Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization
Abstract
:1. Introduction
2. Materials and Methods
2.1. Main Reagents and Consumables
2.2. Main Instruments and Equipment
2.3. Sample Preparation
2.4. Sample Characterization
2.4.1. Surface Morphology and Chemical Composition
2.4.2. Surface Roughness
2.4.3. Surface Hydrophilicity
2.5. Macrophages Adhesion, Proliferation and Polarization on Various Surfaces
2.5.1. Source and Cultivation of Macrophages
2.5.2. Cell Adhesion
2.5.3. Cell Morphology
2.5.4. Cell Proliferation
2.5.5. Proinflammatory and Pro-Restorative Gene Expression
2.6. Osteoblasts Behaviors on Different Surfaces with Macrophage Conditioned Medium
2.6.1. Preparation of Macrophage Conditioned Medium (CM)
2.6.2. Source and Cultivation of Osteoblasts
2.6.3. Osteoblast Adhesion
2.6.4. Cell Morphology
2.6.5. Cell Proliferation
2.6.6. Cells Differentiation and Mineralization
Alkaline Phosphatase Staining
Alizarin Red Staining
2.7. Statistical Analysis
3. Results
3.1. Sample Characterization
3.1.1. SEM Observation
3.1.2. EDS Analysis, Surface Roughness, and Hydrophilicity
3.2. Macrophage Behaviors on Different Surfaces
3.2.1. Cell Adhesion and Morphology
3.2.2. Cell Proliferation and Polarization
3.3. Osteoblasts Behaviors on Different Surfaces with Macrophage CM
3.3.1. Cell Adhesion and Morphology
3.3.2. Cell Proliferation, Differentiation and Mineralization
4. Discussion
4.1. Effect of Zirconia Surface on the Biological Behavior of Macrophages
4.2. Effects of Zirconia Surface to Promote Osteogenesis by Immunoregulation
4.3. Current Limitations and Future Perspectives
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kellesarian, S.V.; Yunker, M.; Ramakrishnaiah, R.; Malmstrom, H.; Kellesarian, T.V.; Ros Malignaggi, V.; Javed, F. Does incorporating zinc in titanium implant surfaces influence osseointegration? A systematic review. J. Prosthet. Dent. 2017, 117, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Evrard, L.; Waroquier, D.; Parent, D. Allergies to dental metals. Titanium: A new allergen. Rev. Medicale Brux. 2010, 31, 44–49. [Google Scholar]
- Shah, R.; Penmetsa, D.S.L.; Thomas, R.; Mehta, D.S. Titanium Corrosion: Implications For Dental Implants. Eur. J. Prosthodont. Restor. Dent. 2016, 24, 171–180. [Google Scholar] [CrossRef] [PubMed]
- Sivaraman, K.; Chopra, A.; Narayan, A.I.; Balakrishnan, D. Is zirconia a viable alternative to titanium for oral implant? A critical review. J. Prosthodont. Res. 2018, 62, 121–133. [Google Scholar] [CrossRef]
- Hilgenfeld, T.; Prager, M.; Schwindling, F.S.; Heil, A.; Kuchenbecker, S.; Rammelsberg, P.; Bendszus, M.; Heiland, S. Artefacts of implant-supported single crowns—Impact of material composition on artefact volume on dental MRI. Eur. J. Oral Implantol. 2016, 9, 301–308. [Google Scholar]
- Traini, T.; Pettinicchio, M.; Murmura, G.; Varvara, G.; Di Lullo, N.; Sinjari, B.; Caputi, S. Esthetic outcome of an immediately placed maxillary anterior single-tooth implant restored with a custom-made zirconia-ceramic abutment and crown: A staged treatment. Quintessence Int. 2011, 42, 103–108. [Google Scholar]
- Cionca, N.; Hashim, D.; Mombelli, A. Zirconia dental implants: Where are we now, and where are we heading? Periodontol. 2000 2017, 73, 241–258. [Google Scholar] [CrossRef]
- Hanawa, T. Zirconia versus titanium in dentistry: A review. Dent. Mater. J. 2020, 39, 24–36. [Google Scholar] [CrossRef]
- de Avila, E.D.; Avila-Campos, M.J.; Vergani, C.E.; Spolidorio, D.M.; Mollo Fde, A., Jr. Structural and quantitative analysis of a mature anaerobic biofilm on different implant abutment surfaces. J. Prosthet. Dent. 2016, 115, 428–436. [Google Scholar] [CrossRef]
- Att, W.; Takeuchi, M.; Suzuki, T.; Kubo, K.; Anpo, M.; Ogawa, T. Enhanced osteoblast function on ultraviolet light-treated zirconia. Biomaterials 2009, 30, 1273–1280. [Google Scholar] [CrossRef]
- Han, J.; Zhao, J.; Shen, Z. Zirconia ceramics in metal-free implant dentistry. Adv. Appl. Ceram. 2016, 116, 138–150. [Google Scholar] [CrossRef]
- Camposilvan, E.; Leone, R.; Gremillard, L.; Sorrentino, R.; Zarone, F.; Ferrari, M.; Chevalier, J. Aging resistance, mechanical properties and translucency of different yttria-stabilized zirconia ceramics for monolithic dental crown applications. Dent. Mater. 2018, 34, 879–890. [Google Scholar] [CrossRef] [PubMed]
- Yadav, R.; Saini, S.; Sonwal, S.; Meena, A.; Huh, Y.S.; Brambilla, E.; Ionescu, A.C. Optimization and ranking of dental restorative composites by ENTROPY-VIKOR and VIKOR-MATLAB. Polym. Adv. Technol. 2024, 35, e6526. [Google Scholar] [CrossRef]
- Han, J.M.; Hong, G.; Lin, H.; Shimizu, Y.; Wu, Y.; Zheng, G.; Zhang, H.; Sasaki, K. Biomechanical and histological evaluation of the osseointegration capacity of two types of zirconia implant. Int. J. Nanomed. 2016, 11, 6507–6516. [Google Scholar] [CrossRef] [PubMed]
- Saini, S.; Yadav, R.; Sonwal, S.; Meena, A.; Huh, Y.S.; Brambilla, E.; Ionescu, A.C. Tribological, mechanical, and thermal properties of nano tricalcium phosphate and silver particulates reinforced Bis-GMA/TEGDMA dental resin composites. Tribol. Int. 2024, 199, 110010. [Google Scholar] [CrossRef]
- Chen, B.; Wang, W.; Hu, M.; Liang, Y.; Wang, N.; Li, C.; Li, Y. “Photo-Thermo-Electric” Dental Implant for Anti-Infection and Enhanced Osteoimmunomodulation. ACS Nano 2024, 18, 24968–24983. [Google Scholar] [CrossRef]
- Chen, B.; You, Y.; Ma, A.; Song, Y.; Jiao, J.; Song, L.; Shi, E.; Zhong, X.; Li, Y.; Li, C. Zn-Incorporated TiO2 Nanotube Surface Improves Osteogenesis Ability Through Influencing Immunomodulatory Function of Macrophages. Int. J. Nanomed. 2020, 15, 2095–2118. [Google Scholar] [CrossRef]
- Chen, B.; Liang, Y.; Song, Y.; Liang, Y.; Jiao, J.; Bai, H.; Li, Y. Photothermal-Controlled Release of IL-4 in IL-4/PDA-Immobilized Black Titanium Dioxide (TiO2) Nanotubes Surface to Enhance Osseointegration: An In Vivo Study. Materials 2022, 15, 5962. [Google Scholar] [CrossRef]
- Nawa, M.; Nakamoto, S.; Sekino, T.; Niihara, K. Tough and strong Ce-TZP/Alumina nanocomposites doped with titania. Ceram. Int. 1998, 24, 497–506. [Google Scholar] [CrossRef]
- Sato, H.; Yamada, K.; Pezzotti, G.; Nawa, M.; Ban, S. Mechanical properties of dental zirconia ceramics changed with sandblasting and heat treatment. Dent. Mater. J. 2008, 27, 408–414. [Google Scholar] [CrossRef]
- Yamashita, D.; Machigashira, M.; Miyamoto, M.; Takeuchi, H.; Noguchi, K.; Izumi, Y.; Ban, S. Effect of surface roughness on initial responses of osteoblast-like cells on two types of zirconia. Dent. Mater. J. 2009, 28, 461–470. [Google Scholar] [CrossRef] [PubMed]
- Ban, S. Reliability and properties of core materials for all-ceramic dental restorations. Jpn. Dent. Sci. Rev. 2008, 44, 3–21. [Google Scholar] [CrossRef]
- Han, J.M.; Hong, G.; Matsui, H.; Shimizu, Y.; Zheng, G.; Lin, H.; Sasaki, K. The surface characterization and bioactivity of NANOZR in vitro. Dent. Mater. J. 2014, 33, 210–219. [Google Scholar] [CrossRef] [PubMed]
- Komasa, S.; Takao, S.; Yang, Y.; Zeng, Y.; Li, M.; Yan, S.; Zhang, H.; Komasa, C.; Kobayashi, Y.; Nishizaki, H.; et al. Effects of UV Treatment on Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANOZR). Materials 2020, 13, 2772. [Google Scholar] [CrossRef] [PubMed]
- Komasa, S.; Nishizaki, M.; Zhang, H.; Takao, S.; Yin, D.; Terada, C.; Kobayashi, Y.; Kusumoto, T.; Yoshimine, S.; Nishizaki, H.; et al. Osseointegration of Alkali-Modified NANOZR Implants: An In Vivo Study. Int. J. Mol. Sci. 2019, 20, 842. [Google Scholar] [CrossRef]
- Takao, S.; Komasa, S.; Agariguchi, A.; Kusumoto, T.; Pezzotti, G.; Okazaki, J. Effects of Plasma Treatment on the Bioactivity of Alkali-Treated Ceria-Stabilised Zirconia/Alumina Nanocomposite (NANOZR). Int. J. Mol. Sci. 2020, 21, 7476. [Google Scholar] [CrossRef]
- Liu, J.; Hong, G.; Wu, Y.H.; Endo, K.; Han, J.M.; Kumamoto, H.; Wada, T.; Kato, H.; Gao, P.; Sasaki, K. A novel method of surface modification by electrochemical deoxidation: Effect on surface characteristics and initial bioactivity of zirconia. J. Biomed. Mater. Res. Part B Appl. Biomater. 2017, 105, 2641–2652. [Google Scholar] [CrossRef]
- Bai, L.; Du, Z.; Du, J.; Yao, W.; Zhang, J.; Weng, Z.; Liu, S.; Zhao, Y.; Liu, Y.; Zhang, X.; et al. A multifaceted coating on titanium dictates osteoimmunomodulation and osteo/angio-genesis towards ameliorative osseointegration. Biomaterials 2018, 162, 154–169. [Google Scholar] [CrossRef]
- Zhang, Q.; Hwang, J.W.; Oh, J.H.; Park, C.H.; Chung, S.H.; Lee, Y.S.; Baek, J.H.; Ryoo, H.M.; Woo, K.M. Effects of the fibrous topography-mediated macrophage phenotype transition on the recruitment of mesenchymal stem cells: An in vivo study. Biomaterials 2017, 149, 77–87. [Google Scholar] [CrossRef]
- Zhao, Y.; Bai, L.; Zhang, Y.; Yao, R.; Sun, Y.; Hang, R.; Chen, X.; Wang, H.; Yao, X.; Xiao, Y.; et al. Type I collagen decorated nanoporous network on titanium implant surface promotes osseointegration through mediating immunomodulation, angiogenesis, and osteogenesis. Biomaterials 2022, 288, 121684. [Google Scholar] [CrossRef]
- Chen, M.; Huang, L.; Shen, X.; Li, M.; Luo, Z.; Cai, K.; Hu, Y. Construction of multilayered molecular reservoirs on a titanium alloy implant for combinational drug delivery to promote osseointegration in osteoporotic conditions. Acta Biomater. 2020, 105, 304–318. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Yuen, J.; Crawford, R.; Chang, J.; Wu, C.; Xiao, Y. The effect of osteoimmunomodulation on the osteogenic effects of cobalt incorporated β-tricalcium phosphate. Biomaterials 2015, 61, 126–138. [Google Scholar] [CrossRef] [PubMed]
- Bormann, K.H.; Gellrich, N.C.; Kniha, H.; Schild, S.; Weingart, D.; Gahlert, M. A prospective clinical study to evaluate the performance of zirconium dioxide dental implants in single-tooth edentulous area: 3-year follow-up. BMC Oral Health 2018, 18, 181. [Google Scholar] [CrossRef] [PubMed]
- Depprich, R.; Zipprich, H.; Ommerborn, M.; Naujoks, C.; Wiesmann, H.P.; Kiattavorncharoen, S.; Lauer, H.C.; Meyer, U.; Kubler, N.R.; Handschel, J. Osseointegration of zirconia implants compared with titanium: An in vivo study. Head Face Med. 2008, 4, 30. [Google Scholar] [CrossRef]
- Sun, Y.; Sun, J.; Wu, X.; Li, Y.; Li, X.; Li, R.; Wang, T.; Bi, W.; Cui, W.; Yu, Y. Mechanism of zirconia microgroove surface structure for osseointegration. Mater. Today Adv. 2021, 12, 100159. [Google Scholar] [CrossRef]
- Fischer, J.; Schott, A.; Mrtin, S. Surface micro-structuring of zirconia dental implants. Clin. Oral Implant. Res. 2016, 27, 162–166. [Google Scholar] [CrossRef]
- Henningsen, A.; Smeets, R.; Heuberger, R.; Jung, O.T.; Hanken, H.; Heiland, M.; Cacaci, C.; Precht, C. Changes in surface characteristics of titanium and zirconia after surface treatment with ultraviolet light or non-thermal plasma. Eur. J. Oral Sci. 2020, 126, 126–134. [Google Scholar] [CrossRef]
- Carinci, F.; Pezzetti, F.; Volinia, S.; Francioso, F.; Arcelli, D.; Farina, E.; Piattelli, A. Zirconium oxide: Analysis of MG63 osteoblast-like cell response by means of a microarray technology. Biomaterials 2004, 25, 215–228. [Google Scholar] [CrossRef]
- Mukaddam, K.; Ruggiero, S.; Berger, S.M.; Cholewa, D.; Kuhl, S.; Vegh, D.; Payer, M.; Bornstein, M.M.; Alhawasli, F.; Fasler-Kan, E. Cytokines Activate JAK-STAT Signaling Pathway in MG-63 Cells on Titanium and Zirconia. Materials 2022, 15, 5621. [Google Scholar] [CrossRef]
- Wang, X.; Liu, W.; Yu, X.; Wang, B.; Xu, Y.; Yan, X.; Zhang, X. Advances in surface modification of tantalum and porous tantalum for rapid osseointegration: A thematic review. Front. Bioeng. Biotechnol. 2022, 10, 983695. [Google Scholar] [CrossRef]
- Li, Y.; Xiao, Y.; Liu, C. The Horizon of Materiobiology: A Perspective on Material-Guided Cell Behaviors and Tissue Engineering. Chem. Rev. 2017, 117, 4376–4421. [Google Scholar] [CrossRef] [PubMed]
- Horwood, N.J. Macrophage Polarization and Bone Formation: A review. Clin. Rev. Allergy Immunol. 2016, 51, 79–86. [Google Scholar] [CrossRef] [PubMed]
- Bai, L.; Liu, Y.; Du, Z.; Weng, Z.; Yao, W.; Zhang, X.; Huang, X.; Yao, X.; Crawford, R.; Hang, R.; et al. Differential effect of hydroxyapatite nano-particle versus nano-rod decorated titanium micro-surface on osseointegration. Acta Biomater. 2018, 76, 344–358. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Shen, Z.; Zhou, Y.; Zhou, Y.H.; Zhou, J.Y.; Qian, X.N.; Wei, Y.W.; Qiu, J. Osteogenic and anti-inflammatory effects of SLA titanium substrates doped with chitosan-stabilized selenium nanoparticles via a covalent coupling strategy. Colloids Surf. B Biointerfaces 2023, 224, 113217. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Fang, J.; Pan, J.; Qi, H.; Yin, Y.; He, Y.; Gan, X.; Li, Y.; Li, Y.; Guo, J. Zinc finger-inspired peptide-metal-phenolic nanointerface enhances bone-implant integration under bacterial infection microenvironment through immune modulation and osteogenesis promotion. Bioact. Mater. 2024, 41, 564–576. [Google Scholar] [CrossRef]
- Anselme, K. Osteoblast adhesion on biomaterials. Biomaterials 2000, 21, 667–681. [Google Scholar] [CrossRef]
- Sunarso; Toita, R.; Tsuru, K.; Ishikawa, K. A superhydrophilic titanium implant functionalized by ozone gas modulates bone marrow cell and macrophage responses. J. Mater. Sci. Mater. Med. 2016, 27, 127. [Google Scholar] [CrossRef]
- Shu, Y.; Li, K.; Li, J.; Ding, Y.; Yang, G.; Zheng, X. Ferrocene-functionalized polydopamine film timely mediates M1-to-M2 macrophage polarization through adaptive wettability. Colloids Surf. B Biointerfaces 2024, 236, 113825. [Google Scholar] [CrossRef]
- Webster, T.J.; Ergun, C.; Doremus, R.H.; Siegel, R.W.; Bizios, R. Enhanced functions of osteoblasts on nanophase ceramics. Biomaterials 2000, 21, 1803–1810. [Google Scholar] [CrossRef]
- Ma, A.; You, Y.; Chen, B.; Wang, W.; Liu, J.; Qi, H.; Liang, Y.; Li, Y.; Li, C. Icariin/Aspirin Composite Coating on TiO2 Nanotubes Surface Induce Immunomodulatory Effect of Macrophage and Improve Osteoblast Activity. Coatings 2020, 10, 427. [Google Scholar] [CrossRef]
- Zhang, Y.; Lei, H.; Wang, P.; Zhou, Q.; Yu, J.; Leng, X.; Ma, R.; Wang, D.; Dong, K.; Xing, J.; et al. Restoration of dysregulated intestinal barrier and inflammatory regulation through synergistically ameliorating hypoxia and scavenging reactive oxygen species using ceria nanozymes in ulcerative colitis. Biomater. Res. 2023, 27, 75. [Google Scholar] [CrossRef] [PubMed]
- Jiang, C.; Shi, Q.; Yang, J.; Ren, H.; Zhang, L.; Chen, S.; Si, J.; Liu, Y.; Sha, D.; Xu, B.; et al. Ceria nanozyme coordination with curcumin for treatment of sepsis-induced cardiac injury by inhibiting ferroptosis and inflammation. J. Adv. Res. 2024, 63, 159–170. [Google Scholar] [CrossRef] [PubMed]
- Taira, M.; Kagiya, T.; Harada, H.; Sasaki, M.; Kimura, S.; Narushima, T.; Nezu, T.; Araki, Y. Microscopic observations and inflammatory cytokine productions of human macrophage phagocytising submicron titanium particles. J. Mater. Sci. Mater. Med. 2010, 21, 267–275. [Google Scholar] [CrossRef] [PubMed]
- Kheder, W.; Al Kawas, S.; Khalaf, K.; Samsudin, A.R. Impact of tribocorrosion and titanium particles release on dental implant complications—A narrative review. Jpn. Dent. Sci. Rev. 2021, 57, 182–189. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Zhang, S.; Chen, L.J.; Zou, H.X.; Wang, Y.N.; Xia, H.B. Early soft tissue response to zirconium oxide and titanium healing abutments in vivo: A study in dogs. BMC Oral Health 2021, 21, 416. [Google Scholar] [CrossRef]
- Hou, Y.; Xie, W.; Yu, L.; Camacho, L.C.; Nie, C.; Zhang, M.; Haag, R.; Wei, Q. Surface Roughness Gradients Reveal Topography-Specific Mechanosensitive Responses in Human Mesenchymal Stem Cells. Small 2020, 16, e1905422. [Google Scholar] [CrossRef]
- Long, E.G.; Buluk, M.; Gallagher, M.B.; Schneider, J.M.; Brown, J.L. Human mesenchymal stem cell morphology, migration, and differentiation on micro and nano-textured titanium. Bioact. Mater. 2019, 4, 249–255. [Google Scholar] [CrossRef]
- Boyan, B.D.; Cheng, A.; Olivares-Navarrete, R.; Schwartz, Z. Implant Surface Design Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv. Dent. Res. 2016, 28, 10–17. [Google Scholar] [CrossRef]
- Hotchkiss, K.M.; Reddy, G.B.; Hyzy, S.L.; Schwartz, Z.; Boyan, B.D.; Olivares-Navarrete, R. Titanium surface characteristics, including topography and wettability, alter macrophage activation. Acta Biomater. 2016, 31, 425–434. [Google Scholar] [CrossRef]
- Luu, T.U.; Gott, S.C.; Woo, B.W.K.; Rao, M.P.; Liu, W.F. Micro- and Nanopatterned Topographical Cues for Regulating Macrophage Cell Shape and Phenotype. ACS Appl. Mater. Interfaces 2015, 7, 28665–28672. [Google Scholar] [CrossRef]
- Shirazi, S.; Ravindran, S.; Cooper, L.F. Topography-mediated immunomodulation in osseointegration; Ally or Enemy. Biomaterials 2022, 291, 121903. [Google Scholar] [CrossRef] [PubMed]
- Bai, L.; Wu, R.; Wang, Y.; Wang, X.; Zhang, X.; Huang, X.; Qin, L.; Hang, R.; Zhao, L.; Tang, B. Osteogenic and angiogenic activities of silicon-incorporated TiO2 nanotube arrays. J. Mater. Chem. B 2016, 4, 5548–5559. [Google Scholar] [CrossRef] [PubMed]
- Bose, S.; Roy, M.; Bandyopadhyay, A. Recent advances in bone tissue engineering scaffolds. Trends Biotechnol. 2012, 30, 546–554. [Google Scholar] [CrossRef] [PubMed]
- Gao, A.; Hang, R.; Huang, X.; Zhao, L.; Zhang, X.; Wang, L.; Tang, B.; Ma, S.; Chu, P.K. The effects of titania nanotubes with embedded silver oxide nanoparticles on bacteria and osteoblasts. Biomaterials 2014, 35, 4223–4235. [Google Scholar] [CrossRef] [PubMed]
- Mosser, D.M.; Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008, 8, 958–969. [Google Scholar] [CrossRef]
- Pandey, A.K.; Pati, F.; Mandal, D.; Dhara, S.; Biswas, K. In vitro evaluation of osteoconductivity and cellular response of zirconia and alumina based ceramics. Mater. Sci. Eng. C Mater. Biol. Appl. 2013, 33, 3923–3930. [Google Scholar] [CrossRef]
- Bylski, D.; Wedemeyer, C.; Xu, J.; Sterner, T.; Löer, F.; von Knoch, M. Alumina ceramic particles, in comparison with titanium particles, hardly affect the expression of RANK-, TNF-alpha-, and OPG-mRNA in the THP-1 human monocytic cell line. J. Biomed. Mater. Res. Part A 2009, 89, 707–716. [Google Scholar] [CrossRef]
- Radziun, E.; Dudkiewicz Wilczyńska, J.; Książek, I.; Nowak, K.; Anuszewska, E.L.; Kunicki, A.; Olszyna, A.; Ząbkowski, T. Assessment of the cytotoxicity of aluminium oxide nanoparticles on selected mammalian cells. Toxicol. Vitr. 2011, 25, 1694–1700. [Google Scholar] [CrossRef]
- Flaherty, N.L.; Chandrasekaran, A.; del Pilar Sosa Peña, M.; Roth, G.A.; Brenner, S.A.; Begley, T.J.; Melendez, J.A. Comparative analysis of redox and inflammatory properties of pristine nanomaterials and commonly used semiconductor manufacturing nano-abrasives. Toxicol. Lett. 2015, 239, 205–215. [Google Scholar] [CrossRef]
- Taylor, A.J.; McClure, C.D.; Shipkowski, K.A.; Thompson, E.A.; Hussain, S.; Garantziotis, S.; Parsons, G.N.; Bonner, J.C. Atomic layer deposition coating of carbon nanotubes with aluminum oxide alters pro-fibrogenic cytokine expression by human mononuclear phagocytes in vitro and reduces lung fibrosis in mice in vivo. PLoS ONE 2014, 9, e106870. [Google Scholar] [CrossRef]
- Oshima, Y.; Iwasa, F.; Tachi, K.; Baba, K. Effect of Nanofeatured Topography on Ceria-Stabilized Zirconia/Alumina Nanocomposite on Osteogenesis and Osseointegration. Int. J. Oral Maxillofac. Implant. 2017, 32, 81–91. [Google Scholar] [CrossRef] [PubMed]
Code | Product Name | Composition | Density (g/cm3) | Hardness (Vickers) | Flexural Strength (MPa) | Fracture Toughness (MPa m1/2) | Elastic Modulus (GPa) | Manufacturer |
---|---|---|---|---|---|---|---|---|
NANO-Zr | P-NANO-Zr | 70 vol% 10 mol CeO2-ZrO2 30 vol% Al2O3 | 5.53 | 1160 | 1500 | 18 | 245 | Panasonic Health Care Co., Ltd. Tokyo, Japan |
3Y-TZP | Aadva Zr | 3 mol Y2O3-ZrO2 | 6.05 | 1250 | 1200 | 9.5 | 210 | GC Co., Ltd. Tokyo, Japan |
Ti | ASTM F67 unalloyed Ti, grade 2 | 99.7% titanium | - | - | - | - | - | Baoji Lian Zhong Titanium Metal Material Co., Ltd., Baoji, China |
Gene | DNA Primer | Sequence (5′ to 3′) |
---|---|---|
IL-6 | Forward | CCAGAGATACAAAGAAATGATGG |
Reverse | ACTCCAGAAGACCAGAGGAAAT | |
TNF-α | Forward | TGCCTATGTCTCAGCCTCTTC |
Reverse | GAGGCCATTTGGGAACTTCT | |
IL-10 | Forward | GCCAGAGCCACATGCTCCTA |
Reverse | GTCCAGCTGGTCCTTTGTTTG | |
TGF-β | Forward | TTGCTTCAGCTCCACAGAGA |
Reverse | TGGTTGTAGAGGGCAAGGAC | |
GAPDH | Forward | GGTGAAGGTCGGTGTGAACG |
Reverse | CTCGCTCCTGGAAGATGGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, Y.; Song, Y.; Lan, S.; Geng, R.; Wang, M.; Li, S.; Han, J.; Bai, H.; Hong, G.; Li, Y. Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization. Coatings 2024, 14, 1460. https://doi.org/10.3390/coatings14111460
Tian Y, Song Y, Lan S, Geng R, Wang M, Li S, Han J, Bai H, Hong G, Li Y. Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization. Coatings. 2024; 14(11):1460. https://doi.org/10.3390/coatings14111460
Chicago/Turabian StyleTian, Yuan, Yunjia Song, Suli Lan, Ruoting Geng, Muxiang Wang, Sanwen Li, Jianmin Han, Hong Bai, Guang Hong, and Ying Li. 2024. "Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization" Coatings 14, no. 11: 1460. https://doi.org/10.3390/coatings14111460
APA StyleTian, Y., Song, Y., Lan, S., Geng, R., Wang, M., Li, S., Han, J., Bai, H., Hong, G., & Li, Y. (2024). Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization. Coatings, 14(11), 1460. https://doi.org/10.3390/coatings14111460