Supplemental Xylooligosaccharide Attenuates Growth Retardation and Intestinal Damage in Broiler Chickens Challenged by Avian Pathogenic Escherichia coli

Abstract

This study was conducted to investigate the protective effects of xylooligosaccharide (XOS) on the growth performance and intestinal health of broilers challenged by avian pathogenic Escherichia coli (APEC). A total of 144 newly hatched male Lingnan yellow-feathered broilers were randomly divided into three groups (six replicates/group): a control (CON) group, an APEC group and an XOS group (APEC-challenged broilers supplemented with 1600 mg/kg XOS). Birds in the APEC and XOS groups were orally challenged with APEC from 7 to 12 d of age. Growth performance and intestinal health-related parameters were determined on d 13 and 17. The reductions (p < 0.05) in final body weight, average daily gain and elevation (p < 0.05) in intestinal APEC colonization in challenged broilers were counteracted by the XOS addition, which also alleviated the APEC-induced reductions (p < 0.05) in jejunal goblet cell count and density in broilers on d 17. Supplementing with XOS increased (p < 0.05) jejunal villus height and crypt depth, coupled with occludin and zonula occluden-1 expression, on d 17, and diminished the change (p < 0.05) in the jejunal inflammatory cytokine expression profile in a time-dependent manner. Moreover, cecal counts of total bacteria and Lactobacillus in challenged broilers were augmented (p < 0.05) by the XOS addition, which also mitigated APEC-induced reductions (p < 0.05) in cecal acetate, butyrate and valerate concentrations in broilers on d 13 or 17. Supplementing with XOS blocked the increases (p < 0.05) in the expression of cecal E. coli virulence genes relA and ompR on d 13 along with the expression of fimH and csgA on d 17. XOS alleviated APEC-induced growth retardation and intestinal disruption in broilers partially by restraining the intestinal colonization of APEC. Furthermore, the improvements in cecal microbiota and fermentation pattern, along with attenuation of cecal E. coli virulence resulting from XOS supplementation, could also support the maintenance of intestinal health in APEC-challenged broilers.

1. Introduction

As one of the most prevalent pathogenic bacteria in poultry, avian pathogenic Escherichia coli (APEC), such as serogroups O1, O2 and O78, account for a range of diseases. Both broilers and laying hens are susceptible to APEC, with economic losses from APEC-contaminated carcasses reaching USD 40 million in the U.S. APEC serves as either a primary pathogen or secondary pathogen to viral infections, immunosuppressive disease, or environment stress, leading to colisepticemia, hemorrhagic septicemia and enteritis. Although antibiotics and vaccines are employed to combat APEC infections, the emergence of resistance and the variety of serotypes limit their effectiveness [1]. Although APEC belongs to the extra-intestinal pathogens, it mainly inhabits and develops in the gut [1]. Avian isolates clustered with human extra-intestinal pathogenic Escherichia coli (ExPEC) at the genomic level, indicating a horizontal exchange of mobile genetic elements between APEC and ExPEC [2]. This interaction contributes to their survival and virulence. Therefore, APEC is characterized as a potential zoonotic pathogen that poses a threat to public health [3]. Moreover, APEC still has intestinal pathogenicity with the potential to trigger numerous intra-intestinal disorders in chickens [1]. Indeed, oral administration of APEC has been verified to cause intestinal damage, leading to retardation of growth in broilers [4]. During the past few decades, antibiotics have been widely used in feeds to prevent or control bacteria-related disorders in animals. However, the efficacy of antibiotic treatment for APEC is diminished by the horizontal spread of genetic elements, such as islands of resistance and virulence genes in APEC and commensal E. coli [5]. Moreover, the in-feed antibiotic prohibition results in a demand for exploring natural additives to mitigate APEC damage. There is an interest in characterizing prebiotics as potential alternatives to alleviate the detrimental effects of the APEC challenge in poultry [6].

Xylooligosaccharide (XOS) represents an important type of prebiotic that can pass through the proximal intestine and selectively stimulate the proliferation of certain beneficial bacteria as well as facilitate the production of short-chain fatty acids (SCFAs) in the hindgut of animals [7]. As a key nutritional and energy component for enterocytes, SCFAs sustain cell renewal and repair to enhance the anti-inflammation response and barrier function of intestinal epithelia [8]. In addition, SCFAs inhibit the virulence genes and colonization ability of ExPEC, making them versatile and effective antimicrobial agents produced during microbial degradation of oligosaccharides [9]. Additionally, XOS is hypothesized to exert a similar effect to other oligosaccharides in inhibiting the adhesion of specific pathogenic bacteria to host intestinal epithelia, due to its potential ability to bind to bacterial surfaces, probably by acting as decoy receptors for bacterial adhesins [10]. Other ways that XOS suppresses pathogens, such as interference with gene expression associated with bacterial virulence (e.g., adhesion), are less investigated but might be equally impactful [11]. The aforementioned actions of XOS are speculated to optimize the gut microbiome and diminish bacterial pathogenicity, which may subsequently enhance the production performance and intestinal health of chickens. Indeed, it has been reported that an XOS addition improved growth performance and intestinal health as well as modulated the immune responses of broilers that were free of challenges [12]. Nevertheless, it is unknown whether dietary XOS could protect broilers against an APEC challenge. Therefore, this study aimed to investigate the effect of XOS on intestinal integrity, cecal microbial composition and SCFA production, with the goal of decreasing APEC colonization and the expression of virulence, thus protecting yellow-feathered broiler chicks from APEC. The findings of this research may offer insights into the application of XOS in broiler farming and present an environmentally friendly and effective approach to address microbial infections.

2. Materials and Methods

2.1. Animals and Experimental Design

The experimental animal protocols of this study were approved by the Animal Care and Use Committee of the South China Agricultural University (Protocol Number: 2023F240). In this study, we selected yellow-feathered broilers, which are medium-growing breeds favored in China [13]. A total of 144 1 d old male Lingnan yellow-feathered broiler chicks were purchased from Xinwang Poultry Co., Ltd. (Guangzhou, China), vaccinated with live chicken Marek’s disease vaccine and did not receive any other vaccinations or probiotics during the trial period. Chicks (paired as AF × DB, with A and F representing the heavy-duty sire lines of the Lingnan yellow-feathered chicken, while D and B denote the high-yielding female lines of the same breed) were randomly allocated into 3 groups: a control (CON) group (birds received a basal diet without challenge), an APEC group (birds received a basal diet with APEC challenge) and an XOS group (APEC-challenged birds supplemented with 1600 mg/kg XOS). Each group involved 6 replicates with 8 birds per replicate. The initial body weight was similar across replicates. The corncob-derived XOS (95% purity) was obtained from Shandong Longlive Bio-Technology Co. Ltd. (Dezhou, China). The percentage of each component was as follows: xylose 2.2%, xylobiose 40%, xylotriose 33%, xylotetraose 12%, xylotentaose 5%, xylhexaose and xylheptaose 5.5%, glucose and arabinose 2%. The additive dosage of XOS in the broiler diet was selected based on our preliminary experiment, and another study used 2000 mg/mg of XOS additions to mitigate pathogenic bacterial infections [5,14]. Feed ingredients were crushed and mixed with the corresponding weight of XOS to make a ground diet for broiler rearing.

The nutritional composition and nutrient levels of the basal diet based on the Chinese Feeding Standard of Yellow-feathered Chickens (NY/T 3645-2020) are presented in

Table 1. Composition and nutrient levels of basal diet (air-dry basis).

Ingredients	Contents (%)
Corn	60.88
Soybean meal	35.21
Limestone	1.44
Dicalcium phosphate	1.56
Salt	0.34
Choline chloride (50%)	0.35
DL-Methionine (98%)	0.12
Premix (1)	0.10
Total	100.00
Nutrient levels (2)
Metabolizable energy (Mcal/kg)	2.86
Crude protein (%)	21.06
Calcium (%)	1.00
Available phosphorus (%)	0.40
Digestible lysine (%)	1.05
Digestible methionine (%)	0.42
Digestible methionine + cysteine (%)	0.71

⁽¹⁾ Supplied per kilogram of diet: vitamin A, 12,000 IU; vitamin D₃, 600 IU; tocopherol, 45 IU; menadione, 2.5 mg; thiamin, 2.2 mg; riboflavin, 8 mg; niacin, 40 mg; pantothenic acid, 10 mg; pyridoxine, 4 mg; biotin, 0.4 mg; folic acid, 1.0 mg; cobalamin, 0.013 mg; Fe, 80 mg; Cu, 8.0 mg; Zn, 60 mg; Mn, 110 mg; Se, 0.3 mg; I, 1.1 mg. ⁽²⁾ Values represent calculated levels of nutrients.

[15]. Broilers were housed in a windowed room measuring 40 square meters, and the humidity was kept at approximately 65%. Eighteen wire cages were used in this study, and each cage contained eight chickens. The dimensions of the cages were 70 cm in length, 32 cm in width and 43 cm in depth. The room temperature was kept at 34 °C during the first three days using heaters and then gradually reduced to 26 °C on d 17. Birds were exposed to continuous white lighting and had free access to the diets and fresh water.

2.2. Construction of APEC O78 Recombinant Strain with Antibiotic Resistance

In order to detect the colonization in the intestine by resistance plate screening, we constructed APEC O78 with a spectinomycin-resistant biofilm self-inducible promoter [16]. The pMB1-spect-PthrC3_8-eGFP plasmid (Addgene#107411) that exerts no impacts on the growth, virulence and physiological activities of E. coli [16] was extracted from DH5α strain in agar stab (Addgene Plasmid Repository) by using the SanPrep Column Plasmid Mini-preps Kit (Sangon Biotech. Co., Ltd., Shanghai, China). The concentration of extracted plasmid was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The purity and integrity of the plasmid were verified by measuring the ratio of absorbance at 260 nm to 280 nm (A260/A280 greater than 1.8) and using agarose gel electrophoresis, respectively. The recovery and purification of plasmid were performed using DNA gel recovery kits (Tsingke Biotech. Co., Ltd., Beijing, China).

The APEC O78 strain (CVCC1570), provided by China Veterinary Culture Collection Center (Beijing, China), was plated in LB agar. Single colonies of APEC O78 were picked and cultured in LB medium (37 °C, 180 rpm) until the OD₆₀₀ value reached 0.3~0.5, followed by centrifugation for 8 min (4 °C, 3000 rpm). After discarding the supernatant, the resulting precipitate was washed twice with calcium chloride solution and then resuspended with sterile water containing 15% glycerol. The resultant competent cells of APEC O78 (100 μL) were electro-transformed with pMB1-spect-PthrC3_8-eGFP plasmid (5 μL, guaranteed plasmid mass greater than 1 μg) through a micropulser (Bio-Rad, Hercules, CA, USA) with voltage of 1.8 kv, capacitance of 25 μF and resistance of 200 Ω. The successfully recombinant bacteria were screened by plating on spectinomycin (50 μg/mL, solarbio Tech. Co., Ltd., Beijing, China)-resistant LB agar.

2.3. Oral Administration of Recombinant APEC O78

The above recombinant APEC O78 strain was inoculated in LB broth and cultured at 37 °C overnight. To enumerate bacteria, the inoculum was diluted and plated on LB broth agar at 37 °C for 24 h. From 7 to 12 d of age, each bird in the APEC and XOS groups was orally gavaged with 2 mL of recombinant APEC culture (total 4.0 × 10⁹ CFU), while CON birds were orally gavaged with the same amount of LB broth. The APEC gavage dose was determined by a combination of a previous trial and studies to construct APEC infections [17]. No food or water were administered for 6 h before and 3 h after the APEC challenge in all groups.

2.4. Sample Collection

At 1st and 5th d post challenge (namely 13 and 17 d of age), birds were randomly selected from each replicate (one bird/replicate) and then slaughtered for separating the intestinal tract. Sterile scissors and forceps were used to cut 1 cm of duodenum, jejunum and ileum at their midpoints for determination of intestinal colonization of APEC O78. Further, the samples near the midpoints of the jejunum and ileum were collected and separated into two sections, one of which was fixed in 4% paraformaldehyde solution, while the other one was snap-frozen by liquid nitrogen and kept at −80 °C. Meanwhile, cecal content was harvested from each bird.

2.5. Measurement of Growth Performance

Each replicate was kept in a cage, and they were weighed collectively. The overall weight of each treatment group was then divided by the number of chicks in that group to calculate the average weight. Body weight and feed consumption of broilers were recorded for each replicate at 13 and 17 d of age for calculation of the final body weight (FBW), average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR) during 1–13 d and 1–17 d of age. The collected data on FBW, FCR, mortality rates and rearing duration were utilized to compute the European Production Index (EPI) using the following formula: (FBW × liveability × 100)/(FCR × rearing time).

2.6. Determination of Intestinal Colonization of APEC O78

The experimental method was derived from a previous study [18]. The samples from duodenal, jejunal and ileal tissues were dissected longitudinally and rinsed in sterile phosphate buffer solution (PBS) containing 0.25 mg/mL of spectinomycin (in order to kill the irrelevant bacteria). These tissues were then cryohomogenized by a rapid Sample Grinder (JXFSTPRP-24, Jingxin Industrial Development Co., Ltd., Shanghai, China), and the resulting homogenate was 10-fold gradient-diluted with sterile PBS containing 0.05 mg/mL of spectinomycin, followed by spreading on a MacConkey agar plate containing 0.05 mg/mL of spectinomycin at 37 °C overnight. We recorded the number of colonies grown and multiplied this by the number of dilutions, after which this was processed as log₁₀ to analyze the differences between the groups.

2.7. Histomorphological Examination of Intestinal Tissues

Jejunal samples fixed in formaldehyde solution were subjected to paraffin-embedding procedures. The 4 μm cross-sections of samples were separately stained with hematoxylin–eosin and periodic acid–Schiff (PAS) stain. For each section, the intact and representative villus–crypt units in each section (at least 8) were selected for analyzing intestinal morphology under microscopic vision fields with Image J software (1.54d). Villus height (VH) was defined as the length from the tip of the villus to the villus–crypt junction, while crypt depth (CD) was defined as the depth of emboli between adjacent villi, and the ratio of VH to CD (VCR) was then calculated. Further, goblet cells were detected in PAS-stained sections, and the count and density of goblet cells were expressed as the total number of goblet cells per villus and per 100 μm of villus, respectively.

2.8. Determination of the Relative mRNA Expression of Intestinal Genes

Total RNA was isolated from jejunal tissue using the FastPure^® Cell/Tissue Total RNA Isolation Kit V2 (Vazyme Biotech., Nanjing, China) according to the manufacturer’s protocols. The verification of RNA concentration and quality, reverse transcription as well as quantitative reverse transcription PCR (RT-qPCR) were implemented according to the methods described elsewhere [18]. Primer sequences for the reference gene, glyceraldehyde-phosphate dehydrogenase (GAPDH), and the target genes, including interleukin (IL)-1β, IL-6, IL-8, IL-10, tumor necrosis factor α (TNF-α), claudin-1, occludin and zonula occludens-1 (ZO-1) are listed in

Table 2. Primer sequences for relative quantitative PCR.

Species	Genes (1)	Primer Sequences (5′-3′)	Product Sizes (bp)
Chicken	GAPDH	F: GTGAAGGTCGGAGTGAACGGATTT	187
		R: CCCATTTGATGTTGGCGGGAT
	IL-1β	F: TGCCTGCAGAAGAAGCCTCG	204
		R: GACGGGCTCAAAAACCTCCT
	IL-6	F: GCTGCAGTCACAGAACGAGT	167
		R: GGACAGGTTTCTGACCAGAGG
	IL-8	F: TGAGAAGCAACAACAACAGCA	129
		R: CAGCACAGGAATGAGGCATA
	IL-10	F: TCAATCCAGGGACGATGAACT	114
		R: TCTGTGTAGAAGCGCAGCAT
	TNF-α	F: GCATCGCCGTCTCCTACCA	204
		R: CCTGCCCAGATTCAGCAAAGT
	Claudin-1	F: GTGCAGAAGATGCGGATGG	253
		R: TTGGTGTTGGGTAAGATGTTGTTT
	Occludin	F: ATCAACAAAGGCAACTCT	157
		R: GCAGCAGCCATGTACTCT
	ZO-1	F: GAGTTTGATAGTGGCGTT	298
		R: GTGGGAGGATGCTGTTGT
Escherichia coli	GAPDH	F: TCGCATTGTTTTCCGTGCTG	75
		R: TCAGCGTCTAACAGGTCGTT
	fimH	F: GATGTTTCTGCTCGTGATG	261
		R: TACCGCCGAAGTCCCT
	csgA	F: ACTGGCCTCATATCAACGGC	98
		R: CGTAAAGTAGCATTCGCCGC
	hycA	F: CGGCATGATTGATGGCAAGG	100
		R: GGCGGTGTATAAGCTGTCGT
	luxS	F: TTGGTACGCCAGATGAGCAG	113
		R: GCCACACTGGTAGACGTTCA
	tolA	F: ATGGTTGATTCAGGTGCGGT	87
		R: CTTGCGCTGCTCATCAGAAC
	relA	F: GTTCGCCGGATGTTATTGGC	100
		R: CCGGCGCATCTTTTACTTCG
	ompR	F: GCGTCGCTAATGCAGAACAG	142
		R: ATGATCGGCATCGGATTGCT

⁽¹⁾ The primer sequences were obtained from the genes of the corresponding species. Gallus gallus: GAPDH, reduced glyceraldehyde-phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; ZO-1, zonula occludens-1. Escherichia coli: fimH, fimbrillin H; csgA, curli subunit gene A; hycA, formate hydrogenlyase regulator HycA gene; luxS, S-ribosylhomocysteine lyase; tolA, Tol/Pal system protein TolA gene; relA, (p)ppGpp synthetase gene; ompR, outer membrane protein R.

. The relative mRNA expression of the target genes was calculated using the 2^−ΔΔCt method, ΔCt = Ct_Target − Ct_GAPDH, ΔΔCt = ΔCt_treat − ΔCt_CON.

2.9. Quantitative Profiling of Cecal Bacterial Counts

Bacterial populations were measured by the absolute RT-qPCR method described previously [19]. Briefly, total genomic DNA was extracted from cecal chyme using the TIANamp Stool DNA kit (TIANGEN Biotech. Co., Ltd., Beijing, China). The concentration and quality of DNA were validated according to our previous study [20]. The extracted DNA was used as a template for PCR amplification using microbe-specific primers (

Table 3. Primer sequences for absolute quantitative PCR.

Bacteria	Primer Sequences (5′-3′)	Product Sizes (bp)
Total bacteria	F: GCAGGCCTAACACATGCAAGTC	315
	R: TGCTGCCTCCCGTAGGAGT
Lactobacillus	F: GAGGCAGCAGTAGGGAATCTTC	126
	R: GGCCAGTTACTACCTCTATCCTTCTTC
Bifidobacterium	F: TACACCACCACCCGAAGAA	123
	R: GGAGTGCTCCTGCAGATTGT
Escherichia coli	F: CATGCCGCGTGTATGAAGAA	96
	R: CGGGTAACGTCAATGAGCAAA
Avain pathogenic E. coli O78	F: CGATGTTGAGCGCAAGGTTG	323
	R: TAGGTATTCCTGTTGCGGAG
Salmonella	F: AGGCCTTCGGGTTGTAAAGT	97
	R: GTTAGCCGGTGCTTCTTCTG

), and the PCR products were then validated by agarose gel electrophoresis, followed by recovery and purification using DNA gel recovery kits (Tsingke Biotech. Co., Ltd., Beijing, China). The resulting DNA standards for target bacteria with their serial 10-fold dilutions served as the templates for qPCR with the corresponding primers. To construct standard curves for target bacteria, the lg (copy numbers) and their respective Ct values of each concentration of DNA standards were denoted as the X-and Y-axes, respectively. The copy numbers of DNA standards were calculated under the following formula: DNA (copy numbers) = [(C × 6.0233 × 10²³ (copies/mol)]/(S × 660 × 10⁶), in which C represents the concentration of DNA standards (μg/μL) and S represents the number of product bases corresponding to microbe-specific primers. Finally, individual sample DNA served as the template to obtain the Ct value by quantitative PCR, and the copy number of each bacterium was then calculated according to the standard curve obtained above.

2.10. Analysis of SCFA Profile

The concentrations of SCFAs in cecal chyme were determined by the internal standard method of gas chromatography with 2-ethylbutyric acid (2-EB) used as the internal standard. Briefly, cecal chyme was dissolved in 2.5 times (v/w) the volume of ultrapure water by vortex shaking for 5 min and then centrifuged (10,000 rpm, 4°C) for 10 min. The supernatant was collected and mixed with 0.2 times the volume of 25% (v/v) metaphosphate containing 2 g/L 2-EB, followed by incubation in ice water for 30 min and centrifugation (10,000 rpm, 4 °C) for 10 min. The resulting supernatant was then poured into the chromatographic injection bottle of an Agilent 6890 N gas chromatograph (Agilent, Santa Clara, CA, USA) for SCFA analysis following the method of a previous report [21].

2.11. Determination of the Relative mRNA Expression of Cecal E. coli Virulence Genes

Bacterial RNA was isolated from cecal chyme, using the PowerFecal Pro kit (QIAGEN, Hilden, Germany) under the manufacturer’s instructions [22]. The confirmation of RNA concentration and quality, reverse transcription as well as RT-qPCR were implemented as described previously [19]. Primer sequences of the reference gene GAPDH and virulence genes (type 1 fimbriae D-mannose specific adhesin (fimH), curlin major subunit (csgA), formate hydrogenlyase regulatory protein (hycA), S-ribosylhomocysteine lyase (luxS), Tol/Pal system protein (tolA), (p)ppGpp synthetase (relA) and DNA-binding transcriptional dual regulator (ompR)) of E. coli are presented in Table 2. The relative mRNA expression of target genes was calculated using the 2^−ΔΔCt method, ΔCt = Ct_Target − Ct_GAPDH, ΔΔCt = ΔCt_treat − ΔCt_CON.

2.12. Statistical Analysis

Data are presented as means with their pooled standard error of the mean. All data were analyzed by one-way ANOVA in the general linear model procedure of SPSS 22.0. Differences among groups were detected by Duncan’s multiple comparisons. Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance.

3. Results

3.1. Effect of XOS on Growth Performance of Broilers Challenged by APEC

As shown in

Table 4. Effect of xylooligosaccharide on growth performance of broilers challenged by avian pathogenic Escherichia coli ⁽¹⁾.

Items	CON (2)	APEC	XOS	SEM	p-Value (3)
Days 1–13
FBW, g	149 a	133 b	160 a	6.77	<0.001
ADG, g	9.01 a	7.59 b	9.98 a	0.547	<0.001
ADFI, g	14.8 b	14.3 b	15.4 a	0.514	0.037
FCR	1.62 b	1.86 a	1.68 b	0.087	0.004
EPI	705.92 a	547.81 b	734.20 a	62.88	0.020
Days 1–17
FBW, g	220 a	191 b	237 a	11.6	<0.001
ADG, g	11.23 a	9.40 b	11.99 a	0.624	<0.001
ADFI, g	21.7 a,b	19.7 b	22.8 a	1.17	0.005
FCR	1.90	2.09	1.97	0.143	0.158
EPI	680.21 a,b	536.55 b	709.83 a	89.83	0.012

SEM, pooled standard error of the mean; FBW, final body weight; ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio; EPI, European Production Index. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

, broilers in the APEC group showed reduced (p < 0.05) FBW and ADG during both 1–13 d and 1–17 d of age, along with an increased (p < 0.05) FCR during 1–13 d of age when compared with those in the CON group. However, supplemental XOS restored the above parameters in challenged broilers to the same (p > 0.05) levels as those in the CON group. An XOS addition also elevated (p < 0.05) the ADFI in challenged broilers during 1–17 d of age as compared with that in the APEC group.

3.2. Effect of XOS on Intestinal Colonization of APEC in Broilers Challenged by APEC

There was a higher (p < 0.05) number of duodenal, jejunal and ileal APEC in broilers on both d 13 and 17 in the APEC group versus the CON group (

Table 5. Effect of xylooligosaccharide on intestinal colonization of Escherichia coli (O78) in broilers challenged by avian pathogenic Escherichia coli on d 13 and 17 ⁽¹⁾.

Items (CFU)	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
Duodenum	3.94 b	4.28 a	3.81 a,b	0.124	0.047
Jejunum	3.25 b	4.57 a	3.85 a,b	0.216	0.048
Ileum	4.03 b	5.14 a	3.87 b	0.153	0.016
Day 17
Duodenum	3.59 b	4.45 a	3.91 a,b	0.096	0.042
Jejunum	4.23 b	4.54 a	4.08 b	0.115	0.039
Ileum	4.44 b	5.23 a	3.79 b	0.085	0.024

SEM, pooled standard error of the mean. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

). However, the number of duodenal, jejunal and ileal APEC on d 13 and d 17 in the XOS group was reduced to a level comparable to (p > 0.05) those in the CON group. Based on the above results (jejunal APEC number was reduced more obviously than duodenal APEC number due to XOS addition), we selected jejunal samples for further analysis.

3.3. Effects of XOS on Jejunal Histomorphological Measurements of Broilers Challenged by APEC

As shown in

Table 6. Effect of xylooligosaccharide on histological measurements from jejunal tissues of broilers challenged by avian pathogenic Escherichia coli ⁽¹⁾.

Items	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
Villus height (μm)	575	475	542	60.1	0.088
Crypt depth (μm)	77.2 a	60.8 b	71.4 a,b	9.75	0.043
Villus height-to-crypt depth ratio	7.51	7.74	7.77	1.30	0.963
Goblet cell count (4)	72.3	66.5	86.6	20.4	0.313
Goblet cell density (5)	8.19 b	7.73 b	11.22 a	1.68	0.013
Day 17
Villus height (μm)	648 a,b	536 b	815 a	92.9	0.006
Crypt depth (μm)	82.2 a,b	79.6 b	104.7 a	13.98	0.035
Villus height-to-crypt depth ratio	7.88	6.74	7.83	0.957	0.100
Goblet cell count	88.3 a	52.0 b	80.8 a	9.03	<0.001
Goblet cell density	9.28 a	4.75 b	8.47 a	0.887	<0.001

SEM, pooled standard error of the mean. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ⁽⁴⁾ Goblet cell count was calculated as the total number of goblet cells per villus. ⁽⁵⁾ Goblet cell density was calculated as the number of goblet cells per 100 μm of villus. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

, compared with the CON group, the APEC group had a decrease (p < 0.05) in CD coupled with a trend toward a decrease (p < 0.10) in VH on d 13. However, VH on d 13 tended to be higher (p < 0.10), while VH and CD on d 17 were higher (p < 0.05) in the XOS group than those in the APEC group. Furthermore, compared to the APEC group, the CD on d 13 in the XOS group was increased to a level similar to that in the CON group (p > 0.05). Goblet cell density on d 13 in the XOS group was higher (p < 0.05) than that in either the CON group or the APEC group. Both goblet cell count and density on d 17 were lower (p < 0.05) in the APEC group versus either the CON group or the XOS group.

3.4. Effect of XOS on the Relative Expression of Jejunal Genes of Broilers Challenged by APEC

As shown in

Table 7. Effect of xylooligosaccharide on the relative mRNA expression of jejunal tight junction proteins in broilers challenged by avian pathogenic Escherichia coli on d 13 and 17 ⁽¹⁾.

Items	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
ZO-1	1.00 b	1.05 ab	1.32 a	0.105	0.036
Occludin	1.07 a,b	0.87 b	1.45 a	0.135	0.041
Claudin-1	1.12	1.35	1.90	0.327	0.279
Day 17
ZO-1	1.00 b	1.12 b	1.79 a	0.253	0.048
Occludin	1.03 b	1.01 b	1.66 a	0.178	0.027
Claudin-1	1.00 b	1.17 a,b	2.57 a	0.464	0.019

SEM, pooled standard error of the mean; ZO-1, zonula occludens-1. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

, the mRNA expression profile of jejunal tight junction (TJ) proteins was similar (p > 0.05) between the CON group and the APEC group on both d 13 and 17. However, the XOS group showed increases (p < 0.05) in occludin mRNA expression on d 13 as well as the mRNA expression of occludin and ZO-1 on d 17 in comparison with the APEC group.

Compared with the CON group, the APEC group had a lower (p < 0.05) expression of TNF-α and IL-8 on d 13 coupled with a higher (p < 0.05) expression of IL-8 on d 17 (

Table 8. Effect of xylooligosaccharide on the relative mRNA expression of jejunal inflammatory cytokines in broilers challenged by avian pathogenic Escherichia coli on d 13 and 17 ⁽¹⁾.

Items	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
IL-6	1.09	1.71	1.81	0.233	0.098
IL-8	1.10 a	0.23 b	0.28 b	0.064	<0.001
IL-10	1.09 b	1.32 a,b	2.26 a	0.108	0.041
IL-1β	1.23	1.20	0.64	0.253	0.302
TNF-α	1.02 a	0.51 b	1.15 a	0.079	0.001
Day 17
IL-6	1.05 b	1.91 a,b	2.36 a	0.409	0.047
IL-8	1.02 b	1.92 a	2.79 a	0.404	0.048
IL-10	0.94 b	1.81 a,b	2.45 a	0.438	0.044
IL-β	0.94 a,b	1.42 a	0.80 b	0.178	0.024
TNF-α	1.00	0.97	0.67	0.137	0.570

SEM, pooled standard error of the mean; IL, interleukin; TNF, tumor necrosis factor. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

). The XOS group had a higher (p < 0.05) expression of TNF-α on d 13 with a lower (p < 0.05) expression of IL-1β on d 17 when compared with the APEC group.

3.5. Effect of XOS on Cecal Bacterial Count of Broilers Challenged by APEC

As presented in

Table 9. Effect of xylooligosaccharide on cecal bacterial counts of broilers challenged by avian pathogenic Escherichia coli ⁽¹⁾.

Items	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
Total bacteria (lg copies/g)	9.95 a,b	9.58 b	10.19 a	0.327	0.041
Lactobacillus (lg copies/g)	7.83 a	7.47 b	8.27 a	0.277	0.003
Bifidobacteria (lg copies/g)	6.87	6.72	7.15	0.486	0.359
E. coli (lg copies/g)	7.77	7.47	7.69	0.124	0.621
E. coli O78 (lg copies/g)	3.44 b	4.29 a	4.20 a	0.453	0.016
Salmonella (lg copies/g)	4.14	4.25	4.17	0.170	0.636
Day 17
Total bacteria (lg copies/g)	9.71 a,b	9.69 b	10.11 a	0.221	0.035
Lactobacillus (lg copies/g)	8.00 a,b	7.49 b	8.19 a	0.325	0.036
Bifidobacteria (lg copies/g)	6.77	6.58	6.85	0.323	0.420
E. coli (lg copies/g)	7.80	7.74	7.47	0.186	0.552
E. coli O78 (lg copies/g)	3.35	3.46	3.19	0.211	0.212
Salmonella (lg copies/g)	3.87	3.90	3.86	0.180	0.963

SEM, pooled standard error of the mean. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

, the APEC group had a lower (p < 0.05) count of Lactobacillus with a higher (p < 0.05) count of E. coli O78 in the cecum on d 13 than those in the CON group. Comparatively, the counts of total bacteria and Lactobacillus in the cecum on both d 13 and 17 were higher (p < 0.05) in the XOS group versus the APEC group. No differences (p > 0.05) were observed in the counts of cecal Bifidobacteria, E. coli and Salmonella among groups on either d 13 or 17.

3.6. Effect of XOS on Cecal SCFA Profile of Broilers Challenged by APEC

Compared with the CON group, the APEC group presented reductions (p < 0.05) in cecal acetate and isobutyrate concentrations on d 13, along with the concentrations of cecal acetate, butyrate and valerate on d 17 (

Table 10. Effects of xylooligosaccharide on cecal short-chain fatty acid profile of broilers challenged by avian pathogenic Escherichia coli ⁽¹⁾.

Items (mmol/L)	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
Acetate	24.8 a	18.5 b	30.5 a	3.07	0.001
Propionate	2.26	1.36	1.43	0.589	0.077
Butyrate	4.66	5.33	7.27	2.201	0.200
Isobutyrate	0.26 a	0.16 b	0.18 b	0.039	0.014
Valerate	0.29	0.17	0.28	0.085	0.135
Isovalerate	0.21	0.21	0.20	0.085	0.981
Day 17
Acetate	22.8 a	12.8 b	24.1 a	5.10	0.008
Propionate	1.53	1.05	1.49	0.685	0.553
Butyrate	7.94 a	5.13 b	6.13 a,b	1.241	0.027
Isobutyrate	0.21	0.10	0.15	0.112	0.411
Valerate	0.38 a	0.20 b	0.27 a,b	0.062	0.004
Isovalerate	0.30	0.14	0.18	0.091	0.055

SEM, pooled standard error of the mean. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Significance was defined as p < 0.05, and 0.05 < p < 0.10 was considered as a tendency toward significance. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

). The propionate concentration on d 13 and isovalerate concentration on d 17 showed a tendency toward reduction (p < 0.10) in the APEC group compared to the CON group. The concentration of acetate on both d 13 and 17 in the XOS group was higher (p < 0.05) than that in the APEC group but did not differ (p > 0.05) from the CON group. Furthermore, the concentrations of butyrate and valerate on d 17 in the XOS group were not different (p > 0.05) from both the CON group and the APEC group.

3.7. Effect of XOS on the Relative Expression of Cecal E. coli Virulence Genes of Broilers Challenged by APEC

As displayed in

Table 11. Effect of xylooligosaccharide on the relative mRNA expression of virulence genes of cecal E. coli in broilers challenged by avian pathogenic Escherichia coli on d 13 and 17 ⁽¹⁾.

Items	CON (2)	APEC	XOS	SEM	p-Value (3)
Day 13
fimH	0.93 b	1.89 a	0.60 b	0.241	0.045
csgA	1.29	2.17	0.52	0.475	0.134
hycA	0.97 a,b	1.68 a	0.36 b	0.192	0.024
luxS	0.84	2.21	1.03	0.238	0.056
tolA	1.04	1.34	1.49	0.175	0.237
relA	0.88 b	3.17 a	0.84 b	0.521	0.006
ompR	1.16 b	2.84 a	0.95 b	0.412	0.024
Day 17
fimH	0.90 b	2.75 a	0.38 b	0.337	0.003
csgA	0.87 b	2.00 a	0.53 b	0.236	0.012
hycA	0.84	1.20	0.65	0.287	0.329
luxS	0.87	1.35	0.51	0.178	0.155
tolA	0.85	0.76	0.39	0.191	0.269
relA	1.01	1.73	0.67	0.367	0.153
ompR	1.00	0.97	0.67	0.137	0.141

SEM, pooled standard error of the mean; fimH, fimbrillin H; csgA, curli subunit gene A; hycA, formate hydrogenlyase regulator HycA gene; luxS, S-ribosylhomocysteine lyase; tolA, Tol/Pal system protein TolA gene; relA, (p)ppGpp synthetase gene; ompR, outer membrane protein R. ⁽¹⁾ Values are the mean of six replicates per treatment. ⁽²⁾ CON = control (broilers were free of challenge); APEC = broilers were challenged by avian pathogenic Escherichia coli from 7 to 12 d of age; XOS = APEC-challenged broilers supplemented with 1600 mg/kg xylooligosaccharide. ⁽³⁾ Statistical significance was determined at p < 0.05, and trends (tendencies toward significant effects) were measured at 0.05 < p < 0.10. ^a,b Values within a row with different superscript letters differ significantly (p < 0.05).

, the cecal E. coli of broilers in the APEC group showed increases (p < 0.05) in relA and ompR expression on d 13 together with fimH and csgA expression on d 17 compared with those in the CON group. Supplementing XOS to challenged broilers restored the above parameters to the same levels (p > 0.05) as those in the CON group. Furthermore, the XOS group had a lower (p < 0.05) expression of fimH and hycA along with a tendency toward lower (p < 0.10) expression of luxS of cecal E. coli on d 13 when compared with the APEC group.

4. Discussion

Consistent with a previous report [4] that revealed the detrimental effects of the APEC challenge on the growth performance of broilers, the present study showed that an APEC challenge caused reduced FBW and ADG during both 1–13 and 1–17 d of age concurrent with increased FCR during 1–13 d of age without alteration of ADFI in broilers. These results suggest that the poor growth of broilers induced by APEC was likely due to the detected intestinal disruption instead of a reduction in appetite. It has been reported that XOS supplementation could improve the growth performance of broilers [12]. However, contrasting results were also described elsewhere [23,24]. The discrepancies might originate from the differences in the amount of XOS added and the health status of the chickens. In this study, the addition of XOS to diets reversed the decline in growth performance induced by an APEC challenge, which could be partly attributed to the observed effect of XOS in mitigating the APEC-induced intestinal disruption of broilers.

Intestinal colonization of APEC is essential for colonization, invasion and damage to intestinal and extra-intestinal tissues of chickens [25]. Our study revealed that oral administration of APEC O78 increased its colonization of intestinal tissues in broilers, while an XOS addition reduced its colonization in the intestine on d 13 and d 17. Those findings indicated the use of XOS against intestinal colonization of APEC in broilers. Similarly, other researchers reported that feeding XOS reduced intestinal colonization of Salmonella in mice by enriching Bifidobacterium in the intestine [7]. Alternatively, XOS might repress adhesion-related gene expression in bacteria. This hypothesis is somewhat supported by the current findings on cecal E. coli virulence genes’ expression as well as by some previous studies [11], thus supporting that there is reduced intestinal colonization of APEC in broilers that were fed with XOS.

Intestinal histological morphology serves as an indicator of intestinal health. The elongation of intestinal villi increases their surface area, which enhances absorption, strengthens the barrier function and improves the growth performance of animals [4,26]. Impaired intestinal morphology, along with a slow turnover of enterocytes, occurred in broilers during APEC invasion [27]. Likewise, we found that the APEC challenge tended to decrease VH and reduced the CD of jejunum in broilers on d 13, implying compromises of development and turnover of intestinal villi by the APEC challenge. Increasing evidence has demonstrated the benefits of XOS in the intestinal morphological structure of broilers [23,24]. In the present study, the XOS addition tended to increase jejunal VH on d 13 as well as elevating both the VH and CD of the jejunum in APEC-challenged broilers on d 17. These results indicated that the addition of XOS could protect intestinal epithelia, maintain the development of the crypt–villus and repair intestinal villi [26].

Goblet cells are capable of secreting a variety of functional proteins (e.g., mucin-2) that help maintain the intestinal barrier and prevent colonization by pathogenic bacteria [28]. Similar to the previous report, this study observed reductions in jejunal goblet cell count and the density of broilers on d 17 due to an APEC challenge [29]. On the other hand, adding XOS to challenged broilers enhanced the density of jejunal goblet cells on day 13 and offset the decreases in both count and density on day 17, indicating that dietary XOS could potentially shield the intestinal mucosal barrier against an APEC challenge by promoting the growth of goblet cells. This is consistent with the elevation of Lactobacillus and SCFAs in the cecum, which is thought to promote mucin-2 expression [30]. Analogous results were reported in previous studies regarding chickens under unchallenged conditions [23]. Because prebiotics can improve the intestinal histomorphology of animals in a microbiota-associated manner, we hypothesized that the reduced jejunal colonization of APEC due to the XOS addition could partially explain the observed enhancements in intestinal morphology, goblet cell count and density in broilers fed with XOS [24].

Intraepithelial TJ is composed of various proteins, including transmembrane proteins (such as claudin-1 and occludin) and linker proteins (such as ZO-1), which are implicated in maintaining intestinal integrity against paracellular penetration of pathogen-related factors from the intestinal lumen. Thus, they serve as a crucial defense line against enteric infections [31]. In line with a previous study [27], this study revealed minimal changes in the expression of jejunal TJ proteins in broilers following an APEC challenge. Supplementing XOS to challenged broilers improved their intestinal integrity, as evidenced by an increased expression of occludin in the jejunum on both d 13 and 17, along with increased expression of ZO-1 on d 17. Similar results were reported in previous studies, where the addition of XOS fortified intestinal integrity by increasing the expression of specific TJ proteins in chickens [23].

The disruptions in the intestinal structure of chickens due to an APEC challenge are established to be linked with intestinal inflammation [22]. On the one hand, inflammatory cytokine-mediated inflammation benefits the recruitment of phagocytes to clear pathogens, especially at the early stage of infection [32]. On the other hand, sustained inflammation contributes to bacteria-related intestinal injury [33]. There can be varying responses of intestinal inflammatory cytokine expression profiles in broilers to bacterial challenges that likely depend on the time-points post-challenge and the intricate immune feedback of the host [19]. Indeed, we found that the APEC challenge had a complex effect on the expression of jejunal inflammatory cytokines, as evidenced by a time-dependent change in their expression profile. It was possible that the downregulation of TNF-α, a multifunctional cytokine that enhances the host immune response against pathogens [34], in challenged broilers at an early stage of APEC infection (d 13) was unfavorable for eliminating the invading bacteria in the intestine. In contrast, the upregulation of IL-6 and IL-8 at a later stage of APEC infection (d 17) was assumed to contribute to the detected damage of the intestinal histomorphology in broilers [22]. It has been shown that feeding XOS attenuated intestinal inflammation in piglets by decreasing the expression of several inflammatory cytokines, such as TNF-α and IL-6 [35]. We observed that supplementing XOS to challenged broilers reversed the reduction in jejunal TNF-α expression on d 13 and lowered jejunal IL-1β expression on d 17, suggesting a potential of XOS addition in prompting elimination of intestinal pathogens (e.g., APEC) and alleviating intestinal inflammation in broilers at early and later stages of APEC infection, respectively.

The gut microbiota is involved in maintaining intestinal homeostasis and regulating pathological processes in broilers [19]. It has been indicated that APEC disrupt gut microbial composition in broilers, primarily characterized by an increased count of E. coli and a reduced count of Lactobacillus [25]. In this study, the APEC challenge elevated their abundance and reduced the Lactobacillus count in the cecum of broilers on d 13, demonstrating a negative shift in the cecal microbiota of broilers at an early stage of APEC infection. XOS stimulated beneficial bacteria such as Lactobacillus in the chicken gut [36]. We found that adding XOS to challenged broilers enhanced the numbers of cecal Lactobacillus as well as total bacteria on days 13 and 17. These results validated that an XOS addition optimized cecal microbial composition in broilers partially through the enrichment of Lactobacillus [23]. However, a contrasting finding was reported of no changes in cecal bacterial counts of broilers fed with XOS [37]. This inconsistency might be related to the variations in the quantity and duration of the XOS addition. Remarkably, it seemed that the observed increase in Lactobacillus upon the XOS addition was not sufficient to fully account for the simultaneous increase in total bacteria, suggesting the potential enrichment of others in broiler cecum [38].

SCFAs are the crucial metabolites during microbial fermentation of carbohydrates in the hindgut and mediate cross-talk between the host and gut microbes; furthermore, they maintain the health and growth of animals, primarily as a key energy component for enterocytes, thus sustaining intestinal renewal [8]. This study revealed reductions or decreasing trends of SCFAs in broilers’ responses to APEC. These findings suggested a disturbance in the cecal fermentation pattern in challenged broilers, which was plausibly related to the observed alteration of gut microbiota. Previously, feeding XOS increased cecal concentrations of certain SCFAs in chickens [24,38], although these results showed some variations. In this study, the XOS addition alleviated the APEC-induced reduction in the cecal acetate concentration in broilers on both d 13 and 17, concurrent with reductions in cecal butyrate and valerate concentrations in broilers on d 17, which were presumably associated with the stimulation of SCFA-producing bacteria [38]. These results supported the idea that dietary XOS protects the cecal fermentation pattern from the APEC challenge, in consideration of the abilities of SCFAs to regulate intestinal recovery and immunity, thus defending against bacterial invasion [8].

The cecum of chickens is considered a reservoir for E. coli virulence factors, whose expression is pivotal for their pathogenicity [1,22]. The upregulation of virulence genes has been indicated to aggravate intestinal disorders in broilers [1]. In this way, the fimH and csgA genes are, respectively, responsible for encoding an important subunit of fimbriae type Ι and curli, prompting adhesion, motility and biofilm formation, thus being prominent for establishing E. coli infection in chickens [1]. The hycA gene encodes a regulatory protein related to antibiotic resistance in E. coli [39]. The luxS gene encodes an enzyme impelling the synthesis of autoinducer-2, which can reinforce E. coli pathogenicity [1]. The tolA gene encodes a cytoplasmic membrane protein required for maintaining the outer membrane integrity of bacteria and, consequently, benefits the motility and adherence of E. coli [40]. The relA gene encodes a ribosome-associated enzyme that mediates the environmental sustainability of E. coli, and enhances its adhesion and survival [41]. The ompR acts as a response regulator in bacterial two-component systems, which can facilitate the growth and virulence of E. coli [1].

Despite a minor difference in amount, the expression profile of virulence genes in the cecal digesta differed across groups. We recorded an upregulation of fimH, hycA, relA and ompR on d 13 along with fimH and csgA on d 17 following the APEC challenge. These results evidenced a fortification of virulence genes within the cecum in APEC-challenged broilers, which coincided with the findings of Afridi [42]. Previous studies have observed the repressed expression of adhesin-related genes in Listeria [11] caused by XOS treatment in in vitro models. Herein, APEC-induced upregulations of cecal E. coli virulence factors relA and ompR expression on d 13, together with fimH and csgA expression on d 17 in broilers, were reversed by an XOS addition. These effects might be related to elevated concentrations of cecal SCFAs, which could inhibit the expression of E. coli O157 virulence factors [9]. The above findings uncovered an influential role of XOS in limiting E. coli virulence, which could diminish E. coli pathogenicity and thereby protect intestinal health in broilers challenged by APEC.

5. Conclusions

In this experiment with short duration, supplemental XOS attenuated growth retardation and intestinal disruption in APEC-challenged broilers at least partially by inhibiting APEC colonization of the intestine. Moreover, supplemental XOS mitigated APEC-induced perturbations of cecal microbiota and the fermentation product profile along with the increase in E. coli virulence, which might also contribute to protecting intestinal health in broilers challenged by APEC. The findings can expand our fundamental knowledge regarding the mechanisms of XOS in protecting the intestinal health of animals. Future experiments with long duration deserve to be conducted to confirm the above benefits of an XOS addition.