Lumpy Skin Disease—An Emerging Cattle Disease in Europe and Asia
Abstract
:1. Introduction
1.1. Background
1.2. Host-Range
1.3. Distribution of LSD
1.4. Transmission
1.5. Current LSDV Vaccines Used in the Field
1.6. Efficacy and Safety of Capripoxvirus Vaccines
1.7. Recombinant LSDV in the Field
1.8. Next Generation Vaccines Being Developed for LSD including Modified LSDV, Inactivated LSDV and Subunit LSD Vaccines as well as mRNA Based Vaccines
1.9. LSDV as a Vaccine Vector
Promoter | Origin | Type | Sequence (5′ to 3′) | References |
---|---|---|---|---|
mH5 | VACV, modified | Early-late | AAAAATTGAAAATAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAA | [109] |
pLEO | VACV, modified | Early-late | TTTTATTTTTTTTTTTTGGAATATAAATATCCGGTAAAATTGAAAAAATATACACTAATTAGCGTCTCGTTTCAGACGCTAG | [110] |
p7.5 | VACV, modified | Early-late | CCAAACCCACCCGCTTTTTATAGTAAGTTTTTCACCCATAAATAATAAATACAATAATTAATTTCTCGTAAAAGTAGAAAATATATTCTAATTTATTGCACGG | [111] |
p11 | VACV | Late | TTTCATTTTGTTTTTTTCTATGCTATAA | [112] |
pSS | Synthetic | Early-late | AAAATTGAAATTTTATTTTTTTTTTTTGGAATATAAATA | [113] |
mFP | Fowlpox, modified | Early-late | AGAAAAATATCCTAAAATTGAATTGTAATTATCGATAATAA | [20] |
Target Pathogen | Antigen Expressed | Capripoxvirus Backbone | Reference |
---|---|---|---|
Rindepest Virus | Rindepest Virus H and F gene | KS-1 * | [122] |
Peste-des-petits-ruminants virus (PPRV) | hemagglutinin (H) or the fusion (F) protein gene of PPRV | KS-1 * | [118] |
Blue Tongue Virus (BTV) | BTV VP7 | KS-1 * | [119] |
Rift Valley Fever Virus (RVFV) | RVFV Gn and Gc glycoproteins | KS-1 * | [117] |
HIV | Grttn polyprotein | nLSDV | [106,123] |
Env and Gag | nLSDV with SODis | [105] | |
Rabies virus (RABV) | RABV Glycoprotein | nLSDV | [6] |
Mokola virus (MOKV), West Caucasian bat virus (WCBV), Rabies Virus (RABV) | RABV, MOKV and WCBV glycoprotein genes | nLSDV | [121] |
Rift valley fever virus (RVFV) | RVFV Gn and Gc glycoproteins | nLSDV | [102,124,125] |
Bovine ephemeral fever virus (BEFV) | BEFV Glycoprotein | nLSDV | [102,124,125] |
Glycoprotein | nLSDV with either SODis or ΔSOD | [104] | |
Glycoprotein and Matrix |
2. Conclusions
3. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kitching, R.; Smale, C. Comparison of the external dimensions of capripoxvirus isolates. Res. Vet. Sci. 1986, 41, 425–427. [Google Scholar] [CrossRef] [PubMed]
- Tulman, E.R.; Afonso, C.L.; Lu, Z.; Zsak, L.; Sur, J.-H.; Sandybaev, N.T.; Kerembekova, U.Z.; Zaitsev, V.L.; Kutish, G.F.; Rock, D.L. The Genomes of Sheeppox and Goatpox Viruses. J. Virol. 2002, 76, 6054–6061. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tulman, E.R.; Afonso, C.L.; Lu, Z.; Zsak, L.; Kutish, G.F.; Rock, D.L. Genome of Lumpy Skin Disease Virus. J. Virol. 2001, 75, 7122–7130. [Google Scholar] [CrossRef] [Green Version]
- McFadden, G. Poxvirus tropism. Nat. Rev. Genet. 2005, 3, 201–213. [Google Scholar] [CrossRef]
- Prozesky, L.; Barnard, B.J. A study of the pathology of lumpy skin disease in cattle. Onderstepoort J. Veter.-Res. 1982, 49, 167–175. [Google Scholar]
- Aspden, K.; Passmore, J.-A.; Tiedt, F.; Williamson, A.-L. Evaluation of lumpy skin disease virus, a capripoxvirus, as a replication-deficient vaccine vector. J. Gen. Virol. 2003, 84, 1985–1996. [Google Scholar] [CrossRef]
- Abutarbush, S.M.; Ababneh, M.M.; Al Zoubi, I.G.; Al Sheyab, O.M.; Alekish, M.O.; Al Gharabat, R.J. Lumpy Skin Disease in Jordan: Disease Emergence, Clinical Signs, Complications and Preliminary-associated Economic Losses. Transbound. Emerg. Dis. 2013, 62, 549–554. [Google Scholar] [CrossRef]
- Tuppurainen, E.; Dietze, K.; Wolff, J.; Bergmann, H.; Beltran-Alcrudo, D.; Fahrion, A.; Lamien, C.E.; Busch, F.; Sauter-Louis, C.; Conraths, F.J.; et al. Review: Vaccines and Vaccination against Lumpy Skin Disease. Vaccines 2021, 9, 1136. [Google Scholar] [CrossRef]
- Aspden, K.A. Study of the Host Restricted Lumpy Skin Disease Virus as a Vaccine Vector Using Rabies Virus as a Model; University of Cape Town: Cape Town, South Africa, 2002. [Google Scholar]
- Coetzer, J.A.W.; Tuppurainen, E. Lumpy skin disease. Infect. Dis. Livest. 2004, 2, 1268–1276. [Google Scholar]
- Möller, J.; Moritz, T.; Schlottau, K.; Krstevski, K.; Hoffmann, D.; Beer, M.; Hoffmann, B. Experimental lumpy skin disease virus infection of cattle: Comparison of a field strain and a vaccine strain. Arch. Virol. 2019, 164, 2931–2941. [Google Scholar] [CrossRef]
- Ahmed, E.M.; Eltarabilli, M.M.; Shahein, M.A.; Fawzy, M. Lumpy skin disease outbreaks investigation in Egyptian cattle and buffaloes: Serological evidence and molecular characterization of genome termini. Comp. Immunol. Microbiol. Infect. Dis. 2021, 76, 101639. [Google Scholar] [CrossRef] [PubMed]
- Fagbo, S.; Coetzer, J.A.; Venter, E.H. Seroprevalence of Rift Valley fever and lumpy skin disease in African buffalo (Syncerus caffer) in the Kruger National Park and Hluhluwe-iMfolozi Park, South Africa. J. S. Afr. Veter-Assoc. 2014, 85, 1075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Kock, G. Lumpy skin disease (knopvelsiekte) of cattle in Southern Africa. J. Am. Vet. Med. Assoc. 1948, 112, 57. [Google Scholar]
- Hedger, R.; Hamblin, C. Neutralising antibodies to lumpy skin disease virus in African wildlife. Comp. Immunol. Microbiol. Infect. Dis. 1983, 6, 209–213. [Google Scholar] [CrossRef] [PubMed]
- Young, E.; Basson, P.A.; Weiss, K.E. Experimental infection of game animals with lumpy skin disease virus (prototype strain Neethling). Onderstepoort J. Vet.-Res. 1970, 37, 79–87. [Google Scholar]
- Dao, T.D.; Tran, L.H.; Nguyen, H.D.; Hoang, T.T.; Nguyen, G.H.; Tran, K.V.D.; Nguyen, H.X.; Van Dong, H.; Bui, A.N.; Bui, V.N. Characterization of Lumpy skin disease virus isolated from a giraffe in Vietnam. Transbound. Emerg. Dis. 2022, 69, e3268–e3272. [Google Scholar] [CrossRef]
- Rhazi, H.; Safini, N.; Mikou, K.; Alhyane, M.; Lenk, M.; Tadlaoui, K.O.; Elharrak, M. Comparative Sensitivity Study of Primary Cells, Vero, OA3.Tsand ESH-L cell lines to Lumpy Skin Disease, Sheeppox, and Goatpox viruses Detection and Growth. J. Virol. Methods 2021, 293, 114164. [Google Scholar] [CrossRef]
- Binepal, Y.S.; Ongadi, F.A.; Chepkwony, J.C. Alternative cell lines for the propagation of lumpy skin disease virus. Onderstepoort J. Veter.-Res. 2001, 68, 151–153. [Google Scholar]
- Omar, R. Comparison of the Two Lumpy Skin Disease Virus Vaccines, Neethling and Herbivac, and Construction of a Recombinant Herbivac-Rift Valley Fever Virus Vaccine; University of Cape Town: Sydney, Australia, 2015. [Google Scholar]
- Fay, P.; Cook, C.; Wijesiriwardana, N.; Tore, G.; Comtet, L.; Carpentier, A.; Shih, B.; Freimanis, G.; Haga, I.R.; Beard, P.M. Madin-Darby bovine kidney (MDBK) cells are a suitable cell line for the propagation and study of the bovine poxvirus lumpy skin disease virus. J. Virol. Methods 2020, 285, 113943. [Google Scholar] [CrossRef]
- Munyanduki, H.; Omar, R.; Douglass, N.; Williamson, A.-L. Removal of bovine viral diarrhea virus (BVDV) from lumpy skin disease virus (LSDV) vaccine stocks by passage on chorioallantoic membranes of fertilized hens’ eggs. J. Virol. Methods 2019, 275, 113752. [Google Scholar] [CrossRef]
- Weiss, K.E. Lumpy Skin Disease Virus. In Cytomegaloviruses. Rinderpest Virus. Lumpy Skin Disease Virus; Springer: Berlin/Heidelberg, Germany, 1968; pp. 111–131. [Google Scholar]
- van Diepen, M.; Chapman, R.; Douglass, N.; Whittle, L.; Chineka, N.; Galant, S.; Cotchobos, C.; Suzuki, A.; Williamson, A.-L. Advancements in the Growth and Construction of Recombinant Lumpy Skin Disease Virus (LSDV) for Use as a Vaccine Vector. Vaccines 2021, 9, 1131. [Google Scholar] [CrossRef] [PubMed]
- Babiuk, S.; Parkyn, G.; Copps, J.; Larence, J.E.; Sabara, M.I.; Bowden, T.R.; Boyle, D.B.; Kitching, R.P. Evaluation of an Ovine Testis Cell Line (OA3.Ts) for Propagation of Capripoxvirus Isolates and Development of an Immunostaining Technique for Viral Plaque Visualization. J. Vet. Diagn. Investig. 2007, 19, 486–491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yeruham, I.; Nir, O.; Braverman, Y.; Davidson, M.; Grinstein, H.; Haymovitch, M.; Zamir, O. Spread of lumpy skin disease in Israeli dairy herds. Vet. Rec. 1995, 137, 91–93. [Google Scholar] [CrossRef] [PubMed]
- Vandenbussche, F.; Mathijs, E.; Philips, W.; Saduakassova, M.; De Leeuw, I.; Sultanov, A.; Haegeman, A.; De Clercq, K. Recombinant LSDV Strains in Asia: Vaccine Spillover or Natural Emergence? Viruses 2022, 14, 1429. [Google Scholar] [CrossRef]
- Manić, M.; Stojiljković, M.; Petrović, M.; Nišavić, J.; Bacić, D.; Petrović, T.; Vidanović, D.; Obrenović, S. Epizootic features and control measures for lumpy skin disease in south-east Serbia in 2016. Transbound. Emerg. Dis. 2019, 66, 2087–2099. [Google Scholar] [CrossRef] [PubMed]
- Lu, G.; Xie, J.; Luo, J.; Shao, R.; Jia, K.; Li, S. Lumpy skin disease outbreaks in China, since 3 August 2019. Transbound. Emerg. Dis. 2020, 68, 216–219. [Google Scholar] [CrossRef]
- Gupta, T.; Patial, V.; Bali, D.; Angaria, S.; Sharma, M.; Chahota, R. A review: Lumpy skin disease and its emergence in India. Vet. Res. Commun. 2020, 44, 111–118. [Google Scholar] [CrossRef]
- Kayesh, M.E.H.; Hussan, M.T.; Hashem, A.; Eliyas, M.; Anower, A.M. Lumpy Skin Disease Virus Infection: An Emerging Threat to Cattle Health in Bangladesh. Hosts Viruses 2020, 7, 97–108. [Google Scholar] [CrossRef]
- Sprygin, A.; Artyuchova, E.; Babin, Y.; Prutnikov, P.; Kostrova, E.; Byadovskaya, O.; Kononov, A. Epidemiological characterization of lumpy skin disease outbreaks in Russia in 2016. Transbound. Emerg. Dis. 2018, 65, 1514–1521. [Google Scholar] [CrossRef]
- Agianniotaki, E.I.; Mathijs, E.; Vandenbussche, F.; Tasioudi, K.E.; Haegeman, A.; Iliadou, P.; Chaintoutis, S.C.; Dovas, C.I.; Van Borm, S.; Chondrokouki, E.D.; et al. Complete Genome Sequence of the Lumpy Skin Disease Virus Isolated from the First Reported Case in Greece in 2015. Genome Announc. 2017, 5, e00550-17. [Google Scholar] [CrossRef] [Green Version]
- OIE-WAHIS. Events Management. Available online: https://wahis.woah.org/#/event-management (accessed on 1 December 2022).
- Klement, E.; Broglia, A.; Antoniou, S.E.; Tsiamadis, V.; Plevraki, E.; Petrovic, T.; Polacek, V.; Debeljak, Z.; Miteva, A.; Alexandrov, T.; et al. Neethling vaccine proved highly effective in controlling lumpy skin disease epidemics in the Balkans. Prev. Vet. Med. 2020, 181, 104595. [Google Scholar] [CrossRef] [PubMed]
- Kononov, A.; Prutnikov, P.; Shumilova, I.; Kononova, S.; Nesterov, A.; Byadovskaya, O.; Pestova, Y.; Diev, V.; Sprygin, A. Determination of lumpy skin disease virus in bovine meat and offal products following experimental infection. Transbound. Emerg. Dis. 2019, 66, 1332–1340. [Google Scholar] [CrossRef] [PubMed]
- Khalafalla, A. Lumpy Skin Disease: An Economically Significant Emerging Disease. Available online: https://www.intechopen.com/online-first/85014 (accessed on 10 January 2023).
- Tuppurainen, E.S.M.; Stoltsz, W.H.; Troskie, M.; Wallace, D.B.; Oura, C.A.L.; Mellor, P.S.; Coetzer, J.A.W.; Venter, E. A Potential Role for Ixodid (Hard) Tick Vectors in the Transmission of Lumpy Skin Disease Virus in Cattle. Transbound. Emerg. Dis. 2011, 58, 93–104. [Google Scholar] [CrossRef] [Green Version]
- Sohier, C.; Haegeman, A.; Mostin, L.; De Leeuw, I.; Van Campe, W.; De Vleeschauwer, A.; Tuppurainen, E.S.M.; van den Berg, T.; De Regge, N.; De Clercq, K. Experimental evidence of mechanical Lumpy Skin Disease virus transmission by Stomoxys calcitrans biting flies and Haematopota spp. horseflies. Sci. Rep. 2019, 9, 20076. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paslaru, A.I.; Maurer, L.M.; Vögtlin, A.; Hoffmann, B.; Torgerson, P.R.; Mathis, A.; Veronesi, E. Putative roles of mosquitoes (Culicidae) and biting midges (Culicoides spp.) as mechanical or biological vectors of lumpy skin disease virus. Med. Vet. Entomol. 2022, 36, 381–389. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhao, L.; Yang, J.; Shi, M.; Nie, F.; Liu, S.; Wang, Z.; Huang, D.; Wu, H.; Li, D.; et al. Analysis of vaccine-like lumpy skin disease virus from flies near the western border of China. Transbound. Emerg. Dis. 2021, 69, 1813–1823. [Google Scholar] [CrossRef]
- Paslaru, A.I.; Verhulst, N.O.; Maurer, L.M.; Brendle, A.; Pauli, N.; Vögtlin, A.; Renzullo, S.; Ruedin, Y.; Hoffmann, B.; Torgerson, P.R.; et al. Potential mechanical transmission of Lumpy skin disease virus (LSDV) by the stable fly (Stomoxys calcitrans) through regurgitation and defecation. Curr. Res. Insect Sci. 2020, 1, 100007. [Google Scholar] [CrossRef]
- Lubinga, J.C.; Tuppurainen, E.S.M.; Mahlare, R.; Coetzer, J.A.W.; Stoltsz, W.H.; Venter, E.H. Evidence of Transstadial and Mechanical Transmission of Lumpy Skin Disease Virus by Amblyomma hebraeum Ticks. Transbound. Emerg. Dis. 2013, 62, 174–182. [Google Scholar] [CrossRef]
- Kitching, R.P.; Hammond, J.M.; Black, D.N. Studies on the Major Common Precipitating Antigen of Capripoxvirus. J. Gen. Virol. 1986, 67, 139–148. [Google Scholar] [CrossRef]
- Saegerman, C.; Bertagnoli, S.; Meyer, G.; Ganière, J.-P.; Caufour, P.; De Clercq, K.; Jacquiet, P.; Fournié, G.; Hautefeuille, C.; Etore, F.; et al. Risk of introduction of lumpy skin disease in France by the import of vectors in animal trucks. PLoS ONE 2018, 13, e0198506. [Google Scholar] [CrossRef] [Green Version]
- Namazi, F.; Tafti, A.K. Lumpy skin disease, an emerging transboundary viral disease: A review. Vet. Med. Sci. 2021, 7, 888–896. [Google Scholar] [CrossRef] [PubMed]
- Carn, V.M.; Kitching, R.P. An investigation of possible routes of transmission of lumpy skin disease virus (Neethling). Epidemiology Infect. 1995, 114, 219–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aleksandr, K.; Olga, B.; David, W.B.; Pavel, P.; Yana, P.; Svetlana, K.; Alexander, N.; Vladimir, R.; Dmitriy, L.; Alexander, S. Non-vector-borne transmission of lumpy skin disease virus. Sci. Rep. 2020, 10, 7436. [Google Scholar] [CrossRef]
- Shumilova, I.; Krotova, A.; Nesterov, A.; Byadovskaya, O.; van Schalkwyk, A.; Sprygin, A. Overwintering of recombinant lumpy skin disease virus in northern latitudes, Russia. Transbound. Emerg. Dis. 2022, 69, e3239–e3243. [Google Scholar] [CrossRef] [PubMed]
- Osuagwuh, U.I.; Bagla, V.H.; Venter, E.H.; Annandale, C.H.; Irons, P. Absence of lumpy skin disease virus in semen of vaccinated bulls following vaccination and subsequent experimental infection. Vaccine 2007, 25, 2238–2243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Annandale, C.H.; Holm, D.E.; Ebersohn, K.; Venter, E.H. Seminal Transmission of Lumpy Skin Disease Virus in Heifers. Transbound. Emerg. Dis. 2014, 61, 443–448. [Google Scholar] [CrossRef] [Green Version]
- Şevik, M.; Doğan, M. Epidemiological and Molecular Studies on Lumpy Skin Disease Outbreaks in Turkey during 2014-2015. Transbound. Emerg. Dis. 2017, 64, 1268–1279. [Google Scholar] [CrossRef]
- Haegeman, A.; De Leeuw, I.; Mostin, L.; Van Campe, W.; Aerts, L.; Venter, E.; Tuppurainen, E.; Saegerman, C.; De Clercq, K. Comparative Evaluation of Lumpy Skin Disease Virus-Based Live Attenuated Vaccines. Vaccines 2021, 9, 473. [Google Scholar] [CrossRef]
- Van Rooyen, P.J.; Munz, E.K.; Weiss, K.E. The optimal conditions for the multiplication of Neethling-type lumpy skin disease virus in embryonated eggs. Onderstepoort J. Vet. Res. 1969, 36, 165–174. [Google Scholar]
- Mathijs, E.; Vandenbussche, F.; Haegeman, A.; King, A.; Nthangeni, B.; Potgieter, C.; Maartens, L.; Van Borm, S.; De Clercq, K. Complete Genome Sequences of the Neethling-Like Lumpy Skin Disease Virus Strains Obtained Directly from Three Commercial Live Attenuated Vaccines. Genome Announc. 2016, 4, e01255-16. [Google Scholar] [CrossRef] [Green Version]
- Calistri, P.; De Clercq, K.; Gubbins, S.; Klement, E.; Stegeman, A.; Abrahantes, J.C.; Marojevic, D.; Antoniou, S.; Broglia, A. Lumpy skin disease epidemiological report IV: Data collection and analysis. EFSA J. 2020, 18, e06010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norian, R.; Ahangran, N.A.; Varshovi, H.R.; Azadmehr, A. Comparative efficacy of two heterologous capripox vaccines to control lumpy skin disease in cattle. Bulg. J. Vet. Med. 2019, 22, 171–179. [Google Scholar] [CrossRef]
- Gari, G.; Abie, G.; Gizaw, D.; Wubete, A.; Kidane, M.; Asgedom, H.; Bayissa, B.; Ayelet, G.; Oura, C.A.; Roger, F.; et al. Evaluation of the safety, immunogenicity and efficacy of three capripoxvirus vaccine strains against lumpy skin disease virus. Vaccine 2015, 33, 3256–3261. [Google Scholar] [CrossRef] [PubMed]
- Zhugunissov, K.; Bulatov, Y.; Orynbayev, M.; Kutumbetov, L.; Abduraimov, Y.; Shayakhmetov, Y.; Taranov, D.; Amanova, Z.; Mambetaliyev, M.; Absatova, Z.; et al. Goatpox virus (G20-LKV) vaccine strain elicits a protective response in cattle against lumpy skin disease at challenge with lumpy skin disease virulent field strain in a comparative study. Vet Microbiol. 2020, 245, 108695. [Google Scholar] [CrossRef] [PubMed]
- Hamdi, J.; Bamouh, Z.; Jazouli, M.; Boumart, Z.; Tadlaoui, K.O.; Fihri, O.F.; EL Harrak, M. Experimental evaluation of the cross-protection between Sheeppox and bovine Lumpy skin vaccines. Sci. Rep. 2020, 10, 8888. [Google Scholar] [CrossRef]
- Manual, O. Chapter 3.4.12 Lumpy Skin Disease. Available online: https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.04.12_LSD.pdf (accessed on 10 January 2023).
- Morgenstern, M.; Klement, E. The Effect of Vaccination with Live Attenuated Neethling Lumpy Skin Disease Vaccine on Milk Production and Mortality—An Analysis of 77 Dairy Farms in Israel. Vaccines 2020, 8, 324. [Google Scholar] [CrossRef]
- Abutarbush, S.; Hananeh, W.M.; Ramadan, W.; Al Sheyab, O.M.; Alnajjar, A.R.; Al Zoubi, I.G.; Knowles, N.J.; Tuppurainen, E.S.M.; Bachanek-Bankowska, K. Adverse Reactions to Field Vaccination Against Lumpy Skin Disease in Jordan. Transbound. Emerg. Dis. 2014, 63, e213–e219. [Google Scholar] [CrossRef]
- Ben-Gera, J.; Klement, E.; Khinich, E.; Stram, Y.; Shpigel, N.Y. Comparison of the efficacy of Neethling lumpy skin disease virus and x10RM65 sheep-pox live attenuated vaccines for the prevention of lumpy skin disease—The results of a randomized controlled field study. Vaccine 2015, 33, 4837–4842. [Google Scholar] [CrossRef]
- Tuppurainen, E.; Babiuk, S.; Klement, E. Lumpy Skin Disease; Springer: Berlin/Heidelberg, Germany, 2018. [Google Scholar]
- Kara, P.D.; Afonso, C.L.; Wallace, D.B.; Kutish, G.F.; Abolnik, C.; Lu, Z.; Vreede, F.T.; Taljaard, L.C.F.; Zsak, A.; Viljoen, G.J.; et al. Comparative sequence analysis of the South African vaccine strain and two virulent field isolates of Lumpy skin disease virus. Arch. Virol. 2003, 148, 1335–1356. [Google Scholar] [CrossRef]
- van Schalkwyk, A.; Kara, P.; Heath, L. Phylogenomic characterization of historic lumpy skin disease virus isolates from South Africa. Arch. Virol. 2022, 167, 2063–2070. [Google Scholar] [CrossRef]
- Desingu, P.A.; Rubeni, T.P.; Sundaresan, N.R. Evolution of monkeypox virus from 2017 to 2022: In the light of point mutations. Front. Microbiol. 2022, 13, 1037598. [Google Scholar] [CrossRef] [PubMed]
- Brennan, G.; Stoian, A.M.M.; Yu, H.; Rahman, M.J.; Banerjee, S.; Stroup, J.N.; Park, C.; Tazi, L.; Rothenburg, S. Molecular Mechanisms of Poxvirus Evolution. mBio 2022, e01526-22. [Google Scholar] [CrossRef] [PubMed]
- Bedson, H.S.; Dumbell, K.R. Hybrids derived from the viruses of alastrim and rabbit pox. Epidemiology Infect. 1964, 62, 141–146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dumbell, K.R.; Bedson, H.S. The use of ceiling temperature and reactivation in the isolation of pox virus hybrids. Epidemiology Infect. 1964, 62, 133–140. [Google Scholar] [CrossRef] [Green Version]
- Bedson, H.S.; Dumbell, K.R. Hybrids derived from the viruses of variola major and cowpox. Epidemiology Infect. 1964, 62, 147–158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakano, E.; Panicali, D.; Paoletti, E. Molecular genetics of vaccinia virus: Demonstration of marker rescue. Proc. Natl. Acad. Sci. USA 1982, 79, 1593–1596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paoletti, E.; Weinberg, R.L.; Davis, S.W.; Davis, M. Genetically engineered poxviruses: A novel approach to the construction of live vaccines. Vaccine 1984, 2, 204–208. [Google Scholar] [CrossRef]
- Herbert, M.H.; Squire, C.J.; Mercer, A.A. Poxviral Ankyrin Proteins. Viruses 2015, 7, 709–738. [Google Scholar] [CrossRef]
- Erlandson, K.J.; Cotter, C.A.; Charity, J.C.; Martens, C.; Fischer, E.R.; Ricklefs, S.M.; Porcella, S.F.; Moss, B. Duplication of the A17L Locus of Vaccinia Virus Provides an Alternate Route to Rifampin Resistance. J. Virol. 2014, 88, 11576–11585. [Google Scholar] [CrossRef] [Green Version]
- Sprygin, A.; Mazloum, A.; van Schalkwyk, A.; Babiuk, S. Capripoxviruses, leporipoxviruses, and orthopoxviruses: Occurrences of recombination. Front. Microbiol. 2022, 13, 978829. [Google Scholar] [CrossRef]
- Krotova, A.; Byadovskaya, O.; Shumilova, I.; van Schalkwyk, A.; Sprygin, A. An in-depth bioinformatic analysis of the novel recombinant lumpy skin disease virus strains: From unique patterns to established lineage. BMC Genom. 2022, 23, 396. [Google Scholar] [CrossRef] [PubMed]
- Sprygin, A.; Babin, Y.; Pestova, Y.; Kononova, S.; Wallace, D.B.; Van Schalkwyk, A.; Byadovskaya, O.; Diev, V.; Lozovoy, D.; Kononov, A. Analysis and insights into recombination signals in lumpy skin disease virus recovered in the field. PLoS ONE 2018, 13, e0207480. [Google Scholar] [CrossRef]
- Kononov, A.; Byadovskaya, O.; Kononova, S.; Yashin, R.; Zinyakov, N.; Mischenko, V.; Perevozchikova, N.; Sprygin, A. Detection of vaccine-like strains of lumpy skin disease virus in outbreaks in Russia in 2017. Arch. Virol. 2019, 164, 1575–1585. [Google Scholar] [CrossRef] [PubMed]
- Kumar, N.; Tripathi, B.N. A serious skin virus epidemic sweeping through the Indian subcontinent is a threat to the livelihood of farmers. Virulence 2022, 13, 1943–1944. [Google Scholar] [CrossRef] [PubMed]
- Kara, P.D.; Mather, A.S.; Pretorius, A.; Chetty, T.; Babiuk, S.; Wallace, D.B. Characterisation of putative immunomodulatory gene knockouts of lumpy skin disease virus in cattle towards an improved vaccine. Vaccine 2018, 36, 4708–4715. [Google Scholar] [CrossRef] [PubMed]
- Chervyakova, O.; Issabek, A.; Sultankulova, K.; Bopi, A.; Kozhabergenov, N.; Omarova, Z.; Tulendibayev, A.; Aubakir, N.; Orynbayev, M. Lumpy Skin Disease Virus with Four Knocked Out Genes Was Attenuated In Vivo and Protects Cattle from Infection. Vaccines 2022, 10, 1705. [Google Scholar] [CrossRef] [PubMed]
- Douglass, N.; Munyanduki, H.; Omar, R.; Gers, S.; Mutowembwa, P.; Heath, L.; Williamson, A.-L. Influence of the Viral Superoxide Dismutase (SOD) Homologue on Lumpy Skin Disease Virus (LSDV) Growth, Histopathology and Pathogenicity. Vaccines 2020, 8, 664. [Google Scholar] [CrossRef]
- Wolff, J.; Beer, M.; Hoffmann, B. High Efficiency of Low Dose Preparations of an Inactivated Lumpy Skin Disease Virus Vaccine Candidate. Vaccines 2022, 10, 1029. [Google Scholar] [CrossRef]
- Wolff, J.; Moritz, T.; Schlottau, K.; Hoffmann, D.; Beer, M.; Hoffmann, B. Development of a Safe and Highly Efficient Inactivated Vaccine Candidate against Lumpy Skin Disease Virus. Vaccines 2020, 9, 4. [Google Scholar] [CrossRef]
- Kar, P.P.; Araveti, P.B.; Kuriakose, A.; Srivastava, A. Design of a multi-epitope protein as a subunit vaccine against lumpy skin disease using an immunoinformatics approach. Sci. Rep. 2022, 12, 19411. [Google Scholar] [CrossRef]
- Es-Sadeqy, Y.; Bamouh, Z.; Ennahli, A.; Safini, N.; El Mejdoub, S.; Tadlaoui, K.O.; Gavrilov, B.; El Harrak, M. Development of an inactivated combined vaccine for protection of cattle against lumpy skin disease and bluetongue viruses. Vet. Microbiol. 2021, 256, 109046. [Google Scholar] [CrossRef] [PubMed]
- Matsiela, M.S.; Naicker, L.; Dibakwane, V.S.; Ntombela, N.; Khoza, T.; Mokoena, N. Improved safety profile of inactivated Neethling strain of the Lumpy Skin Disease Vaccine. Vaccine X 2022, 12, 100209. [Google Scholar] [CrossRef]
- Malone, R.W. mRNA Vaccines in Livestock and Companion Animals Are Here Now. Available online: https://rwmalonemd.substack.com/p/mrna-vaccines-in-livestock-and-companion (accessed on 10 January 2023).
- Alcock, R.; Cottingham, M.G.; Rollier, C.S.; Furze, J.; De Costa, S.D.; Hanlon, M.; Spencer, A.J.; Honeycutt, J.D.; Wyllie, D.H.; Gilbert, S.C.; et al. Long-Term Thermostabilization of Live Poxviral and Adenoviral Vaccine Vectors at Supraphysiological Temperatures in Carbohydrate Glass. Sci. Transl. Med. 2010, 2, 19ra12. [Google Scholar] [CrossRef] [PubMed]
- Suschak, J.; Williams, J.A.; Schmaljohn, C.S. Advancements in DNA vaccine vectors, non-mechanical delivery methods, and molecular adjuvants to increase immunogenicity. Hum. Vaccines Immunother. 2017, 13, 2837–2848. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rollier, C.S.; Reyes-Sandoval, A.; Cottingham, M.G.; Ewer, K.; Hill, A.V. Viral vectors as vaccine platforms: Deployment in sight. Curr. Opin. Immunol. 2011, 23, 377–382. [Google Scholar] [CrossRef]
- Thiel, V.; Herold, J.; Schelle, B.; Siddell, S.G. Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus. J. Gen. Virol. 2001, 82, 1273–1281. [Google Scholar] [CrossRef]
- Chiuppesi, F.; Salazar, M.D.; Contreras, H.; Nguyen, V.H.; Martinez, J.; Park, Y.; Nguyen, J.; Kha, M.; Iniguez, A.; Zhou, Q.; et al. Development of a multi-antigenic SARS-CoV-2 vaccine candidate using a synthetic poxvirus platform. Nat. Commun. 2020, 11, 6121. [Google Scholar] [CrossRef]
- Laudermilch, E.; Chandran, K. MAVERICC: Marker-free Vaccinia Virus Engineering of Recombinants through in vitro CRISPR/Cas9 Cleavage. J. Mol. Biol. 2021, 433, 166896. [Google Scholar] [CrossRef]
- Gowripalan, A.; Smith, S.; Tscharke, D. Selection of Vaccinia Virus Recombinants Using CRISPR/Cas9. Bio-Protocol 2021, 11, e4270. [Google Scholar] [CrossRef]
- Wyatt, L.S.; Earl, P.L.; Moss, B. Generation of Recombinant Vaccinia Viruses. Curr. Protoc. Microbiol. 2015, 39, 14A.4.1–14A.4.18. [Google Scholar] [CrossRef]
- Suzuki, A. Development and Characterisation of Recombinant LSDV-Vectored Dual Vaccines Against Bovine Leukaemia Virus and Lumpy Skin Disease Virus; University of Cape Town: Cape Town, South Africa, 2019. [Google Scholar]
- Wallace, D.B.; Mather, A.; Kara, P.D.; Naicker, L.; Mokoena, N.; Pretorius, A.; Nefefe, T.; Thema, N.; Babiuk, S. Protection of Cattle Elicited Using a Bivalent Lumpy Skin Disease Virus-Vectored Recombinant Rift Valley Fever Vaccine. Front. Vet. Sci. 2020, 7, 256. [Google Scholar] [CrossRef] [PubMed]
- Aspden, K.; A van Dijk, A.; Bingham, J.; Cox, D.; Passmore, J.-A.; Williamson, A.-L. Immunogenicity of a recombinant lumpy skin disease virus (neethling vaccine strain) expressing the rabies virus glycoprotein in cattle. Vaccine 2002, 20, 2693–2701. [Google Scholar] [CrossRef] [PubMed]
- Wallace, D.B.; Viljoen, G.J. Immune responses to recombinants of the South African vaccine strain of lumpy skin disease virus generated by using thymidine kinase gene insertion. Vaccine 2005, 23, 3061–3067. [Google Scholar] [CrossRef] [PubMed]
- Cêtre-Sossah, C.; Dickmu, S.; Kwiatek, O.; Albina, E. A G-protein-coupled chemokine receptor: A putative insertion site for a multi-pathogen recombinant capripoxvirus vaccine strategy. J. Immunol. Methods 2017, 448, 112–115. [Google Scholar] [CrossRef] [Green Version]
- Douglass, N.; Omar, R.; Munyanduki, H.; Suzuki, A.; Mutowembwa, P.; Kara, P.; Heath, L.; Williamson, A.-L. The Development of Dual Vaccines against Lumpy Skin Disease (LSD) and Bovine Ephemeral Fever (BEF). Vaccines 2021, 9, 1512. [Google Scholar] [CrossRef]
- Chapman, R.; van Diepen, M.; Douglass, N.; Galant, S.; Jaffer, M.; Margolin, E.; Ximba, P.; Hermanus, T.; Moore, P.L.; Williamson, A.-L. Assessment of an LSDV-Vectored Vaccine for Heterologous Prime-Boost Immunizations against HIV. Vaccines 2021, 9, 1281. [Google Scholar] [CrossRef]
- Shen, Y. An Investigation into the Use of Lumpy Skin Disease Virus as a Vaccine Vector for a Potential HIV-1 Vaccine; University of Cape Town: Cape Town, South Africa, 2010. [Google Scholar]
- Alharbi, N.K. Poxviral promoters for improving the immunogenicity of MVA delivered vaccines. Hum. Vaccines Immunother. 2018, 15, 203–209. [Google Scholar] [CrossRef] [Green Version]
- Ink, B.S.; Pickup, D.J. Transcription of a poxvirus early gene is regulated both by a short promoter element and by a transcriptional termination signal controlling transcriptional interference. J. Virol. 1989, 63, 4632–4644. [Google Scholar] [CrossRef] [Green Version]
- Wyatt, L.S.; Shors, S.T.; Murphy, B.R.; Moss, B. Development of a replication-deficient recombinant vaccinia virus vaccine effective against parainfluenza virus 3 infection in an animal model. Vaccine 1996, 14, 1451–1458. [Google Scholar] [CrossRef]
- Di Pilato, M.; Mejías-Pérez, E.; Gomez, C.E.; Perdiguero, B.; Sorzano, C.O.S.; Esteban, M. New vaccinia virus promoter as a potential candidate for future vaccines. J. Gen. Virol. 2013, 94, 2771–2776. [Google Scholar] [CrossRef] [Green Version]
- Cochran, M.A.; Puckett, C.; Moss, B. In vitro mutagenesis of the promoter region for a vaccinia virus gene: Evidence for tandem early and late regulatory signals. J. Virol. 1985, 54, 30–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bertholet, C.; Drillien, R.; Wittek, R. One hundred base pairs of 5’ flanking sequence of a vaccinia virus late gene are sufficient to temporally regulate late transcription. Proc. Natl. Acad. Sci. USA 1985, 82, 2096–2100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chakrabarti, S.; Sisler, J.R.; Moss, B. Compact, Synthetic, Vaccinia Virus Early/Late Promoter for Protein Expression. Biotechniques 1997, 23, 1094–1097. [Google Scholar] [CrossRef]
- Antoshkina, I.V.; Glazkova, D.V.; Urusov, F.A.; Bogoslovskaya, E.V.; Shipulin, G.A. Comparison of Recombinant MVA Selection Methods Based on F13L, D4R and K1L Genes. Viruses 2022, 14, 528. [Google Scholar] [CrossRef]
- Boshra, H.; Truong, T.; Nfon, C.; Gerdts, V.; Tikoo, S.; Babiuk, L.A.; Kara, P.; Mather, A.; Wallace, D.; Babiuk, S. Capripoxvirus-vectored vaccines against livestock diseases in Africa. Antivir. Res. 2013, 98, 217–227. [Google Scholar] [CrossRef] [PubMed]
- Romero, C.H.; Barrett, T.; Chamberlain, R.W.; Kitching, R.P.; Fleming, M.; Black, D.N. Recombinant Capripoxvirus Expressing the Hemagglutinin Protein Gene of Rinderpest Virus: Protection of Cattle against Rinderpest and Lumpy Skin Disease Viruses. Virology 1994, 204, 425–429. [Google Scholar] [CrossRef]
- Soi, R.K.; Rurangirwa, F.R.; McGuire, T.C.; Rwambo, P.M.; DeMartini, J.C.; Crawford, T.B. Protection of Sheep against Rift Valley Fever Virus and Sheep Poxvirus with a Recombinant Capripoxvirus Vaccine. Clin. Vaccine Immunol. 2010, 17, 1842–1849. [Google Scholar] [CrossRef] [Green Version]
- Caufour, P.; Rufael, T.; Lamien, C.E.; Lancelot, R.; Kidane, M.; Awel, D.; Sertse, T.; Kwiatek, O.; Libeau, G.; Sahle, M.; et al. Protective efficacy of a single immunization with capripoxvirus-vectored recombinant peste des petits ruminants vaccines in presence of pre-existing immunity. Vaccine 2014, 32, 3772–3779. [Google Scholar] [CrossRef]
- Wade-Evans, A.M.; Romero, C.H.; Mellor, P.; Takamatsu, H.; Anderson, J.; Thevasagayam, J.; Fleming, M.J.; Mertens, P.P.; Black, D.N. Expression of the major core structural protein (VP7) of bluetongue virus, by a recombinant capripox virus, provides partial protection of sheep against a virulent heterotypic bluetongue virus challenge. Virology 1996, 220, 227–231. [Google Scholar] [CrossRef] [Green Version]
- Boshra, H.; Truong, T.; Nfon, C.; Bowden, T.R.; Gerdts, V.; Tikoo, S.; Babiuk, L.A.; Kara, P.; Mather, A.; Wallace, D.B.; et al. A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats. Antiviral Res. 2015, 123, 39–49. [Google Scholar] [CrossRef]
- Weyer, J.; Kuzmin, I.V.; Rupprecht, C.E.; Nel, L.H. Cross-protective and cross-reactive immune responses to recombinant vaccinia viruses expressing full-length lyssavirus glycoprotein genes. Epidemiol. Infect. 2007, 136, 670–678. [Google Scholar] [CrossRef] [PubMed]
- Ngichabe, C.K.; Wamwayi, H.M.; Ndungu, E.K.; Mirangi, P.K.; Bostock, C.J.; Black, D.N.; Barrett, T. Long term immunity in African cattle vaccinated with a recombinant capripox-rinderpest virus vaccine. Epidemiol. Infect. 2002, 128, 343–349. [Google Scholar] [CrossRef] [Green Version]
- Burgers, W.A.; Ginbot, Z.; Shen, Y.-J.; Chege, G.K.; Soares, A.P.; Müller, T.L.; Bunjun, R.; Kiravu, A.; Munyanduki, H.; Douglass, N.; et al. The novel capripoxvirus vector lumpy skin disease virus efficiently boosts modified vaccinia Ankara human immunodeficiency virus responses in rhesus macaques. J. Gen. Virol. 2014, 95, 2267–2272. [Google Scholar] [CrossRef] [PubMed]
- Cohen, A.D.C.; Van Dijk, A.A.; Korber, A.K.R.; Dumbell; Williamson, A.-L. Lumpy Skin Disease Virus as a Recombinant Vaccine Vector for Rift Valley Fever Virus and Bovine Ephemeral Fever Virus. In Proceedings of the European Society for Veterinary Virology. 4th International Congress on Veterinary Virology. "Virus survival and Vaccination", Moredun Research Institute, Edinburgh, Scotland, 24–27 August 1997; pp. 230–231. [Google Scholar]
- Wallace, D.B.; Ellis, C.E.; Espach, A.; Smith, S.J.; Greyling, R.R.; Viljoen, G.J. Protective immune responses induced by different recombinant vaccine regimes to Rift Valley fever. Vaccine 2006, 24, 7181–7189. [Google Scholar] [CrossRef] [PubMed]
- Offerman, K.; Deffur, A.; Carulei, O.; Wilkinson, R.; Douglass, N.; Williamson, A.-L. Six host-range restricted poxviruses from three genera induce distinct gene expression profiles in an in vivo mouse model. BMC Genom. 2015, 16, 510. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Whittle, L.; Chapman, R.; Williamson, A.-L. Lumpy Skin Disease—An Emerging Cattle Disease in Europe and Asia. Vaccines 2023, 11, 578. https://doi.org/10.3390/vaccines11030578
Whittle L, Chapman R, Williamson A-L. Lumpy Skin Disease—An Emerging Cattle Disease in Europe and Asia. Vaccines. 2023; 11(3):578. https://doi.org/10.3390/vaccines11030578
Chicago/Turabian StyleWhittle, Leah, Rosamund Chapman, and Anna-Lise Williamson. 2023. "Lumpy Skin Disease—An Emerging Cattle Disease in Europe and Asia" Vaccines 11, no. 3: 578. https://doi.org/10.3390/vaccines11030578