Dietary Resistant Starch Regulates Bile Acid Metabolism by Modulating the FXR/LRH-1 Signaling Pathway in Broilers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Growth Performance and Sample Collection
2.3. Plasma and Liver Lipid Metabolism
2.4. Contents of Bile Acid Synthase in Liver
2.5. Targeted Metabolomic Analysis of Ileum Bile Acid
2.6. RT-PCR Analysis
2.7. Extraction of Bacterial DNA
2.8. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Plasma and Liver Lipid Levels
3.3. Contents of Total Bile Acids
3.4. Ileum Bile Acid Metabolism
3.5. Contents of Liver Bile Acid Synthase
3.6. Gene Expression of Bile Acid Transporter
3.7. FXR/LRH-1 and FXR-FGFR4 Signaling Pathway
3.8. Number of Specific Active Bacteria in Ileum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Fasuan, T.O.; Asadu, K.C.; Anyiam, C.C.; Ojokoh, L.O.; Olagunju, T.M.; Chima, J.U.; Okpara, K.O. Bioactive and nutritional characterization of modeled and optimized consumer-ready flakes from pseudocereal (Amaranthus viridis), high-protein soymeal and modified corn starch. Food Prod. Process. Nutr. 2021, 3, 12. [Google Scholar] [CrossRef]
- Svihus, B. Limitations to wheat starch digestion in growing broiler chickens: A brief review. Anim. Prod. Sci. 2011, 51, 583–589. [Google Scholar] [CrossRef]
- Obadi, M.; Qi, Y.; Xu, B. High-amylose maize starch: Structure, properties, modifications and industrial applications. Carbohydr. Polym. 2023, 299, 120185. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Tan, L.; Kong, L. Impact of dietary intake of resistant starch on obesity and associated metabolic profiles in human: A systematic review of the literature. Crit. Rev. Food Sci. Nutr. 2021, 61, 889–905. [Google Scholar] [CrossRef]
- Raigond, P.; Ezekiel, R.; Raigond, B. Resistant starch in food: A review. J. Sci. Food Agric. 2015, 95, 1968–1978. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, Y.; Li, J.; Xing, T.; Jiang, Y.; Zhang, L.; Gao, F. Dietary resistant starch modifies the composition and function of caecal microbiota of broilers. J. Sci. Food Agric. 2020, 100, 1274–1284. [Google Scholar] [CrossRef]
- Nielsen, T.S.; Lærke, H.N.; Theil, P.K.; Sørensen, J.F.; Saarinen, M.; Forssten, S.; Knudsen, K.E. Diets high in resistant starch and arabinoxylan modulate digestion processes and SCFA pool size in the large intestine and faecal microbial composition in pigs. Br. J. Nutr. 2014, 112, 1837–1849. [Google Scholar] [CrossRef]
- Enriquez, A.B.; Ten Caten, F.; Ghneim, K.; Sekaly, R.P.; Sharma, A.A. Regulation of Immune Homeostasis, Inflammation, and HIV Persistence by the Microbiome, Short-Chain Fatty Acids, and Bile Acids. Annu. Rev. Virol. 2023, 10, 397–422. [Google Scholar] [CrossRef]
- McGlone, E.R.; Bloom, S.R. Bile acids and the metabolic syndrome. Ann. Clin. Biochem. 2019, 56, 326–337. [Google Scholar] [CrossRef]
- Liu, Y.; Huang, K.; Zhang, Y.; Cao, H.; Guan, X. Dietary polyphenols maintain homeostasis via regulating bile acid metabolism: A review of possible mechanisms. Food Funct. 2023, 14, 9486–9505. [Google Scholar] [CrossRef]
- Bing, H.; Li, Y.L. The role of bile acid metabolism in the occurrence and development of NAFLD. Front. Mol. Biosci. 2022, 9, 1089359. [Google Scholar] [CrossRef] [PubMed]
- Meadows, V.; Kennedy, L.; Kundu, D.; Alpini, G.; Francis, H. Bile Acid Receptor Therapeutics Effects on Chronic Liver Diseases. Front. Med. 2020, 7, 15. [Google Scholar] [CrossRef] [PubMed]
- Qin, S.; Tian, J.; Zhao, Y.; Wang, L.; Wang, J.; Liu, S.; Meng, J.; Wang, F.; Liu, C.; Han, J.; et al. Gardenia extract protects against intrahepatic cholestasis by regulating bile acid enterohepatic circulation. J. Ethnopharmacol. 2023, 319, 117083. [Google Scholar] [CrossRef]
- Yu, L.; Liu, Y.; Wang, S.; Zhang, Q.; Zhao, J.; Zhang, H.; Narbad, A.; Tian, F.; Zhai, Q.; Chen, W. Cholestasis: Exploring the triangular relationship of gut microbiota-bile acid-cholestasis and the potential probiotic strategies. Gut Microbes 2023, 15, 2181930. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Zhang, Z.; Xie, H.; Zhang, C.; Bai, Y.; Cao, H.; Che, Q.; Guo, J.; Su, Z. Effect of different bile acids on the intestine through enterohepatic circulation based on FXR. Gut Microbes 2021, 13, 1949095. [Google Scholar] [CrossRef] [PubMed]
- Clifford, B.L.; Sedgeman, L.R.; Williams, K.J.; Morand, P.; Cheng, A.; Jarrett, K.E.; Chan, A.P.; Brearley-Sholto, M.C.; Wahlström, A.; Ashby, J.W.; et al. FXR activation protects against NAFLD via bile-acid-dependent reductions in lipid absorption. Cell Metab. 2021, 33, 1671–1684.e1674. [Google Scholar] [CrossRef]
- Islam, K.B.; Fukiya, S.; Hagio, M.; Fujii, N.; Ishizuka, S.; Ooka, T.; Ogura, Y.; Hayashi, T.; Yokota, A. Bile acid is a host factor that regulates the composition of the cecal microbiota in rats. Gastroenterology 2011, 141, 1773–1781. [Google Scholar] [CrossRef]
- De Valdez, G.F.; Martos, G.; Taranto, M.P.; Lorca, G.L.; Oliver, G.; de Ruiz Holgado, A.P. Influence of bile on beta-galactosidase activity and cell viability of Lactobacillus reuteri when subjected to freeze-drying. J. Dairy Sci. 1997, 80, 1955–1958. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Penders, J.; Vink, C.; Driessen, C.; London, N.; Thijs, C.; Stobberingh, E.E. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol. Lett. 2005, 243, 141–147. [Google Scholar] [CrossRef]
- Fan, Y.; Ju, T.; Bhardwaj, T.; Korver, D.R.; Willing, B.P. Week-Old Chicks with High Bacteroides Abundance Have Increased Short-Chain Fatty Acids and Reduced Markers of Gut Inflammation. Microbiol. Spectr. 2023, 11, e0361622. [Google Scholar] [CrossRef] [PubMed]
- Rinttilä, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J. Appl. Microbiol. 2004, 97, 1166–1177. [Google Scholar] [CrossRef] [PubMed]
- Ohashi, Y.; Fujisawa, T. Analysis of Clostridium cluster XI bacteria in human feces. Biosci. Microbiota Food Health 2019, 38, 65–68. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.M.; Maia, M.R.G.; Pinna, C.; Biagi, G.; Matos, E.; Segundo, M.A.; Fonseca, A.J.M.; Cabrita, A.R.J. Effects of Zinc Source and Enzyme Addition on the Fecal Microbiota of Dogs. Front. Microbiol. 2021, 12, 688392. [Google Scholar] [CrossRef]
- Liu, Y.S.; Zhang, Y.Y.; Li, J.L.; Wang, X.F.; Xing, T.; Zhu, X.D.; Zhang, L.; Gao, F. Growth performance, carcass traits and digestive function of broiler chickens fed diets with graded levels of corn resistant starch. Br. Poult. Sci. 2020, 61, 146–155. [Google Scholar] [CrossRef]
- Camp, L.K.; Southern, L.L.; Bidner, T.D. Effect of carbohydrate source on growth performance, carcass traits, and meat quality of growing-finishing pigs. J. Anim. Sci. 2003, 81, 2488–2495. [Google Scholar] [CrossRef]
- Heo, J.M.; Agyekum, A.K.; Yin, Y.L.; Rideout, T.C.; Nyachoti, C.M. Feeding a diet containing resistant potato starch influences gastrointestinal tract traits and growth performance of weaned pigs. J. Anim. Sci. 2014, 92, 3906–3913. [Google Scholar] [CrossRef]
- Li, T.J.; Dai, Q.Z.; Yin, Y.L.; Zhang, J.; Huang, R.L.; Ruan, Z.; Deng, Z.; Xie, M. Dietary starch sources affect net portal appearance of amino acids and glucose in growing pigs. Animal 2008, 2, 723–729. [Google Scholar] [CrossRef]
- Bergh, M.; Razdan, A.; Åman, P. Nutritional influence of broiler chicken diets based on covered normal, waxy and high amylose barleys with or without enzyme supplementation. Anim. Feed. Sci. Technol. 1999, 78, 215–226. [Google Scholar] [CrossRef]
- Tian, S.; Chu, Q.; Ma, S.; Ma, H.; Song, H. Dietary Fiber and Its Potential Role in Obesity: A Focus on Modulating the Gut Microbiota. J. Agric. Food Chem. 2023, 71, 14853–14869. [Google Scholar] [CrossRef]
- Da Dalt, L.; Moregola, A.; Svecla, M.; Pedretti, S.; Fantini, F.; Ronzio, M.; Uboldi, P.; Dolfini, D.; Donetti, E.; Baragetti, A.; et al. The inhibition of inner mitochondrial fusion in hepatocytes reduces NAFL and improves metabolic profile during obesity by modulating bile acid conjugation. Cardiovasc. Res. 2023, cvad169. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Zhou, Y.; Tsao, R.; Dong, H.; Zhang, H. Amelioratory Effect of Resistant Starch on Non-alcoholic Fatty Liver Disease via the Gut-Liver Axis. Front. Nutr. 2022, 9, 861854. [Google Scholar] [CrossRef] [PubMed]
- Ha, A.W.; Han, G.J.; Kim, W.K. Effect of retrograded rice on weight control, gut function, and lipid concentrations in rats. Nutr. Res. Pract. 2012, 6, 16–20. [Google Scholar] [CrossRef] [PubMed]
- Nichenametla, S.N.; Weidauer, L.A.; Wey, H.E.; Beare, T.M.; Specker, B.L.; Dey, M. Resistant starch type 4-enriched diet lowered blood cholesterols and improved body composition in a double blind controlled cross-over intervention. Mol. Nutr. Food Res. 2014, 58, 1365–1369. [Google Scholar] [CrossRef] [PubMed]
- Ocvirk, S.; O’Keefe, S.J.D. Dietary fat, bile acid metabolism and colorectal cancer. Semin. Cancer Biol. 2021, 73, 347–355. [Google Scholar] [CrossRef]
- Jia, W.; Wei, M.; Rajani, C.; Zheng, X. Targeting the alternative bile acid synthetic pathway for metabolic diseases. Protein Cell 2021, 12, 411–425. [Google Scholar] [CrossRef]
- Wahlström, A.; Sayin, S.I.; Marschall, H.U.; Bäckhed, F. Intestinal Crosstalk between Bile Acids and Microbiota and Its Impact on Host Metabolism. Cell Metab. 2016, 24, 41–50. [Google Scholar] [CrossRef]
- Fiorucci, S.; Baldoni, M.; Ricci, P.; Zampella, A.; Distrutti, E.; Biagioli, M. Bile acid-activated receptors and the regulation of macrophages function in metabolic disorders. Curr. Opin. Pharmacol. 2020, 53, 45–54. [Google Scholar] [CrossRef]
- Adhikari, A.A.; Ramachandran, D.; Chaudhari, S.N.; Powell, C.E.; Li, W.; McCurry, M.D.; Banks, A.S.; Devlin, A.S. A Gut-Restricted Lithocholic Acid Analog as an Inhibitor of Gut Bacterial Bile Salt Hydrolases. ACS Chem. Biol. 2021, 16, 1401–1412. [Google Scholar] [CrossRef]
- Katafuchi, T.; Makishima, M. Molecular Basis of Bile Acid-FXR-FGF15/19 Signaling Axis. Int. J. Mol. Sci. 2022, 23, 6046. [Google Scholar] [CrossRef]
- Houten, S.M.; Watanabe, M.; Auwerx, J. Endocrine functions of bile acids. EMBO J. 2006, 25, 1419–1425. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Kuipers, F.; de Boer, J.F.; Kuivenhoven, J.A. Modulation of Bile Acid Metabolism to Improve Plasma Lipid and Lipoprotein Profiles. J. Clin. Med. 2021, 11, 4. [Google Scholar] [CrossRef] [PubMed]
- Goldstein, J.; Levy, C. Novel and emerging therapies for cholestatic liver diseases. Liver Int. 2018, 38, 1520–1535. [Google Scholar] [CrossRef] [PubMed]
- Jia, W.; Xie, G.; Jia, W. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 111–128. [Google Scholar] [CrossRef]
- Shih, D.M.; Kast-Woelbern, H.R.; Wong, J.; Xia, Y.R.; Edwards, P.A.; Lusis, A.J. A role for FXR and human FGF-19 in the repression of paraoxonase-1 gene expression by bile acids. J. Lipid Res. 2006, 47, 384–392. [Google Scholar] [CrossRef]
- Devlin, A.S.; Fischbach, M.A. A biosynthetic pathway for a prominent class of microbiota-derived bile acids. Nat. Chem. Biol. 2015, 11, 685–690. [Google Scholar] [CrossRef]
- Wang, Y.; Yu, Y.; Li, L.; Zheng, M.; Zhou, J.; Gong, H.; Feng, B.; Wang, X.; Meng, X.; Cui, Y.; et al. Bile acid-dependent transcription factors and chromatin accessibility determine regional heterogeneity of intestinal antimicrobial peptides. Nat. Commun. 2023, 14, 5093. [Google Scholar] [CrossRef]
- Goldberg, A.A.; Beach, A.; Davies, G.F.; Harkness, T.A.; Leblanc, A.; Titorenko, V.I. Lithocholic bile acid selectively kills neuroblastoma cells, while sparing normal neuronal cells. Oncotarget 2011, 2, 761–782. [Google Scholar] [CrossRef]
Item 1 | 1–21 d | 22–42 d | ||
---|---|---|---|---|
NC | RS | NC | RS | |
Ingredients, % | ||||
Soybean meal | 31.50 | 28.15 | 25.00 | 24.50 |
Corn | 57.00 | 36.50 | 61.30 | 38.00 |
Soybean oil | 3.10 | 2.20 | 4.10 | 4.50 |
Limestone | 1.20 | 1.20 | 1.40 | 1.40 |
Starch (20% resistant starch) | - | 20 | - | 20 |
Corn gluten meal | 3.40 | 8.15 | 4.60 | 8.00 |
L-Lysine hydrochloride | 0.34 | 0.34 | 0.30 | 0.30 |
Dicalcium phosphate | 2.00 | 2.00 | 1.70 | 1.47 |
Salt | 0.30 | 0.30 | 0.30 | 0.30 |
DL-Methionine | 0.15 | 0.15 | 0.08 | 0.07 |
Zeolite powder | 0.01 | 0.01 | 0.22 | 0.56 |
Premix 2 | 1.00 | 1.00 | 1.00 | 1.00 |
Calculated nutrient levels (%) | ||||
Arginine | 1.27 | 1.18 | 1.11 | 1.06 |
Methionine | 0.50 | 0.51 | 0.41 | 0.41 |
Lysine | 1.21 | 1.12 | 1.04 | 1.00 |
Methionine + cysteine | 0.86 | 0.85 | 0.75 | 0.72 |
Threonine | 0.83 | 0.81 | 0.75 | 0.74 |
Non-phytate phosphorus | 0.46 | 0.45 | 0.40 | 0.35 |
Calcium | 1.00 | 1.00 | 0.98 | 0.89 |
Crude protein | 21.33 | 21.00 | 19.49 | 19.40 |
Metabolizable energy (MJ/kg) | 12.52 | - | 13.00 | - |
Analyzed nutrient levels (%) | ||||
Starch 3 | 51.25 | 51.34 | 52.22 | 51.84 |
RS 3 | 3.03 | 7.33 | 3.27 | 7.39 |
Crude protein | 20.91 | 20.61 | 18.85 | 18.37 |
Calcium | 1.01 | 0.96 | 0.99 | 0.92 |
Available phosphorus | 0.47 | 0.48 | 0.41 | 0.38 |
Gene 1 | GenBank Number | Primer Sequence (5′ → 3′) | Products (bp) |
---|---|---|---|
BSEP | XM_004942757.3 | Forward: GGTTCATCCTGCAGAGACATC Reverse: CGCTTCTGGAATGTTTGGGG | 129 |
MRP2 | XM_025151804.1 | Forward: TCATCAAACAGGTGCTGGCT Reverse: GGGTCCCAGGTGACGATGT | 142 |
OATP1 | NM_001318449.1 | Forward: CTCTGTCACCTTGGGGCAATGTC Reverse: AACTCTGGCTGAACGCATCTGTAC | 150 |
NTCP | XM_015287931.1 | Forward: AGACAGGGATGGTTGTGCTT Reverse: CTGAGGGGAGATGGTGATGT | 106 |
ASBT | NM_001319027.1 | Forward: GGGGATGATGCCACTCTGTC Reverse: CCAATGCTGTCGTAGGGGAG | 84 |
IBABP | XM_015293653.2 | Forward: TCGGTCTCCCTGCTGACAAGATC Reverse: AGTCGTGGTGCGTCCTCCTG | 119 |
Ost α | NM_001277697.1 | Forward: CGTTCCATGATGGTGGTGGA Reverse: ACCATGGGCACGTCCTTTAG | 134 |
Ost β | XM_025153901.1 | Forward: GTCCTAAAGGCACCTTGGCT Reverse: GTGGTCCCACAAGTGACACA | 254 |
FXR | NM_204113.2 | Forward: AGTAGAAGCCATGTTCCTCCGTT Reverse: GCAGTGCATATTCCTCCTGTGTC | 182 |
SHP | NM_001030893.2 | Forward: GAGAACTGGCTTTGCGTGTG Reverse: AACTCAGTCTGCTCTGCGTC | 235 |
LRH-1 | NM_205078.1 | Forward: TTAAGCGGACCGTCCAGAAC Reverse: GCATTTTTGGAACCGGCAGT | 110 |
FGF19 | NM_204674.2 | Forward: GCTTCATCCTGCACCGTTTG Reverse: CGATCCCTCCCTGCAAGAAC | 100 |
FGFR4 | XM_015293864.2 | Forward: TCATCGGGAAAGTCCAGCAC Reverse: CCAGCTTTTCTCGGGGGAAT | 133 |
β-actin | NM_205518.1 | Forward: ATCCGGACCCTCCATTGTC Reverse: AGCCATGCCAATCTCGTCTT | 120 |
Gene | Primer Sequence (5′ → 3′) | Products (bp) | Reference |
---|---|---|---|
Bifidobacillus | Forward: GCGTGCTTAACACATGCAAGTC Reverse: CACCCGTTTCCAGGAGCTATT | 126 | [20] |
Bacteroides | Forward: CTGAACCAGCCAAGTAGCG Reverse: CCGCAAACTTTCACAACTGACTTA | 140 | [21] |
Lactobacillus | Forward: AGCAGTAGGGAATCTTCCA Reverse: CACCGCTACACATGGAG | 341 | [22] |
Clostridium cluster XI | Forward: ACGCTACTTGAGGAGGA Reverse: GAGCCGTAGCCTTTCACT | 55 | [23] |
Clostridium cluster XIVa | Forward: GAWGAAGTATYTCGGTATGT Reverse: CTACGCWCCCTTTACAC | 59 | [24] |
Escherichia coli | Forward: CATGCCGCGTGTATGAAGAA Reverse: CGGGTAACGTCAATGAGCAAA | 95 | [20] |
Items 2 | Treatment 1 | SEM | p-Value | |
---|---|---|---|---|
NC | RS | |||
1–21 d | ||||
ADG (g) | 36.35 | 36.15 | 1.25 | 0.962 |
ADFI (g) | 51.86 | 51.11 | 0.31 | 0.390 |
F/G | 1.43 | 1.41 | 0.06 | 0.488 |
21–42 d | ||||
ADG (g) | 73.53 | 70.50 | 2.05 | 0.066 |
ADFI (g) | 140.60 | 146.65 | 4.56 | 0.544 |
F/G | 1.91 | 2.09 * | 0.03 | 0.033 |
1–42 d | ||||
ADG (g) | 54.94 | 53.3 | 1.60 | 0.542 |
ADFI (g) | 96.23 | 98.88 | 2.18 | 0.640 |
F/G | 1.75 | 1.86 | 0.03 | 0.082 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Zhan, C.; Zhang, Y.; Zhang, L.; Li, J.; Xing, T.; Zhao, L.; Wang, J.; Gao, F. Dietary Resistant Starch Regulates Bile Acid Metabolism by Modulating the FXR/LRH-1 Signaling Pathway in Broilers. Agriculture 2023, 13, 2159. https://doi.org/10.3390/agriculture13112159
Wang Z, Zhan C, Zhang Y, Zhang L, Li J, Xing T, Zhao L, Wang J, Gao F. Dietary Resistant Starch Regulates Bile Acid Metabolism by Modulating the FXR/LRH-1 Signaling Pathway in Broilers. Agriculture. 2023; 13(11):2159. https://doi.org/10.3390/agriculture13112159
Chicago/Turabian StyleWang, Zhenxin, Chunyan Zhan, Yingying Zhang, Lin Zhang, Jiaolong Li, Tong Xing, Liang Zhao, Jianfei Wang, and Feng Gao. 2023. "Dietary Resistant Starch Regulates Bile Acid Metabolism by Modulating the FXR/LRH-1 Signaling Pathway in Broilers" Agriculture 13, no. 11: 2159. https://doi.org/10.3390/agriculture13112159
APA StyleWang, Z., Zhan, C., Zhang, Y., Zhang, L., Li, J., Xing, T., Zhao, L., Wang, J., & Gao, F. (2023). Dietary Resistant Starch Regulates Bile Acid Metabolism by Modulating the FXR/LRH-1 Signaling Pathway in Broilers. Agriculture, 13(11), 2159. https://doi.org/10.3390/agriculture13112159