentially implicated in the mechanism underlying ferroptosis triggered by a diet rich in lipids; the precise mechanism underlying this involvement necessitates further investigation. Comparable research has been documented [76], as transcriptomic analysis of fatty liver disease in gibel carp reveals the potential activation of ferroptosis [19].

5. Conclusions

The current study (crude protein 47%, initial body weight 14.36 g) indicated that a dietary lipid content of 12.2% is ideal for maximizing largemouth bass growth performance. Excessive dietary lipid levels up-regulate the ACSL4/LPCAT3/LOX12 axis and promote oxidative stress and ferroptosis in the liver as well as decrease growth performance in fish. However, due to limitations in the research design, the potential mechanism of the axis on fish remains to be further investigated (Figure 6).

Author Contributions

Conceptualization, formal analysis, and writing—original draft preparation, L.H.; methodology, Y.Z.; writing—review and editing, Q.C., H.S., J.Z. (Jiali Zong), L.F., and J.Z. (Juan Zhao); supervision, W.J.; project administration, P.W.; resources, H.L.; funding acquisition, J.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32172987), the National Key R&D Program of China (2019YFD0900200), and Yucheng District (Ya’an City) cooperating with the Sichuan Agricultural University project (2023QXHZ03).

Institutional Review Board Statement

The Animal Protection Advisory Committee of Sichuan Agricultural University has approved the experimental protocol, license number DKY-2018202027.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in this manuscript.

Acknowledgments

The authors would like to express their sincere thanks to the personnel of these teams for their kind assistance.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Chen, Q.; Wang, C.; Sun, Y.; Chen, Y.; Chen, S.; Han, T.; Wang, J. Excessive Substitution of Fish Meal with Fermented Soybean Meal Induces Oxidative Stress by Impairing Glutathione Metabolism in Largemouth Bass (Micropterus salmoides). Antioxidants 2023, 12, 2096. [Google Scholar] [CrossRef]
  2. Cai, W.; Fu, L.; Liu, H.; Yi, J.; Yang, F.; Hua, L.; He, L.; Han, D.; Zhu, X.; Yang, Y.; et al. Dietary yeast glycoprotein supplementation improves the growth performance, intestinal health and disease resistance of largemouth bass (Micropterus salmoides) fed low-fishmeal diets. Front. Immunol. 2023, 14, 1164087. [Google Scholar] [CrossRef] [PubMed]
  3. Peng, D.; Peng, B.; Li, J.; Zhang, Y.; Luo, H.; Xiao, Q.; Tang, S.; Liang, X.-F. Effects of three feed attractants on the growth, biochemical indicators, lipid metabolism and appetite of Chinese perch (Siniperca chuatsi). Aquac. Rep. 2022, 23, 101075. [Google Scholar] [CrossRef]
  4. Xiao, W.; Zou, Z.; Li, D.; Zhu, J.; Yue, Y.; Yang, H. Effect of dietary phenylalanine level on growth performance, body composition, and biochemical parameters in plasma of juvenile hybrid tilapia, Oreochromis niloticus × Oreochromis aureus. J. World Aquac. Soc. 2020, 51, 437–451. [Google Scholar] [CrossRef]
  5. Huang, D.; Wu, Y.; Lin, Y.; Chen, J.; Karrow, N.; Ren, X.; Wang, Y. Dietary Protein and Lipid Requirements for Juvenile Largemouth Bass, Micropterus salmoides. J. World Aquac. Soc. 2017, 48, 782–790. [Google Scholar] [CrossRef]
  6. Li, X.; Zheng, S.; Ma, X.; Cheng, K.; Wu, G. Effects of dietary protein and lipid levels on the growth performance, feed utilization, and liver histology of largemouth bass (Micropterus salmoides). Amino Acids 2020, 52, 1043–1061. [Google Scholar] [CrossRef]
  7. Chen, Y.; Yang, H.; Guo, B.; Li, X.; Leng, X. Dietary effects of protein and lipid levels on growth performance and flesh quality of large-size largemouth bass (Micropterus salmoides). Aquac. Rep. 2023, 33, 101852. [Google Scholar] [CrossRef]
  8. Chen, N.S.; Xiao, W.W.; Liang, Q.L.; Zhou, H.Y.; Ma, X.L.; Zhao, M. Effects of dietary lipid to protein ratios on growth performance, body composition and non-specific immunity of largemouth bass (Micropterus salmoides). J. Fish. China 2012, 36, 1270–1280. [Google Scholar] [CrossRef]
  9. Zhou, Y.L.; Guo, J.L.; Tang, R.J.; Ma, H.J.; Chen, Y.J.; Lin, S.M. High dietary lipid level alters the growth, hepatic metabolism enzyme, and anti-oxidative capacity in juvenile largemouth bass Micropterus salmoides. Fish Physiol. Biochem. 2020, 46, 125–134. [Google Scholar] [CrossRef] [PubMed]
  10. Guo, J.L.; Zhou, Y.L.; Zhao, H.; Chen, W.Y.; Chen, Y.J.; Lin, S.M. Effect of dietary lipid level on growth, lipid metabolism and oxidative status of largemouth bass, Micropterus salmoides. Aquaculture 2019, 506, 394–400. [Google Scholar] [CrossRef]
  11. Borges, P.; Valente, L.M.P.; Veron, V.; Dias, K.; Panserat, S.; Medale, F. High Dietary Lipid Level Is Associated with Persistent Hyperglycaemia and Downregulation of Muscle Akt-mTOR Pathway in Senegalese Sole (Solea senegalensis). PLoS ONE 2014, 9, e102196. [Google Scholar] [CrossRef] [PubMed]
  12. Liao, K.; Yan, J.; Mai, K.; Ai, Q. Dietary lipid concentration affects liver mitochondrial DNA copy number, gene expression and DNA methylation in large yellow croaker (Larimichthys crocea). Comp. Biochem. Physiol. Part B Mol. Integr. Physiol. 2016, 193, 25–32. [Google Scholar] [CrossRef]
  13. Wang, J.; Liu, T.; Zheng, P.; Xu, H.; Su, H.; Tao, H.; Yang, Y. Effect of dietary lipid levels on growth performance, body composition, and feed utilization of juvenile spotted knifejaw Oplegnathus punctatus. Aquac. Rep. 2021, 21, 100797. [Google Scholar] [CrossRef]
  14. Cho, C.Y.; Kaushik, S.J. Nutritional energetics in fish: Energy and protein utilization in rainbow trout (Salmo gairdneri). World Rev. Nutr. Diet. 1990, 61, 132–172. [Google Scholar] [PubMed]
  15. Kaushik, S.J.; Médale, F. Energy requirements, utilization and dietary supply to salmonids. Aquaculture 1994, 124, 81–97. [Google Scholar] [CrossRef]
  16. Kim, H.; Park, M.; Shin, J.H.; Kwon, O. Ethanolic Extract of Acanthopanax koreanum Nakai Alleviates Alcoholic Liver Damage Combined with a High-Fat Diet in C57BL/6J Mice. Molecules 2016, 21, 681. [Google Scholar] [CrossRef]
  17. Qi, J.; Kim, J.W.; Zhou, Z.; Lim, C.-W.; Kim, B. Ferroptosis Affects the Progression of Nonalcoholic Steatohepatitis via the Modulation of Lipid Peroxidation–Mediated Cell Death in Mice. Am. J. Pathol. 2020, 190, 68–81. [Google Scholar] [CrossRef]
  18. Tsurusaki, S.; Tsuchiya, Y.; Koumura, T.; Nakasone, M.; Sakamoto, T.; Matsuoka, M.; Imai, H.; Yuet-Yin Kok, C.; Okochi, H.; Nakano, H.; et al. Hepatic ferroptosis plays an important role as the trigger for initiating inflammation in nonalcoholic steatohepatitis. Cell Death Dis. 2019, 10, 449. [Google Scholar] [CrossRef]
  19. Zhang, X.J.; Zhou, L.; Lu, W.J.; Du, W.X.; Mi, X.Y.; Li, Z.; Li, X.Y.; Wang, Z.W.; Wang, Y.; Duan, M.; et al. Comparative transcriptomic analysis reveals an association of gibel carp fatty liver with ferroptosis pathway. BMC Genom. 2021, 22, 328. [Google Scholar] [CrossRef]
  20. Chen, X.; Li, J.; Kang, R.; Klionsky, D.J.; Tang, D. Ferroptosis: Machinery and regulation. Autophagy 2021, 17, 2054–2081. [Google Scholar] [CrossRef]
  21. Li, Y.; Feng, D.; Wang, Z.; Zhao, Y.; Sun, R.; Tian, D.; Liu, D.; Zhang, F.; Ning, S.; Yao, J.; et al. Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion. Cell Death Differ. 2019, 26, 2284–2299. [Google Scholar] [CrossRef] [PubMed]
  22. Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
  23. Yang, W.S.; Stockwell, B.R. Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol. 2016, 26, 165–176. [Google Scholar] [CrossRef] [PubMed]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  25. YunFei, Z.; ChaoMing, S.; Yuelang, Z.; YongJun, C.; ShiMei, L.; RenJun, T. Optimum dietary fiber level could improve growth, plasma biochemical indexes and liver function of largemouth bass, Micropterus salmoides. Aquaculture 2020, 518, 734661. [Google Scholar]
  26. Shen, Y.; Li, X.; Bao, Y.; Zhu, T.; Wu, Z.; Yang, B.; Jiao, L.; Zhou, Q.; Jin, M. Differential regulatory effects of optimal or excessive dietary lipid levels on growth, lipid metabolism and physiological response in black seabream (Acanthopagrus schlegelii). Aquaculture 2022, 560, 738532. [Google Scholar] [CrossRef]
  27. Xu, J.H.; Qin, J.; Yan, B.L.; Zhu, M.; Luo, G. Effects of dietary lipid levels on growth performance, feed utilization and fatty acid composition of juvenile Japanese seabass (Lateolabrax japonicus) reared in seawater. Aquac. Int. 2011, 19, 79–89. [Google Scholar] [CrossRef]
  28. Fei, S.; Chen, Z.; Duan, Y.; Liu, H.; Jin, J.; Yang, Y.; Han, D.; Zhu, X.; Xie, S. Growth, reproduction, fatty acid profiles and offspring performance of broodstock yellow catfish Pelteobagrus fulvidraco fed diets with different lipid levels. Aquaculture 2024, 580, 740273. [Google Scholar] [CrossRef]
  29. Bertucci, J.I.; Blanco, A.M.; Navarro, J.C.; Unniappan, S.; Canosa, L.F. Dietary protein:lipid ratio modulates somatic growth and expression of genes involved in somatic growth, lipid metabolism and food intake in Pejerrey fry (Odontesthes bonariensis). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2022, 270, 111231. [Google Scholar] [CrossRef]
  30. Calo, J.; Conde-Sieira, M.; Comesana, S.; Soengas, J.L.; Blanco, A.M. Fatty acids of different nature differentially modulate feed intake in rainbow trout. Aquaculture 2023, 563, 738961. [Google Scholar] [CrossRef]
  31. Ruyter, B.; Moya-Falcón, C.; Rosenlund, G.; Vegusdal, A. Fat content and morphology of liver and intestine of Atlantic salmon (Salmo salar): Effects of temperature and dietary soybean oil. Aquaculture 2006, 252, 441–452. [Google Scholar] [CrossRef]
  32. Abdel-Ghany, H.M.; Salem, M.E.-S.; Ezzat, A.A.; Essa, M.A.; Helal, A.M.; Ismail, R.F.; El-Sayed, A.-F.M. Effects of different levels of dietary lipids on growth performance, liver histology and cold tolerance of Nile tilapia (Oreochromis niloticus). J. Therm. Biol. 2021, 96, 102833. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, Y.; Jiang, W.D.; Wu, P.; Liu, Y.; Jin, X.W.; Jiang, J.; Tang, J.Y.; Feng, L.; Zhou, X.Q. Dietary selenium promoted muscle growth (myofiber hypertrophy rather than hyperplasia) by reducing endoplasmic reticulum stress in juvenile grass carp (Ctenopharyngodon idella). Aquaculture 2023, 575, 739796. [Google Scholar] [CrossRef]
  34. Wang, J.-T.; Liu, Y.-J.; Tian, L.-X.; Mai, K.-S.; Du, Z.-Y.; Wang, Y.; Yang, H.-J. Effect of dietary lipid level on growth performance, lipid deposition, hepatic lipogenesis in juvenile cobia (Rachycentron canadum). Aquaculture 2005, 249, 439–447. [Google Scholar] [CrossRef]
  35. Ghanawi, J.; Roy, L.; Davis, D.A.; Saoud, I.P. Effects of dietary lipid levels on growth performance of marbled spinefoot rabbitfish Siganus rivulatus. Aquaculture 2011, 310, 395–400. [Google Scholar] [CrossRef]
  36. Vergara, J.M.; López, C.G.; Robaina, L.; Caballero, M.J.; Montero, D.; Izquierdo, M.S.; Aksnes, A. Growth, feed utilization and body lipid content of gilthead seabream (Sparus aurata) fed increasing lipid levels and fish meals of different quality. Aquaculture 1999, 179, 35–44. [Google Scholar] [CrossRef]
  37. Jiang, Y.D.; Wang, J.T.; Han, T.; Li, X.Y.; Hu, S.X. Effect of dietary lipid level on growth performance, feed utilization and body composition by juvenile red spotted grouper (Epinephelus akaara). Aquac. Int. 2015, 23, 99–110. [Google Scholar] [CrossRef]
  38. Song, L.P.; An, L.; Zhu, Y.A.; Li, X.; Wang, A.Y. Effects of Dietary Lipids on Growth and Feed Utilization of Jade Perch. J. World Aquac. Soc. 2009, 40, 266–273. [Google Scholar] [CrossRef]
  39. Borges, P.; Casal, S.; Conceição, L.; Dias, J.; Oliveira, B.; Valente, L.M.P. Dietary lipid level affects growth performance and nutrient utilisation of Senegalese sole (Solea senegalensis) juveniles. Br. J. Nutr. 2009, 102, 1007–1014. [Google Scholar] [CrossRef]
  40. Lu, K.L.; Xu, W.N.; Liu, W.B.; Wang, L.N.; Zhang, C.N.; Li, X.F. Association of mitochondrial dysfunction with oxidative stress and immune suppression in Blunt Snout Bream Megalobrama amblycephala fed a high-fat diet. J. Aquat. Anim. Health 2014, 26, 100–112. [Google Scholar] [CrossRef]
  41. Wang, X.; Li, Y.; Hou, C.; Gao, Y.; Wang, Y. Physiological and molecular changes in large yellow croaker (Pseudosciaena crocea R.) with high-fat diet-induced fatty liver disease. Aquac. Res. 2015, 46, 272–282. [Google Scholar] [CrossRef]
  42. Jia, H.; Liu, N.; Zhang, Y.; Wang, C.; Yang, Y.; Wu, Z. 3-Acetyldeoxynivalenol induces cell death through endoplasmic reticulum stress in mouse liver. Environ. Pollut. 2021, 286, 117238. [Google Scholar] [CrossRef] [PubMed]
  43. Astuti, S.D.; Febriastri, A.R.; Mukti, A.T.; Yaqubi, A.K.; Susilo, Y.; Syahrom, A. Photobiomodulation effect of infra-red laser on the level of gonad maturity in the Simese Catfish (Pangasianodon hypophthalmus). Heliyon 2023, 9, e23253. [Google Scholar] [CrossRef] [PubMed]
  44. Abulikemu, A.; Zhao, X.; Xu, H.; Li, Y.; Ma, R.; Yao, Q.; Wang, J.; Sun, Z.; Li, Y.; Guo, C. Silica nanoparticles aggravated the metabolic associated fatty liver disease through disturbed amino acid and lipid metabolisms-mediated oxidative stress. Redox Biol. 2023, 59, 102569. [Google Scholar] [CrossRef] [PubMed]
  45. Deng, Y.; Zhang, W.; Yang, Z.; Kong, Q.; Liu, P.; Liao, H.; Cui, Z.; Tang, H. Dietary Lactobacillus plantarum can alleviate high starch diet-induced liver lipid deposition, tissue damage and oxidative stress in largemouth bass (Micropterus salmoides). Aquac. Rep. 2024, 35, 101955. [Google Scholar] [CrossRef]
  46. Zhang, J.K.; Zhou, X.L.; Wang, X.Q.; Zhang, J.X.; Yang, M.L.; Liu, Y.P.; Cao, J.X.; Cheng, G.G. Que Zui tea ameliorates hepatic lipid accumulation and oxidative stress in high fat diet induced nonalcoholic fatty liver disease. Food Res. Int. 2022, 156, 111196. [Google Scholar] [CrossRef]
  47. Fernández-Sánchez, A.; Madrigal-Santillán, E.; Bautista, M.; Esquivel-Soto, J.; Morales-González, A.; Esquivel-Chirino, C.; Durante-Montiel, I.; Sánchez-Rivera, G.; Valadez-Vega, C.; Morales-González, J.A. Inflammation, oxidative stress, and obesity. Int. J. Mol. Sci. 2011, 12, 3117–3132. [Google Scholar] [CrossRef] [PubMed]
  48. Das, S.K.; Vasudevan, D.M. Alcohol-induced oxidative stress. Life Sci. 2007, 81, 177–187. [Google Scholar] [CrossRef]
  49. Xu, Y.; Li, Y.; Li, J.; Chen, W. Ethyl carbamate triggers ferroptosis in liver through inhibiting GSH synthesis and suppressing Nrf2 activation. Redox Biol. 2022, 53, 102349. [Google Scholar] [CrossRef]
  50. Ma, X.; Bi, Q.; Kong, Y.; Xu, H.; Liang, M.; Mai, K.; Zhang, Y. Dietary lipid levels affected antioxidative status, inflammation response, apoptosis and microbial community in the intestine of juvenile turbot (Scophthalmus maximus L.). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2022, 264, 111118. [Google Scholar] [CrossRef]
  51. Xu, H.; Han, T.; Li, X.; Wang, J.; Zheng, P.; Yin, F.; Wang, C. Effects of dietary lipid levels on survival, growth performance, and antioxidant ability of the early juvenile Scylla paramamosain. Aquaculture 2020, 528, 735559. [Google Scholar] [CrossRef]
  52. Yang, Y.; Chen, J.; Gao, Q.; Shan, X.; Wang, J.; Lv, Z. Study on the attenuated effect of Ginkgolide B on ferroptosis in high fat diet induced nonalcoholic fatty liver disease. Toxicology 2020, 445, 152599. [Google Scholar] [CrossRef]
  53. Xu, S.; Xiaojing, L.; Xinyue, S.; Wei, C.; Honggui, L.; Shiwen, X. Pig lung fibrosis is active in the subacute CdCl2 exposure model and exerts cumulative toxicity through the M1/M2 imbalance. Ecotoxicol. Environ. Saf. 2021, 225, 112757. [Google Scholar] [CrossRef]
  54. Wang, L.; Zhang, W.; Gladstone, S.; Ng, W.-K.; Zhang, J.; Shao, Q. Effects of isoenergetic diets with varying protein and lipid levels on the growth, feed utilization, metabolic enzymes activities, antioxidative status and serum biochemical parameters of black sea bream (Acanthopagrus schlegelii). Aquaculture 2019, 513, 734397. [Google Scholar] [CrossRef]
  55. Li, X.; Wang, T.X.; Huang, X.; Li, Y.; Sun, T.; Zang, S.; Guan, K.L.; Xiong, Y.; Liu, J.; Yuan, H.X. Targeting ferroptosis alleviates methionine-choline deficient (MCD)-diet induced NASH by suppressing liver lipotoxicity. Liver Int. 2020, 40, 1378–1394. [Google Scholar] [CrossRef]
  56. Wei, S.; Qiu, T.; Wang, N.; Yao, X.; Jiang, L.; Jia, X.; Tao, Y.; Zhang, J.; Zhu, Y.; Yang, G.; et al. Ferroptosis mediated by the interaction between Mfn2 and IREα promotes arsenic-induced nonalcoholic steatohepatitis. Environ. Res. 2020, 188, 109824. [Google Scholar] [CrossRef] [PubMed]
  57. Jiang, J.J.; Zhang, G.F.; Zheng, J.Y.; Sun, J.H.; Ding, S.B. Targeting Mitochondrial ROS-Mediated Ferroptosis by Quercetin Alleviates High-Fat Diet-Induced Hepatic Lipotoxicity. Front. Pharmacol. 2022, 13, 876550. [Google Scholar] [CrossRef] [PubMed]
  58. Kim, K.M.; Cho, S.S.; Ki, S.H. Emerging roles of ferroptosis in liver pathophysiology. Pharmacal Res. 2020, 43, 985–996. [Google Scholar] [CrossRef]
  59. Buzzetti, E.; Petta, S.; Manuguerra, R.; Luong, T.V.; Cabibi, D.; Corradini, E.; Craxì, A.; Pinzani, M.; Tsochatzis, E.; Pietrangelo, A. Evaluating the association of serum ferritin and hepatic iron with disease severity in non-alcoholic fatty liver disease. Liver Int. 2019, 39, 1325–1334. [Google Scholar] [CrossRef]
  60. Crawford, D.H.G.; Ross, D.G.F.; Jaskowski, L.A.; Burke, L.J.; Britton, L.J.; Musgrave, N.; Briskey, D.; Rishi, G.; Bridle, K.R.; Subramaniam, V.N. Iron depletion attenuates steatosis in a mouse model of non-alcoholic fatty liver disease: Role of iron-dependent pathways. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2021, 1867, 166142. [Google Scholar] [CrossRef]
  61. Dongiovanni, P.; Lanti, C.; Gatti, S.; Rametta, R.; Recalcati, S.; Maggioni, M.; Fracanzani, A.L.; Riso, P.; Cairo, G.; Fargion, S.; et al. High fat diet subverts hepatocellular iron uptake determining dysmetabolic iron overload. PLoS ONE 2015, 10, e0116855. [Google Scholar] [CrossRef] [PubMed]
  62. Liu, J.; Kang, R.; Tang, D. Signaling pathways and defense mechanisms of ferroptosis. FEBS J. 2022, 289, 7038–7050. [Google Scholar] [CrossRef]
  63. Jia, M.; Zhang, H.; Qin, Q.; Hou, Y.; Zhang, X.; Chen, D.; Zhang, H.; Chen, Y. Ferroptosis as a new therapeutic opportunity for nonviral liver disease. Eur. J. Pharmacol. 2021, 908, 174319. [Google Scholar] [CrossRef] [PubMed]
  64. Sun, X.; Ou, Z.; Xie, M.; Kang, R.; Fan, Y.; Niu, X.; Wang, H.; Cao, L.; Tang, D. HSPB1 as a novel regulator of ferroptotic cancer cell death. Oncogene 2015, 34, 5617–5625. [Google Scholar] [CrossRef] [PubMed]
  65. Liu, Y.; Yan, Y.; Han, Z.; Zheng, Y.; Wang, X.; Zhang, M.; Li, H.; Xu, J.; Chen, X.; Ding, Z.; et al. Comparative effects of dietary soybean oil and fish oil on the growth performance, fatty acid composition and lipid metabolic signaling of grass carp, Ctenopharyngodon idella. Aquac. Rep. 2022, 22, 101002. [Google Scholar] [CrossRef]
  66. Chen, Y.; Sun, Z.; Liang, Z.; Xie, Y.; Su, J.; Luo, Q.; Zhu, J.; Liu, Q.; Han, T.; Wang, A. Effects of dietary fish oil replacement by soybean oil and l-carnitine supplementation on growth performance, fatty acid composition, lipid metabolism and liver health of juvenile largemouth bass, Micropterus salmoides. Aquaculture 2020, 516, 734596. [Google Scholar] [CrossRef]
  67. Kagan, V.E.; Mao, G.; Qu, F.; Angeli, J.P.F.; Doll, S.; Croix, C.S.; Dar, H.H.; Liu, B.; Tyurin, V.A.; Ritov, V.B.; et al. Oxidized arachidonic and adrenic PEs navigate cells to ferroptosis. Nat. Chem. Biol. 2017, 13, 81–90. [Google Scholar] [CrossRef]
  68. Doll, S.; Freitas, F.P.; Shah, R.; Aldrovandi, M.; da Silva, M.C.; Ingold, I.; Goya Grocin, A.; da Silva, T.N.X.; Panzilius, E.; Scheel, C.H.; et al. FSP1 is a glutathione-independent ferroptosis suppressor. Nature 2019, 575, 693–698. [Google Scholar] [CrossRef]
  69. Hansen, J.Ø.; Berge, G.M.; Hillestad, M.; Krogdahl, Å.; Galloway, T.F.; Holm, H.; Holm, J.; Ruyter, B. Apparent digestion and apparent retention of lipid and fatty acids in Atlantic cod (Gadus morhua) fed increasing dietary lipid levels. Aquaculture 2008, 284, 159–166. [Google Scholar] [CrossRef]
  70. Dixon, S.J.; Winter, G.E.; Musavi, L.S.; Lee, E.D.; Snijder, B.; Rebsamen, M.; Superti-Furga, G.; Stockwell, B.R. Human Haploid Cell Genetics Reveals Roles for Lipid Metabolism Genes in Nonapoptotic Cell Death. ACS Chem. Biol. 2015, 10, 1604–1609. [Google Scholar] [CrossRef]
  71. Brown, C.W.; Amante, J.J.; Goel, H.L.; Mercurio, A.M. The α6β4 integrin promotes resistance to ferroptosis. J. Cell Biol. 2017, 216, 4287–4297. [Google Scholar] [CrossRef] [PubMed]
  72. Wu, J.; Minikes, A.M.; Gao, M.; Bian, H.; Li, Y.; Stockwell, B.R.; Chen, Z.-N.; Jiang, X. Intercellular interaction dictates cancer cell ferroptosis via NF2-YAP signalling. Nature 2019, 572, 402. [Google Scholar] [CrossRef] [PubMed]
  73. Yang, W.S.; Kim, K.J.; Gaschler, M.M.; Patel, M.; Shchepinov, M.S.; Stockwell, B.R. Peroxidation of polyunsaturated fatty acids by lipoxygenases drives ferroptosis. Proc. Natl. Acad. Sci. USA 2016, 113, E4966–E4975. [Google Scholar] [CrossRef] [PubMed]
  74. Li, Y.; Maher, P.; Schubert, D. A role for 12-lipoxygenase in nerve cell death caused by glutathione depletion. Neuron 1997, 19, 453–463. [Google Scholar] [CrossRef] [PubMed]
  75. Lei, G.; Zhang, Y.; Koppula, P.; Liu, X.; Zhang, J.; Lin, S.H.; Ajani, J.A.; Xiao, Q.; Liao, Z.; Wang, H.; et al. The role of ferroptosis in ionizing radiation-induced cell death and tumor suppression. Cell Res. 2020, 30, 146–162. [Google Scholar] [CrossRef]
  76. Yang, M.; Lu, Z.; Li, F.; Shi, F.; Zhan, F.; Zhao, L.; Li, Y.; Li, J.; Lin, L.; Qin, Z. Escherichia coli induced ferroptosis in red blood cells of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2021, 112, 159–167. [Google Scholar] [CrossRef]
Antioxidants 13 00808 g001
Figure 1. The largemouth bass given the experiment diets showed a relationship between dietary lipid levels and percent weight increase (WG, %).
Figure 1. The largemouth bass given the experiment diets showed a relationship between dietary lipid levels and percent weight increase (WG, %).
Antioxidants 13 00808 g001
Antioxidants 13 00808 g002
Figure 2. Anatomy and histological analysis of livers of largemouth bass fed different lipid level diets ((A): 6.45%; (B): 8.58%; (C): 12.46%; (D): 14.56%; (E): 16.37%; (F): 18.24%). Liver morphology and paraffin-embedding prepared liver sections, stained with hematoxylin and eosin (black arrow: fat drop; red arrow: nuclear migration; and black circle: cytolysis). Scale bars = 20 µm (400×).
Figure 2. Anatomy and histological analysis of livers of largemouth bass fed different lipid level diets ((A): 6.45%; (B): 8.58%; (C): 12.46%; (D): 14.56%; (E): 16.37%; (F): 18.24%). Liver morphology and paraffin-embedding prepared liver sections, stained with hematoxylin and eosin (black arrow: fat drop; red arrow: nuclear migration; and black circle: cytolysis). Scale bars = 20 µm (400×).
Antioxidants 13 00808 g002
Antioxidants 13 00808 g003
Figure 3. Effect of varying dietary lipid composition on largemouth bass liver antioxidant capability. The content of GSH (A) and GSSG (B) in the livers of largemouth bass. Largemouth bass liver enzyme activity measured by glutathione peroxidase (GPX, (C)), glutathione reductase (GR, (D)), and glutathione S-transferase (GST, (E)). Solute carrier family 7 member 11 (SLC7A11) and GPX4 (glutathione peroxidase 4) mRNA expression and protein levels in largemouth bass liver tissue (F–J). The data show three replicates’ means ± SD. Bars labeled with unique letters represent statistically significant differences at a significance level of p < 0.05.
Figure 3. Effect of varying dietary lipid composition on largemouth bass liver antioxidant capability. The content of GSH (A) and GSSG (B) in the livers of largemouth bass. Largemouth bass liver enzyme activity measured by glutathione peroxidase (GPX, (C)), glutathione reductase (GR, (D)), and glutathione S-transferase (GST, (E)). Solute carrier family 7 member 11 (SLC7A11) and GPX4 (glutathione peroxidase 4) mRNA expression and protein levels in largemouth bass liver tissue (F–J). The data show three replicates’ means ± SD. Bars labeled with unique letters represent statistically significant differences at a significance level of p < 0.05.
Antioxidants 13 00808 g003
Antioxidants 13 00808 g004
Figure 4. Effects of different lipid levels on liver iron homeostasis of largemouth bass. The content of Fe2+ in liver tissues (A). The mRNA expression (B,C) and protein levels (D–F) of TF (Transferrin) and TFR (Transferrin receptor) in liver tissues. Data represent means ± SD of three replicates. Bars with different letters indicate significant differences (p < 0.05).
Figure 4. Effects of different lipid levels on liver iron homeostasis of largemouth bass. The content of Fe2+ in liver tissues (A). The mRNA expression (B,C) and protein levels (D–F) of TF (Transferrin) and TFR (Transferrin receptor) in liver tissues. Data represent means ± SD of three replicates. Bars with different letters indicate significant differences (p < 0.05).
Antioxidants 13 00808 g004
Antioxidants 13 00808 g005
Figure 5. The mRNA expressions of ACSL4 (Acyl-CoA synthetase long-chain family member 4, (A)), LPCAT3 (Lysophosphatidylcholine acyltransferase 3, (B)), and LOX12 (Lipoxygenase-12, (C)) in the livers of largemouth bass with dietary different lipid levels. Western blotting images of ACSL4, LPCAT3, LOX12 and β-antin (D). The protein levels of ACSL4 (E), LPCAT3 (F), and LOX12 (G) were analyzed by Western blotting in the livers of largemouth bass with dietary different lipid levels. Values are expressed as the mean ± SD of three replicates. Bars labeled with different letters represent statistically significant differences (p < 0.05).
Figure 5. The mRNA expressions of ACSL4 (Acyl-CoA synthetase long-chain family member 4, (A)), LPCAT3 (Lysophosphatidylcholine acyltransferase 3, (B)), and LOX12 (Lipoxygenase-12, (C)) in the livers of largemouth bass with dietary different lipid levels. Western blotting images of ACSL4, LPCAT3, LOX12 and β-antin (D). The protein levels of ACSL4 (E), LPCAT3 (F), and LOX12 (G) were analyzed by Western blotting in the livers of largemouth bass with dietary different lipid levels. Values are expressed as the mean ± SD of three replicates. Bars labeled with different letters represent statistically significant differences (p < 0.05).
Antioxidants 13 00808 g005
Antioxidants 13 00808 g006
Figure 6. Mechanisms by which excess lipid levels promote hepatic ferroptosis in largemouth bass. PUFA (polyunsaturated fatty acids), ACSL4 (Acyl-CoA synthetase long-chain family member 4), PUFA-CoA (polyunsaturated fatty acids-Coenzyme A), lyso-PL (lysophospholipid), LPCAT3 (Lysophosphatidylcholine acyltransferase 3), PUFA-PL (polyunsaturated fatty acids-phospholipid), LOX12 (Lipoxygenase 12), GPX4 (glutathione peroxidase), PUFA-OH (lipid alcohols), PUFA-OOH (lipid hydroperoxide), GSSG (oxidized glutathione), GSH (reduced glutathione), ALT (Alanine aminotransferase), AST (Aspartate transaminase), TG (triglyceride), and TC (total cholesterol).
Figure 6. Mechanisms by which excess lipid levels promote hepatic ferroptosis in largemouth bass. PUFA (polyunsaturated fatty acids), ACSL4 (Acyl-CoA synthetase long-chain family member 4), PUFA-CoA (polyunsaturated fatty acids-Coenzyme A), lyso-PL (lysophospholipid), LPCAT3 (Lysophosphatidylcholine acyltransferase 3), PUFA-PL (polyunsaturated fatty acids-phospholipid), LOX12 (Lipoxygenase 12), GPX4 (glutathione peroxidase), PUFA-OH (lipid alcohols), PUFA-OOH (lipid hydroperoxide), GSSG (oxidized glutathione), GSH (reduced glutathione), ALT (Alanine aminotransferase), AST (Aspartate transaminase), TG (triglyceride), and TC (total cholesterol).
Antioxidants 13 00808 g006
Table 1. Dietary composition and nutritional content.
Table 1. Dietary composition and nutritional content.
Ingredients (g kg−1) 1Dietary Lipid Levels (%)
6812141618
Soybean oil0206080100120
Microcrystalline cellulose1271076747277
Fishmeal430430430430430430
Chicken powder707070707070
Pork powder909090909090
Gluten707070707070
Fermented soybean meal505050505050
Wheat meal505050505050
Cassava starch505050505050
Lysine222222
DL-Methionine222222
CaH2PO4101010101010
Phospholipid oil202020202020
Choline chloride444444
Vitamin premix 2151515151515
Mineral premix 3101010101010
Nutrients content (%) 4
Crude protein47.1547.2247.2547.2447.6447.50
Crude lipid6.458.5812.4614.5616.3718.24
Ash16.4916.3716.4316.9016.2416.55
Moisture7.467.317.397.557.467.36
Gross energy (MJ kg−1)16.0516.8918.4119.2320.0220.72
1 Soybean oil (Baker Commodities Co., Ltd., Chengdu, China), fishmeal (Chengdu Meiyide Biotechnology Co., Ltd., Chengdu, China), chicken powder (Sichuan Xinrui Feed Technology Co., Ltd., Chengdu, China), pork powder, gluten (Dongguan Yihai Kerry Serui Starch Co., Ltd., Dongguan, China), fermented soybean meal (Shandong Hengfeng Lebang Biological Technology Co., Ltd., Linyi, China), wheat meal (Sichuan Wanfeng Cereals and Oils Co., Ltd., Deyang, China), cassava starch (Xionghe Beiguang Co., Ltd., Chengdu, China), Lysine, DL-Methionine (Chuanheng Ecological Technology Co., Ltd., Deyang, China), CaH2PO4 (Chuanheng Ecological Technology Co., Ltd., Deyang, China). Fish meal (66.94% crude protein, 8.15% crude lipid); chicken powder (59.67% crude protein, 12.31% crude lipid); pork powder (64.18% crude protein, 20.81% crude lipid); gluten (78.7% crude protein, 1.33% crude lipid); fermented soybean meal (45.67% crude protein, 3.46% crude lipid); and wheat meal (13.46% crude protein, 1.61% crude lipid). 2 Vitamin premix (g kg−1 premix): vitamin A, 8.89 g; vitamin E, 14.67 g; vitamin B12, 6.67 g; vitamin D, 53.33 g; Folic acid, 0.13 g; Biotin, 3.33 g; Inositol, 27.21 g; vitamin B1, 1.40 g; Riboflavin, 2.92 g; Pyridoxine, 1.47 g; vitamin K3, 1.39 g; Pantothenic acid, 3.89 g; niacin, 3.00 g; and vitamin C, 110.53 g. All ingredients were diluted with cassava starch to 1.00 kg. 3 Mineral premix (g kg−1 premix): FeSO4·H2O, 10.00 g; MgSO4·H2O, 52.82 g; CuSO4·5H2O, 2.00 g; ZnSO4·H2O, 11.59 g; MnSO4·H2O, 3.77 g; CoCl2·6H2O, 8.06 g; Ca(IO3)2, 6.13 g; Na2SeO3, 44.44 g; KH2PO4, 17.40 g; and NaCl, 7.63 g. All ingredients were diluted with CaCO3 to 1.00 kg. 4 Crude protein, crude lipid, and ash were measured using the Association of Official Analytical Chemists (AOAC) methods.
Table 2. Primer sequences of genes chosen for Real-time PCR analysis.
Table 2. Primer sequences of genes chosen for Real-time PCR analysis.
Name 1SequencesTm (°C) 2Accession NumberE (%) 3
ACSL4-QFGATCTGCACTCACCCCGACA61.4XM_03869989992.3
ACSL4-QRGCTCTGGACTCAAATGCACCT
LPCAT3-QFCAGCCCTTCTGGTATCGTTG63.3XM_03871111199.3
LPCAT3-QRATACACCCTCCGCTATAACCC
LOX12-QFATGGTGCATACCTGACACCTC61.4XM_03873134092.6
LOX12-QRTCCCTCACTTGGCCTTTCTTG
TF-QF
TF-QR		GGGCAACAATCCCCAAACT
TCATCCACCAGACACTGAAAGG		61.4XM_03871803794.4
TFR-QF
TFR-QR		CTTCCTGTCGCCCTATGAGTC
GTCTGCCTTAGGGTTGTTGGT		64.5XM_038718573100.4
GPX4-QFGTTTACGCATCCTTGCCTTCC59.0XM_03871629297.7
GPX4-QRGCTCTTTCAGCCACTTCCACAA
SLC7A11-QF
SLC7A11-QR		GGGGCTACAGATCACACGAG
ACACTACAGCCCCTTTGACC		57XM_03869972295.8
β-actin-QFCCCCATCCACCATGAAGA55.7XM_03869535193.6
β-actin-QRCCTGCTTGCTGATCCACAT
18S-QFTGAATACCGCAGCTAGGAATAATG59.0MH_018569.199.5
18S-QRCCTCCGACTTTCGTTCTTGATT
1 ACSL4 (Acyl-CoA synthetase long-chain family member 4), LPCAT3 (Lysophosphatidylcholine acyltransferase 3), LOX12 (Lipoxygenase-12), TF (Transferrin), TFR (Transferrin receptor), GPX4 (glutathione peroxidase 4) and SLC7A11(Solute carrier family 7 member 11); 2 Tm (melting temperature, °C); and 3 E (amplification efficiency, %).
Table 3. IBW, FBW, PWG, SGR, FI, FE, FCR, PER, CF, VSI, and LSI of largemouth bass fed diets with graded levels of lipid (g kg−1 diets) for 11 weeks 1.
Table 3. IBW, FBW, PWG, SGR, FI, FE, FCR, PER, CF, VSI, and LSI of largemouth bass fed diets with graded levels of lipid (g kg−1 diets) for 11 weeks 1.
ItemsDietary Lipid Levels
6812141618
IBW 214.39 ± 0.1314.31 ± 0.0714.38 ± 0.0314.37 ± 0.0214.31 ± 0.1614.40 ± 0.07
FBW82.86 ± 1.00 bc86.28 ± 3.80 b92.93 ± 3.05 a91.33 ± 0.42 a81.16 ± 1.11 bc79.24 ± 2.07 c
SR98.33 ± 1.7098.67 ± 1.2599.67 ± 0.4799.33 ± 0.4799.33 ± 0.4799.00 ± 1.41
WG475.91 ± 10.55 cd502.87 ± 27.71 bc546.10 ± 19.73 a535.48 ± 3.50 ab467.28 ± 3.42 cd450.45 ± 14.78 d
SGR2.27 ± 0.02 cd2.33 ± 0.06 bc2.42 ± 0.04 a2.40 ± 0.01 ab2.25 ± 0.01 d2.21 ± 0.03 d
FI61.54 ± 2.13 bc63.76 ± 5.18 ab67.55 ± 2.21 a67.20 ± 1.31 a59.53 ± 0.42 bc58.55 ± 2.17 c
FE111.31.24 ± 1.85 b112.98 ± 1.93 ab116.27 ± 2.71 a114.53 ± 1.49 ab112.30 ± 1.83 ab110.78 ± 2.98 b
FCR89.85 ± 1.51 a88.53 ± 1.50 ab86.04 ± 2.02 b87.32 ± 1.14 ab89.06 ± 1.44 ab90.31 ± 2.46 a
PER2.40 ± 0.042.37 ± 0.012.33 ± 0.032.34 ± 0.042.36 ± 0.042.36 ± 0.02
CF2.20 ± 0.042.17 ± 0.032.19 ± 0.062.18 ± 0.032.20 ± 0.032.14 ± 0.06
VSI7.92 ± 0.13 d8.37 ± 0.12 c8.74 ± 0.17 bc8.91 ± 0.20 b9.42 ± 0.09 a9.74 ± 0.29 a
HSI2.82 ± 0.04 b2.68 ± 0.07 b2.99 ± 0.05 b2.93 ± 0.42 b3.45 ± 0.13 a3.64 ± 0.22 a
1 Values are the mean ± SD, n = 3. Mean values with different superscripts in the same row are significantly different (p < 0.05). 2 IBW (initial body weight, g fish−1), FBW (final body weight, g fish−1), SR (survival rate, %), WG (weight gain, %), SGR (specific growth rate, %/d), FI (feed intake, g fish-1), FE (feed efficiency, %), FCR (feed conversion ratio, %), PER (protein efficiency ratio, %), CF (condition factor, %), VSI (visceral body index, %), HSI (hepatosomatic index, %), VW (viscera weight, g fish−1), and LW (liver weight, g fish−1). SR (%) = 100 × final fish number/initial fish number; PWG (%) = 100 × (FBW − IBW)/IBW; SGR (%) = 100 × (ln FBW − ln IBW)/days; FI (g) = total feed intake/fish; FE (%) = 100 × (FBW − IBW)/FI; FCR (%) = 100 × FI/(FBW − IBW); PER = (FBW − IBW)/protein intake (g); CF (%) = 100 × FBW/body length3(cm); VSI (%) = 100 × VW/FBW; and HSI (%) = 100 × LW/FBW.
Table 4. Whole body composition (%, dry-basis) of largemouth bass fed diets with different levels of lipids (%) for 11 weeks 1.
Table 4. Whole body composition (%, dry-basis) of largemouth bass fed diets with different levels of lipids (%) for 11 weeks 1.
ItemsDietary Lipid Levels
6812141618
Moisture70.76 ± 0.5270.61 ± 0.2470.69 ± 0.1970.26 ± 0.3770.92 ± 0.4670.93 ± 0.24
Protein17.28 ± 0.37 d18.41 ± 0.15 b19.42 ± 0.33 a18.93 ± 0.66 a18.00 ± 0.48 bc17.85 ± 0.13 c
Lipid6.88 ± 0.41 d7.56 ± 0.57 c8.17 ± 0.20 b8.65 ± 0.29 ab8.57 ± 0.48 ab8.94 ± 0.19 a
Ash4.19 ± 0.12 a4.00 ± 0.04 b3.67 ± 0.06 cd3.72 ± 0.10 c3.59 ± 0.11 d3.57 ± 0.05 d
1 The values are the means ± SD of three replicate groups, each containing six fish. Significant differences exist between values with different superscripts in the same rows (p < 0.05).
Table 5. Plasma AST and ALT activity, liver TG, and TC content of fish fed diets with graded levels of lipids (%) for 11 weeks 1.
Table 5. Plasma AST and ALT activity, liver TG, and TC content of fish fed diets with graded levels of lipids (%) for 11 weeks 1.
ItemsDietary Lipid Levels
6812141618
Plasma 2
ALT10.32 ±2.57 b12.14 ± 3.97 b14.19 ± 2.68 b14.20 ± 1.52 b20.11 ± 3.45 a21.34 ± 0.51 a
AST33.53 ± 1.88 c37.14 ± 2.26 bc37.58 ± 1.74 bc38.87 ± 1.10 b41.51 ± 3.44 ab43.97 ± 2.49 a
Liver
TG0.157 ± 0.012 b0.158 ± 0.008 b0.191 ± 0.005 b0.192 ± 0.032 b0.256 ± 0.030 a0.292 ± 0.013 a
TC0.020 ± 0.006 d0.028 ± 0.008 cd0.040 ± 0.014 bc0.054 ± 0.010 ab0.055 ± 0.008 ab0.070 ± 0.006 a
1 Values are means ± SD. Significant differences existed between values in the same row with various superscripts (p < 0.05; n = 3). 2 ALT (Alanine aminotransferase, U/L), AST (Aspartate transaminase, U/L), TG (triglyceride, mmol/g prot), and TC (total cholesterol, mmol/g prot).
Table 6. MDA and PC content, T-SOD, CAT, ASA, and AHR activities in the livers of fish fed diets with graded levels of lipid (%) for 11 weeks 1.
Table 6. MDA and PC content, T-SOD, CAT, ASA, and AHR activities in the livers of fish fed diets with graded levels of lipid (%) for 11 weeks 1.
ItemsDietary Lipid Levels
6812141618
MDA 20.95 ± 0.02 b0.75 ± 0.08 c0.76 ± 0.09 c0.86 ± 0.06 bc1.27 ± 0.09 a1.28 ± 0.14 a
PC7.50 ± 1.20 ab6.44 ± 0.70 b4.90 ± 0.86 c4.75 ± 0.51 c7.55 ± 0.47 ab8.23 ± 0.81 a
T-SOD160.99 ± 11.87 abc166.64 ± 5.93 ab165.96 ± 5.83 ab172.76 ± 6.26 a154.29 ± 11.03 bc147.04 ± 7.27 c
CAT9.85 ± 0.33 c11.33 ± 0.21 b12.35 ± 0.43 a12.07 ± 0.43 a11.25 ± 0.28 b10.86 ± 0.11 b
ASA433.08 ± 13.78 d441.95 ± 12.53 d728.31 ± 19.85 b824.39 ± 73.38 a730.97 ± 15.50 b627.67 ± 11.02 c
AHR122.04 ± 4.50 d130.49 ± 5.34 cd141.91 ± 2.52 b167.96 ± 6.45 a134.15 ± 4.82 bc93.58 ± 1.93 e
1 Values are means ± SD. Values within the same row bearing different superscripts indicate significant differences (p < 0.05; n = 3). 2 MDA (malondialdehyde, mmol/mg prot), PC (protein carbonyl, mmol/mg prot), T-SOD (total superoxide dismutase, U/mg prot), CAT (catalase, U/mg prot), ASA (anti-superoxide anion, ug/mg prot), and AHR (anti-hydroxyl radical, U/mg prot).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

He, L.; Zhang, Y.; Cao, Q.; Shan, H.; Zong, J.; Feng, L.; Jiang, W.; Wu, P.; Zhao, J.; Liu, H.; et al. Hepatic Oxidative Stress and Cell Death Influenced by Dietary Lipid Levels in a Fresh Teleost. Antioxidants 2024, 13, 808. https://doi.org/10.3390/antiox13070808

AMA Style

He L, Zhang Y, Cao Q, Shan H, Zong J, Feng L, Jiang W, Wu P, Zhao J, Liu H, et al. Hepatic Oxidative Stress and Cell Death Influenced by Dietary Lipid Levels in a Fresh Teleost. Antioxidants. 2024; 13(7):808. https://doi.org/10.3390/antiox13070808

Chicago/Turabian Style

He, Lingjie, Yupeng Zhang, Quanquan Cao, Hongying Shan, Jiali Zong, Lin Feng, Weidan Jiang, Pei Wu, Juan Zhao, Haifeng Liu, and et al. 2024. "Hepatic Oxidative Stress and Cell Death Influenced by Dietary Lipid Levels in a Fresh Teleost" Antioxidants 13, no. 7: 808. https://doi.org/10.3390/antiox13070808

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop