Nosema apis and Nosema ceranae in Beehives of the Apulian Region of Italy: How Citizen Science Can Support Scientific Research
Abstract
:1. Introduction
2. Material and Methods
2.1. Honeybee Colony Health Status Form
2.2. Sampling
2.3. Microscopic Investigation
2.4. DNA Extraction
2.5. Amplification by PCR and Booster PCR
2.6. Data Analysis
3. Results
3.1. Prevalence of Nosema ceranae and Nosema apis
3.2. Correlation between Beehive Health Status Form and Molecular Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, K.; Li, Y.; Sun, K.; Bao, J.; He, C.; Hou, X. Supplementary honeybee (Apis mellifera L.) pollination enhances fruit growth rate and fruit yield in Paeonia ostii (family: Paeoniaceae). PLoS ONE 2022, 17, e0272921. [Google Scholar] [CrossRef]
- The European Food Safety Authority Insect Pollinator Health. Insect Pollinator Health. 2023. Available online: https://www.efsa.europa.eu/en/topics/insect-pollinator-health (accessed on 30 October 2023).
- Neov, B.; Georgieva, A.; Shumkova, R.; Radoslavov, G.; Hristov, P. Biotic and Abiotic Factors Associated with Colonies Mortalities of Managed Honeybee (Apis mellifera). Diversity 2019, 11, 237. [Google Scholar] [CrossRef]
- Gray, A.; Adjlane, N.; Arab, A.; Ballis, A.; Brusbardis, V.; Bugeja Douglas, A.; Cadahía, L.; Charrière, J.-D.; Chlebo, R.; Coffey, M.F.; et al. Honeybee Colony Loss Rates in 37 Countries Using the COLOSS Survey for Winter 2019–2020: The Combined Effects of Operation Size, Migration and Queen Replacement. J. Apic. Res. 2023, 62, 204–210. [Google Scholar] [CrossRef]
- Marín-García, P.J.; Peyre, Y.; Ahuir-Baraja, A.E.; Garijo, M.M.; Llobat, L. The Role of Nosema Ceranae (Microsporidia: Nosematidae) in Honeybee Colony Losses and Current Insights on Treatment. Vet. Sci. 2022, 9, 130. [Google Scholar] [CrossRef] [PubMed]
- Tantillo, G.; Bottaro, M.; Di Pinto, A.; Martella, V.; Di Pinto, P.; Terio, V. Virus Infections of Honeybees Apis mellifera. Ital. J. Food Saf. 2015, 4, 5364. [Google Scholar] [CrossRef] [PubMed]
- de Figueiró Santos, J.; Coelho, F.C.; Bliman, P.-A. Behavioral Modulation of Infestation by Varroa destructor in Bee Colonies. Implications for Colony Stability. PLoS ONE 2016, 11, e0160465. [Google Scholar] [CrossRef]
- Okamoto, M.; Furuya, H.; Sugimoto, I.; Kusumoto, M.; Takamatsu, D. A Novel Multiplex PCR Assay to Detect and Distinguish between Different Types of Paenibacillus larvae and Melissococcus plutonius, and a Survey of Foulbrood Pathogen Contamination in Japanese Honey. J. Vet. Med. Sci. 2022, 84, 390–399. [Google Scholar] [CrossRef] [PubMed]
- Sulborska, A.; Horecka, B.; Cebrat, M.; Kowalczyk, M.; Skrzypek, T.H.; Kazimierczak, W.; Trytek, M.; Borsuk, G. Microsporidia Nosema spp.—Obligate Bee Parasites Are Transmitted by Air. Sci. Rep. 2019, 9, 14376. [Google Scholar] [CrossRef]
- Galajda, R.; Valenčáková, A.; Sučik, M.; Kandráčová, P. Nosema Disease of European Honeybees. J. Fungi 2021, 7, 714. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations. Nosemosis. 2015. Available online: https://www.fao.org/3/CA3136EN/ca3136en.pdf (accessed on 31 October 2023).
- Mazur, E.D.; Gajda, A.M. Nosemosis in Honeybees: A Review Guide on Biology and Diagnostic Methods. Appl. Sci. 2022, 12, 5890. [Google Scholar] [CrossRef]
- Antúnez, K.; Martín-Hernández, R.; Prieto, L.; Meana, A.; Zunino, P.; Higes, M. Immune suppression in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia). Environ. Microbiol 2009, 11, 2284–2290. [Google Scholar] [CrossRef]
- Iorizzo, M.; Letizia, F.; Ganassi, S.; Testa, B.; Petrarca, S.; Albanese, G.; Di Criscio, D.; De Cristofaro, A. Recent Advances in the Biocontrol of Nosemosis in Honeybees (Apis mellifera L.). J. Fungi 2022, 8, 424. [Google Scholar] [CrossRef] [PubMed]
- Higes, M.; Martín-Hernández, R.; Botías, C.; Bailón, E.G.; González-Porto, A.V.; Barrios, L.; del Nozal, M.J.; Bernal, J.L.; Jiménez, J.J.; Palencia, P.G.; et al. How Natural Infection by Nosema ceranae Causes Honeybee Colony Collapse. Environ. Microbiol. 2008, 10, 2659–2669. [Google Scholar] [CrossRef]
- Bordin, F.; Zulian, L.; Granato, A.; Caldon, M.; Colamonico, R.; Toson, M.; Trevisan, L.; Biasion, L.; Mutinelli, F. Presence of Known and Emerging Honeybee Pathogens in Apiaries of Veneto Region (Northeast of Italy) during Spring 2020 and 2021. Appl. Sci. 2022, 12, 2134. [Google Scholar] [CrossRef]
- Fries, I. Nosema ceranae in European Honeybees (Apis mellifera). J. Invertebr. Pathol. 2010, 103, S73–S79. [Google Scholar] [CrossRef]
- Papini, R.; Mancianti, F.; Canovai, R.; Cosci, F.; Rocchigiani, G.; Benelli, G.; Canale, A. Prevalence of the Microsporidian Nosema ceranae in Honeybee (Apis mellifera) Apiaries in Central Italy. Saudi J. Biol. Sci. 2017, 24, 979–982. [Google Scholar] [CrossRef] [PubMed]
- Donkersley, P.; Elsner-Adams, E.; Maderson, S. A One-Health Model for Reversing Honeybee (Apis mellifera L.) Decline. Vet. Sci. 2020, 7, 119. [Google Scholar] [CrossRef]
- OIE Nosemosis of Honeybees. In OIE Terrestrial Manual; 2018; pp. 744–749. Available online: https://www.woah.org/en/what-we-do/standards/codes-and-manuals/terrestrial-manual-online-access/ (accessed on 15 October 2023).
- Cersini, A.; Antognetti, V.; Giacomelli, A.; Puccica, S.; Pietropaoli, M.; Milito, M.; Cardeti, G.; Marchesi, U.; Maroni Ponti, A.; Pizzariello, M.; et al. Patologie rare: Un caso di Nosema apis in Italia. Apic. Ital. 2013, 9, 3–6. [Google Scholar]
- Bourgeois, A.L.; Rinderer, T.E.; Beaman, L.D.; Danka, R.G. Genetic Detection and Quantification of Nosema apis and N. ceranae in the Honeybee. J. Invertebr. Pathol. 2010, 103, 53–58. [Google Scholar] [CrossRef]
- Michalczyk, M.; Sokół, R.; Szczerba-Turek, A.; Bancerz-Kisiel, A. A Comparison of the Effectiveness of the Microscopic Method and the Multiplex PCR Method in Identifying and Discriminating the Species of Nosema spp. Spores in Worker Bees (Apis mellifera) from Winter Hive Debris. Pol. J. Vet. Sci. 2011, 14, 385–391. [Google Scholar] [CrossRef] [PubMed]
- Utuk, A.E.; Piskin, F.C.; Girisgin, A.O.; Selcuk, O.; Aydin, L. Microscopic and Molecular Detection of Nosema spp. in Honeybees of Turkey. Apidologie 2016, 47, 267–271. [Google Scholar] [CrossRef]
- Ferroglio, E.; Zanet, S.; Peraldo, N.; Tachis, E.; Trisciuoglio, A.; Laurino, D.; Porporato, M. Nosema ceranae Has Been Infecting Honeybees Apis mellifera in Italy since at Least 1993. J. Apic. Res. 2013, 52, 60–61. [Google Scholar] [CrossRef]
- Cilia, G.; Tafi, E.; Zavatta, L.; Caringi, V.; Nanetti, A. The Epidemiological Situation of the Managed Honeybee (Apis mellifera) Colonies in the Italian Region Emilia-Romagna. Vet. Sci. 2022, 9, 437. [Google Scholar] [CrossRef]
- Tosun, O.; Yaman, M. The Effects of Temperature and Humidity around the Beehives on the Distribution of Nosema ceranae, and Also Geographical and Seasonal Activity of the Infection in the Eastern Black Sea Region of Turkey. J. Environ. Sci. Eng. B 2016, 5, 513–522. [Google Scholar] [CrossRef]
- Fenoy, S.; Rueda, C.; Higes, M.; Martín-Hernández, R.; del Aguila, C. High-Level Resistance of Nosema ceranae, a Parasite of the Honeybee, to Temperature and Desiccation. Appl. Environ. Microbiol. 2009, 75, 6886–6889. [Google Scholar] [CrossRef] [PubMed]
- Bravo, J.; Carbonell, V.; Valdebenito, J.; Figueroa, C.; Valdovinos, C.; Martín-Hernández, R.; Higes, M.; Delporte, C. Identification of Nosema ceranae in the Valparaíso District, Chile. Arch. Med. Vet. 2014, 46, 487–491. [Google Scholar] [CrossRef]
- Botías, C.; Martín-Hernández, R.; Barrios, L.; Meana, A.; Higes, M. Nosema spp. Infection and Its Negative Effects on Honeybees (Apis mellifera Iberiensis) at the Colony Level. Vet. Res. 2013, 44, 25. [Google Scholar] [CrossRef] [PubMed]
- Mayack, C.; Naug, D. Parasitic Infection Leads to Decline in Hemolymph Sugar Levels in Honeybee Foragers. J. Insect. Physiol. 2010, 56, 1572–1575. [Google Scholar] [CrossRef] [PubMed]
- Naree, S.; Benbow, M.E.; Suwannapong, G.; Ellis, J.D. Mitigating Nosema Ceranae Infection in Western Honeybee (Apis mellifera) Workers Using Propolis Collected from Honeybee and Stingless Bee (Tetrigona Apicalis) Hives. J. Invertebr. Pathol. 2021, 185, 107666. [Google Scholar] [CrossRef] [PubMed]
- Kralj, J.; Fuchs, S. Nosema spp. Influences Flight Behavior of Infected Honey Bee (Apis mellifera) Foragers. Apidologie 2010, 41, 21–28. [Google Scholar] [CrossRef]
- Paris, L.; El Alaoui, H.; Delbac, F.; Diogon, M. Effects of the Gut Parasite Nosema ceranae on Honeybee Physiology and Behavior. Curr. Opin. Insect. Sci. 2018, 26, 149–154. [Google Scholar] [CrossRef] [PubMed]
- Seehuus, S.-C.; Norberg, K.; Gimsa, U.; Krekling, T.; Amdam, G.V. Reproductive Protein Protects Functionally Sterile Honeybee Workers from Oxidative Stress. Proc. Natl. Acad. Sci. USA 2006, 103, 962–967. [Google Scholar] [CrossRef] [PubMed]
- Badaoui, B.; Fougeroux, A.; Petit, F.; Anselmo, A.; Gorni, C.; Cucurachi, M.; Cersini, A.; Granato, A.; Cardeti, G.; Formato, G.; et al. RNA-Sequence Analysis of Gene Expression from Honeybees (Apis mellifera) Infected with Nosema ceranae. PLoS ONE 2017, 12, e0173438. [Google Scholar] [CrossRef] [PubMed]
- Goblirsch, M.; Huang, Z.Y.; Spivak, M. Physiological and Behavioral Changes in Honeybees (Apis mellifera) Induced by Nosema ceranae Infection. PLoS ONE 2013, 8, e58165. [Google Scholar] [CrossRef] [PubMed]
- Klee, J.; Besana, A.M.; Genersch, E.; Gisder, S.; Nanetti, A.; Tam, D.Q.; Chinh, T.X.; Puerta, F.; Ruz, J.M.; Kryger, P.; et al. Widespread Dispersal of the Microsporidian Nosema ceranae, an Emergent Pathogen of the Western Honeybee, Apis mellifera. J. Invertebr. Pathol. 2007, 96, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Presidential Decree No. 320 on Veterinary Police. Gazzetta Ufficiale della Repubblica Italiana No. 142 1954. Available online: https://www.gazzettaufficiale.it/atto/serie_generale/caricaDettaglioAtto/originario?atto.dataPubblicazioneGazzetta=1954-06-24&atto.codiceRedazionale=054U0320&elenco30giorni=false (accessed on 30 October 2023).
- Regulation (EU) 2016/429 of the European Parliament and of the Council of 9 March 2016 on transmissible animal diseases and amending and repealing certain acts in the area of animal health (‘Animal Health Law’). Off. J. Eur. Union 2016, L84, 1–208.
- Formato, G.; Rivera-Gomis, J.; Bubnic, J.; Martín-Hernández, R.; Milito, M.; Croppi, S.; Higes, M. Nosemosis Prevention and Control. Appl. Sci. 2022, 12, 783. [Google Scholar] [CrossRef]
- Shumkova, R.; Balkanska, R.; Hristov, P. The Herbal Supplements NOZEMAT HERB® and NOZEMAT HERB PLUS®: An Alternative Therapy for N. ceranae Infection and Its Effects on Honeybee Strength and Production Traits. Pathogens 2021, 10, 234. [Google Scholar] [CrossRef]
- Nanetti, A.; Rodriguez-García, C.; Meana, A.; Martín-Hernández, R.; Higes, M. Effect of Oxalic Acid on Nosema ceranae Infection. Res. Vet. Sci. 2015, 102, 167–172. [Google Scholar] [CrossRef]
- Jalbert, K.; Kinchy, A.J.; Perry, S.L. Civil Society Research and Marcellus Shale Natural Gas Development: Results of a Survey of Volunteer Water Monitoring Organizations. J. Environ. Stud. Sci. 2014, 4, 78–86. [Google Scholar] [CrossRef]
- Donnelly, A.; Crowe, O.; Regan, E.; Begley, S.; Caffarra, A. The Role of Citizen Science in Monitoring Biodiversity in Ireland. Int. J. Biometeorol. 2014, 58, 1237–1249. [Google Scholar] [CrossRef] [PubMed]
Species | Primer Sequences (5′-3′) | References |
---|---|---|
N. apis | For: GCCCTCCATAATAAGAGTGTCCAC Rev: ATCTCTCATCCCAAGAGCATTGC | [22] |
N. ceranae | For: AAGAGTGAGACCTATCAGCTAGTTG Rev: CCGTCTCTCAGGCTCCTTCTC | [22] |
Number of Samples | Number of Samples Tested Positive for Nosema spp. after Light Microscopy Analysis | |
---|---|---|
Province of Taranto | 12 | 9 |
Municipality of Castellaneta (TA) | 6 | 6 |
Municipality of Taranto (TA) | 3 | 0 |
Municipality of Mottola (TA) | 3 | 3 |
Province of Bari | 21 | 15 |
Municipality of Putignano (BA) | 6 | 6 |
Municipality of Valenzano (BA) | 12 | 6 |
Municipality of Castellana (BA) | 3 | 3 |
Province of Foggia | 12 | 12 |
Municipality of Ordona (FG) | 6 | 6 |
Municipality of Foggia (FG) | 6 | 6 |
Province of Brindisi | 3 | 1 |
Municipality of Cisternino (BR) | 3 | 1 |
TOTAL | 48 | 37 |
Number of Samples Tested Positive for Nosema ceranae | Number of Samples Tested Positive for Nosema apis | |
---|---|---|
Province of Taranto | 9 | 0 |
Municipality of Castellaneta (TA) | 6 | 0 |
Municipality of Taranto (TA) | 0 | 0 |
Municipality of Mottola (TA) | 3 | 0 |
Province of Bari | 15 | 0 |
Municipality of Putignano (BA) | 6 | 0 |
Municipality of Valenzano (BA) | 6 | 0 |
Municipality of Castellana (BA) | 3 | 0 |
Province of Foggia | 12 | 0 |
Municipality of Ordona (FG) | 6 | 0 |
Municipality of Foggia (FG) | 6 | 0 |
Province of Brindisi | 0 | 1 |
Municipality of Cisternino (BR) | 0 | 1 |
TOTAL | 36 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pandiscia, A.; Lorusso, P.; Manfredi, A.; Bonerba, E.; Bozzo, G.; Tantillo, G.M.; Terio, V. Nosema apis and Nosema ceranae in Beehives of the Apulian Region of Italy: How Citizen Science Can Support Scientific Research. Agriculture 2024, 14, 583. https://doi.org/10.3390/agriculture14040583
Pandiscia A, Lorusso P, Manfredi A, Bonerba E, Bozzo G, Tantillo GM, Terio V. Nosema apis and Nosema ceranae in Beehives of the Apulian Region of Italy: How Citizen Science Can Support Scientific Research. Agriculture. 2024; 14(4):583. https://doi.org/10.3390/agriculture14040583
Chicago/Turabian StylePandiscia, Annamaria, Patrizio Lorusso, Alessio Manfredi, Elisabetta Bonerba, Giancarlo Bozzo, Giuseppina M. Tantillo, and Valentina Terio. 2024. "Nosema apis and Nosema ceranae in Beehives of the Apulian Region of Italy: How Citizen Science Can Support Scientific Research" Agriculture 14, no. 4: 583. https://doi.org/10.3390/agriculture14040583