Next Article in Journal
Correction: Chen et al. High-Sensitivity and -Stability Thin-Film Heat Flux Sensor Based on Transverse Thermoelectric Effect. Coatings 2023, 13, 1610
Next Article in Special Issue
Ag NP-Decorated Glass Surfaces for Sensing in Medical Applications
Previous Article in Journal
Study on Mechanism of Microstructure Refinement by Ultrasonic Cavitation Effect
Previous Article in Special Issue
Coated Biodegradable Zinc Lithium Alloys: Development and Characterization of Co-Doped Strontium Copper Tricalcium Phosphate Coating for Antimicrobial Applications
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization

1
Tianjin Key Laboratory of Oral Soft and Hard Tissues Restoration and Regeneration, School and Hospital of Stomatology, Tianjin Medical University, Tianjin 300070, China
2
Key Laboratory of Immune Microenvironment and Disease (Ministry of Education), Tianjin Institute of Immunology, Tianjin 300070, China
3
Tianjin Key Laboratory of Cellular and Molecular Immunology, Department of Immunology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin 300070, China
4
Liaison Center for Innovative Dentistry, Graduate School of Dentistry, Tohoku University, Sendai 980-8575, Japan
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Coatings 2024, 14(11), 1460; https://doi.org/10.3390/coatings14111460
Submission received: 18 October 2024 / Revised: 8 November 2024 / Accepted: 13 November 2024 / Published: 17 November 2024

Abstract

:
Zirconia implants are recognized for their excellent biocompatibility, aesthetics, and favorable mechanical properties. However, the effects of zirconia surfaces on osteogenesis, particularly in the presence of macrophages, are still not well understood. This study compares two types of zirconia surfaces—ceria-stabilized zirconia/alumina nanocomposite (NANO-Zr) and 3 mol% yttria-stabilized tetragonal zirconia polycrystal (3Y-TZP)—with titanium (Ti) substrates. Both zirconia surfaces promoted macrophage adhesion and proliferation, facilitated a shift from M1 to M2 polarization, and created an immune microenvironment conducive to osteogenesis by downregulating IL-6 and TNF-α and upregulating IL-10 and TGF-β gene expression. In macrophage co-cultures, both zirconia surfaces also supported osteoblast adhesion and proliferation, with NANO-Zr notably enhancing osteogenic differentiation and mineralization. These results highlight NANO-Zr as a promising candidate for future dental and orthopedic implant applications.

Graphical Abstract

1. Introduction

Dental implants have become a routine method for restoring missing teeth. For successful implant restoration, achieving initial stability and rapid osseointegration are critical factors [1]. Titanium (Ti) implants, which possess excellent mechanical properties and biocompatibility, are currently considered the “gold standard” material for dental implants. However, titanium implants present several issues, such as interference with magnetic resonance examination, metal allergies in certain populations, micro-galvanic effects, and gradual loss of corrosion resistance [2,3,4,5]. In addition, the dark color of titanium may show through thin gingival tissues at implant sites, posing aesthetic risks for patients with a thin gingival biotype [6].
Zirconia implants, on the other hand, have gained widespread attention for their excellent biocompatibility, superior aesthetics, high mechanical strength, and resistance to bacterial adhesion. They avoid the potential risks associated with titanium implants, such as MRI interference, metal ion-induced allergic reactions, and micro-galvanic effects [5,7,8,9]. Therefore, zirconia is considered one of the most commonly used implant materials after titanium. As the primary oxide of zirconium, zirconia exists in three crystalline phases: monoclinic, tetragonal, and cubic [10], of which tetragonal polycrystalline zirconia is the most widely researched zirconia implant material [11]. To achieve stability at room temperature, zirconia is often mixed with other metal oxides such as yttria, ceria, and alumina. Commonly used in crown restoration, dental restorative composite resins, and implants, 3 mol% yttria-stabilized tetragonal zirconia polycrystals (3Y-TZP), referred to as yttria-stabilized zirconia, is a type of tetragonal polycrystalline zirconia characterized by low porosity, high density, and strong compressive and flexural strength [11,12,13]. However, compared to titanium implants, 3Y-TZP has slightly lower mechanical properties and is prone to low-temperature degradation (LTD), leading to a higher risk of fracture and potential implant failure [14].
Moreover, nano-structured composite materials show promising potential in the dental field [15,16,17,18]. Nawa et al. developed a ceria-stabilized zirconia/alumina nanocomposite (NANO-Zr), with cerium-stabilized tetragonal zirconia polycrystals (Ce-TZP) as the base material combining with nanoscale polycrystalline alumina Al2O3 [19,20]. Studies have shown that compared to yttria-stabilized zirconia, nanometer zirconia not only inhibits low-temperature degradation [21] but also has higher flexural strength, fracture toughness, better thermal stability, and long-term stability [22,23]. Therefore, nanometer zirconia implants may offer a new treatment option for patients with metal allergies or high aesthetic demands.
Previous studies have found that osteoblasts can adhere well to zirconia surfaces and undergo osteogenic differentiation, achieving bone integration similar to that on titanium surfaces [8]. However, most existing studies focus on osteogenic-related cells, including bone marrow mesenchymal stem cells and osteoblasts [24,25,26,27]. While the osseointegration process after implant placement involves the participation of various cell types [28]. Recent research has revealed that the immune system plays a crucial role in implant osseointegration, with specific interactions between immune cells and osteoblasts [17]. After implant placement, immune cells first accumulate around the implant and regulate the immune response, subsequently promoting osteogenesis.
A variety of immune cells, cytokines, and chemokines interact with osteoblasts and osteoclasts to regulate bone formation and resorption, thus affecting osteointegration. Macrophages, as a key component of the immune system, are the first to colonize the implant surface after placement. They are extensively involved in the inflammatory response, recruiting osteoblasts and inducing their adhesion, proliferation, and differentiation [29]. Macrophages exhibit high plasticity and can become activated in response to different external stimuli, polarizing into either proinflammatory macrophages (M1) or pro-regenerative macrophages (M2). M1 macrophages assist Th1 cells in promoting inflammation by secreting proinflammatory cytokines such as interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α). While an appropriate early inflammatory response following implant placement is both unavoidable and essential for normal osteogenesis, prolonged inflammation mediated by M1 macrophages can inhibit osseointegration, reduce new bone formation, and promote the encapsulation of the implant with fibrous connective tissue [30]. In contrast, M2 macrophages secrete cytokines that promote tissue repair, such as interleukin-10 (IL-10) and transforming growth factor-beta (TGF-β), which induce osteoblast aggregation and new bone formation, promoting osseointegration. Therefore, timely polarization from the M1 inflammatory state to the M2 regenerative state can create a pro-osteogenic immune microenvironment, facilitating bone remodeling and differentiation, a process referred to as “osteoimmunomodulation” [31,32]. These findings underscore the critical role of the immune response in osteogenic differentiation.
Given the limited research on the role of immune responses in the osteogenesis of zirconia implants, elucidating the mechanisms by which the surface of zirconia implants regulates M2 macrophage polarization to promote osteogenesis holds significant theoretical and practical importance. In this study, we characterized the physicochemical properties of titanium (Ti), 3Y-TZP, and NANO-Zr samples. Then, the regulatory effects of different surfaces on macrophage polarization were compared. Finally, the osteogenic effects of co-culturing different materials with macrophages on osteoblasts were further investigated. We hypothesize that NANO-Zr surfaces can enhance the osteogenic potential of osteoblasts by improving the immunomodulatory function of macrophages.

2. Materials and Methods

2.1. Main Reagents and Consumables

Medically pure titanium (Ti) was purchased from Baoji Lian Zhong Titanium Metal Material Co., Ltd., Baoji, China; polishing sandpaper was acquired from MATADOR Sandpaper, Remscheid, Germany; Analytical grade acetone and absolute ethanol were purchased from Tianjin Fengchuan Chemical Reagent Technology Co., Ltd., Tianjin, China; 2.5% glutaraldehyde, 4% paraformaldehyde, PBS, penicillin-streptomycin solution, trypsin-EDTA, CCK-8 kit, Triton-X100, cetylpyridinium chloride, and ALP assay kit were purchased from Beyotime Biotech Inc., Shanghai, China; DMEM, and fetal bovine serum (FBS) were purchased from Gibco, Carlsbad, CA, USA; serum-free cell freezing solution, rhodamine-phalloidin, DAPI and TRnaZol RNA Kit were purchased from NewCell&Molecular Biotech Co., Ltd., Suzhou, China; All-In-One 5X RT Master Mix and SYBR Green I RT-PCR dye were purchased from Abm, Peterborough, ON, Canada; PCR primers were synthesized by Sangon Biotech, Shanghai, China; cell culture dishes, 24-well plates, cryovials, sterile centrifuge tubes, and disposable sterile pipettes were purchased from Wuxi NEST Biotechnology Co., Ltd., Wuxi, China; disposable nuclease-free transparent polypropylene tubes with caps, Roche 96-well plates, and nuclease-free pipette tips were purchased from Corning Inc., New York, NY, USA.

2.2. Main Instruments and Equipment

Cell incubator (Sanyo, Tokyo, Japan), biosafety cabinet (Beijing Donglian Har Instrument Manufacturing Co., Ltd., Beijing, China), inverted microscope (Olympus Corporation, Tokyo, Japan), high-speed centrifuge (Eppendorf, Hamburg, Germany), constant temperature water bath (Beijing Medical Equipment Factory Co., Ltd., Beijing, China), −80 °C freezer (Sanyo, Tokyo, Japan), 4 °C refrigerator (Qingdao Haier Co., Ltd., Qingdao, China), autoclave (Yamato Corporation, Sino-Japanese Joint Venture Co., Ltd., Chongqing, China); microplate reader (Bio-Tek, Minneapolis, MN, USA), scanning electron microscope for sample characterization (Hitachi, Tokyo, Japan), scanning electron microscope for cell behavior observation (Carl Zeiss AG, Oberkochen, Germany), energy-dispersive X-ray spectroscopy (Hitachi, Tokyo, Japan), surface profiler (Surfcom 480A, TOKYO SEIMITSU, Tokyo, Japan), dynamic contact angle detection system (PCA-1; Kyowa Interface Science, Niiza, Japan), laser confocal microscope (Carl Zeiss AG, Oberkochen, Germany), and real-time quantitative PCR instrument (Roche, Basel, Switzerland).

2.3. Sample Preparation

Disks measuring 15 mm in diameter and 1.5 mm in thickness, made of NANO-Zr (Panasonic Health Care Co, Tokyo, Japan), 3Y-TZP (GC Co, Tokyo, Japan), and Ti (Baoji Lian Zhong Titanium Metal Material Co., Ltd., Baoji, China), were used in this study. The 3Y-TZP and NANO-Zr samples were generously provided by the Laboratory of Prosthodontics at Tohoku University. Specifically, NANO-Zr powder (comprising 70 vol% 10 mol CeO2-ZrO2 and 30 vol% Al2O3) was processed into cylindrical rods (19.5 mm in diameter, 100 mm in length) through cold isostatic pressing, then fired at 1450 °C for two hours, and subsequently cut and milled with a diamond grinding wheel. Samples were polished sequentially with sandpaper (200#, 400#, 600#, and 800#) following a consistent polishing procedure and then ultrasonically cleaned in acetone, ethanol, and deionized water for 15 min each. After cleaning, samples were air-dried and stored in sealed containers for future use. Detailed sample information is provided in Table 1.

2.4. Sample Characterization

2.4.1. Surface Morphology and Chemical Composition

The surface morphology of the samples was observed by scanning electron microscopy (SEM, Hitachi, Tokyo, Japan). The chemical composition of the samples was detected by energy-dispersive X-ray spectroscopy (EDS).

2.4.2. Surface Roughness

The sample roughness of the samples was measured using a surface profiler. The trace length was set to 4 mm, with a cutoff value of 0.8 mm. The results were expressed as the arithmetic mean deviation of the profile (Ra value) and the ten-point height of the micro-irregularities (Rz value).

2.4.3. Surface Hydrophilicity

A dynamic contact angle detection system was used to measure the hydrophilicity of the sample surfaces in each group at room temperature using the water droplet method. Specifically, a drop of deionized water was gently placed on the surface of each sample, and once the droplet shape stabilized, the hydrophilicity was measured. The experiment was repeated three times.

2.5. Macrophages Adhesion, Proliferation and Polarization on Various Surfaces

2.5.1. Source and Cultivation of Macrophages

RAW 264.7 cells (American Type Culture Collection, ATCC, Manassas, VA, USA) were cultured in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin in a 5% CO2 incubator at 37 °C. All samples used for cell culture were sterilized with a 25 kGy dose of gamma radiation. The cells were seeded onto different samples in a 24-well plate at a density of 3 × 104 cells per well.

2.5.2. Cell Adhesion

RAW 264.7 cells were seeded on different samples at a density of 3 × 104/well. After seeding, the 24-well plates were placed in an incubator at 37 °C with 5% CO2. Two hours after inoculation, the cells were washed twice with PBS, and non-adhesive cells were counted to calculate the adhesion rate. The adhesion rate was determined using the following formula:
Adhesion rate (%) = (1 − non-adhesive cells/inoculation cells) × 100%.
After 1 day of culture, macrophages were fixed with 4% paraformaldehyde and permeabilized with 0.25%Triton X-100. The cytoskeleton and cell nuclei were stained with rhodamine-phalloidin and DAPI in the dark. After staining, the samples were sealed and stored in the dark. The nucleus and cytoskeleton were observed by laser confocal microscopy. The number of cells in three random areas was counted under a fluorescence microscope.

2.5.3. Cell Morphology

The growth morphology of RAW 264.7 cells was observed by scanning electron microscopy. RAW 264.7 cells were plated on different samples at a density of 3 × 104/well. After plating, the 24-well plates were placed in an incubator at 37 °C with 5%CO2. After 1 day of macrophage culture, the cells were maintained at 4 °C with 2.5% glutaraldehyde solution for 2 h to immobilize. The samples were then dehydrated in ethanol solution (30%, 50%, 75%, 90%, 95%, and 100%) sequentially. The morphology of the cells was observed by scanning electron microscopy (Carl Zeiss AG, Oberkochen, Germany).

2.5.4. Cell Proliferation

Cell proliferation was detected by cell counting kit-8 (CCK-8). RAW 264.7 cells were plated on different samples at a density of 3 × 104/well. After plating, the 24-well plates were placed in the incubator. After 1, 3, 5, and 7 days of macrophage culture, the supernatant was removed and 1 mL of freshly prepared medium containing 10% (v/v) CCK-8 reagent was added. After 90 min of incubation at 37 °C, the supernatant from each well was aspirated and transferred into a 96-well plate. The absorbance was then measured at 450 nm using a microplate reader.

2.5.5. Proinflammatory and Pro-Restorative Gene Expression

The RAW 264.7 cells seeded on the samples were extracted using the TRnaZol RNA Kit according to the user’s manual on day 3. RAW 264.7 mRNA genes for interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha), interleukin-10 (IL-10), and transforming growth factor-beta (TGF-beta) were chosen, and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. Reverse transcription and quantitative real-time polymerase chain reaction (qPCR) were performed. The results were calculated by the 2−ΔΔCt method. Primers for the target genes and the housekeeping gene are shown in Table 2.

2.6. Osteoblasts Behaviors on Different Surfaces with Macrophage Conditioned Medium

2.6.1. Preparation of Macrophage Conditioned Medium (CM)

RAW 264.7 cells were cultured onto different samples at a density of 3 × 104 cells/well, and supernatants from the sample surfaces were collected daily for 7 days. Then, the supernatants were separated at 1200 rpm for 10 min, and the new supernatant was collected. After collecting the new supernatant, it was filtered through a 0.22-μm filter. The filtered supernatant was mixed with fresh DMEM with 10% FBS and 1% penicillin/streptomycin at a proportion of 1:1 to get macrophage-conditioned medium (CM) and stored at 4 °C. The prepared conditioned medium was used for the first 7 days in this part of the experiment.

2.6.2. Source and Cultivation of Osteoblasts

MC3T3-E1 pre-osteoblasts (American Type Culture Collection, ATCC, Manassas, VA, USA) were cultured in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin in a 5% CO2 incubator at 37 °C. The cells were seeded onto different samples in a 24-well plate at a density of 3 × 104 cells per well.

2.6.3. Osteoblast Adhesion

After seeding on different samples, osteoblast cells were cultured for 1 day, then fixed with 4% paraformaldehyde and permeabilized with 0.25%Triton X-100. Rhodamine-phalloidin was used for cytoskeletal actin staining, and DAPI was used for nuclear staining. Laser scanning confocal microscopy was used for observation. After that, pictures were taken under a fluorescence microscope, and the number of cells in 3 random areas was automatically counted using Image J 1.52 (National Institutes of Health, Bethesda, MD, USA).

2.6.4. Cell Morphology

The morphology of MC3T3-E1 cells was observed by scanning electron microscopy. After 1 day of osteoblast seeding on different samples, the cells were cultured for 1 day and maintained at 4 °C for 2 h with 2.5% glutaraldehyde solution to fix the cells. The samples were then dehydrated in ethanol solution (30%, 50%, 75%, 90%, 95%, and 100%) sequentially. The morphology of the cells was observed by scanning electron microscopy (Carl Zeiss AG, Oberkochen, Germany).

2.6.5. Cell Proliferation

Cell counting kit-8 (CCK-8) was used to detect cell proliferation. After 1 day of osteoblast seeding on different samples, the culture was changed to a conditioned medium for 1, 3, 5, and 7 days. After 1, 3, 5, and 7 days of cell culture, the supernatant was removed and 1 mL of freshly prepared medium containing 10% (v/v) CCK-8 reagent was added. After 90 min of incubation at 37 °C, the medium was transferred to a new 96-well plate, and the absorbance value of the plate was measured at 450 nm using a microplate reader.

2.6.6. Cells Differentiation and Mineralization

Alkaline Phosphatase Staining

Alkaline phosphatase (ALP) secretion was detected by the ALP kit. After 1 day of osteoblast seeding on the different samples, the cells were changed to conditioned medium for 7 and 14 days and then assayed by the ALP kit. The absorbance values were measured at 520 nm using a microplate reader.

Alizarin Red Staining

After seeding on different samples, osteoblast cells were cultured in conditioned medium for 14 and 21 days. After that, the samples were stained with 2% alizarin red at 37 °C for 30 min. A digital camera was used to record the images of various substrates. Furthermore, semi-quantitative analysis was performed. One milliliter of 10% cetylpyridinium chloride was added to each sample and incubated for 30 min. The absorbance values were measured at 562 nm using a microplate reader.

2.7. Statistical Analysis

The SPSS software 17.0 (SPSS, New York, NY, USA) was used for statistics analysis. All data were obtained in triplicate and expressed as the mean ± standard deviation (SD). One-way analysis of variance (ANOVA) and Student–Newman–Keuls (SNK) tests were used to compare differences between groups. The significance level was set at α = 0.05. A p-value of <0.05 was considered statistically significant.

3. Results

3.1. Sample Characterization

3.1.1. SEM Observation

Figure 1 shows SEM images of each group of samples at low (3 k), medium (10 k), and high (50 k) magnifications. Figure 1A–C represent the Ti group, where uniform surface scratches, indicative of polishing marks, are visible. Figure 1D–F represent the 3Y-TZP group, also showing uniform polishing marks. Figure 1G–I represent the NANO-Zr group, showing polishing marks along with dark spots evenly distributed across a lighter background. The lighter background corresponds to CeO2-stabilized tetragonal ZrO2 polycrystals, with interspersed dark spots corresponding to Al2O3 crystals, indicating that the NANO-Zr sample possesses a unique intergranular nanostructure.

3.1.2. EDS Analysis, Surface Roughness, and Hydrophilicity

Figure 2A–C represents the mapping surface scan results of Ti, 3Y-TZP, and NANO-Zr samples from EDS analysis, with the surface scan field of view corresponding to the high magnification SEM images. The point scan results from the EDS analysis are shown in Figure 2D. In the Ti sample, the Ti element (96.14%) is uniformly distributed throughout the entire field of view. In the 3Y-TZP sample, the primary elements are Zr (31.19%), O (56.85%), and Y (3.73%), and they are evenly distributed throughout the field of view. In the NANO-Zr sample, the primary elements are Zr (17.18%), Al (21.44%), O (53.74%), and Ce (2.93%), with Al concentrated in the dark spot areas, while the remaining elements are uniformly distributed across the field.
Figure 2E,F shows the surface roughness of the different sample groups. Ra represents the average surface roughness, which is the absolute mean deviation of the surface profile over a fixed length, reflecting the average height difference across the surface. Rz, on the other hand, represents the overall surface roughness, calculated as the sum of the average maximum peak height and the average maximum valley depth over a fixed length. Both are common indicators of surface roughness. The results indicated that the Ra values of the Ti, 3Y-TZP, and NANO-Zr samples were 0.198 ± 0.012, 0.059 ± 0.011, and 0.059 ± 0.012, respectively. The Rz values were 1.373 ± 0.095, 0.448 ± 0.035, and 0.463 ± 0.086, respectively. The Ra and Rz values for the Ti samples were significantly higher than those for the 3Y-TZP and NANO-Zr samples, with statistically significant differences. These results indicated that the surfaces of the 3Y-TZP and NANO-Zr samples were smoother compared to the Ti samples.
Figure 2G shows the water contact angles of the Ti, 3Y-TZP, and NANO-Zr samples. The results indicated that the contact angles were 76.3 ± 2.2 for the Ti samples, 75.9 ± 1.5 for the 3Y-TZP samples, and 73.8 ± 0.7 for the NANO-Zr samples. Both the 3Y-TZP and NANO-Zr samples exhibited a slight decrease in water contact angle compared to the Ti samples, but the differences were not statistically significant. This result suggests that the hydrophilic properties of the different materials are similar, with the zirconia-based substrates potentially having slightly better hydrophilicity than pure titanium, warranting further investigation.

3.2. Macrophage Behaviors on Different Surfaces

3.2.1. Cell Adhesion and Morphology

Figure 3A presents the laser confocal microscopy images of the cells, with the cell cytoskeleton stained in red fluorescence and the cell nucleus in blue fluorescence. After one day of seeding macrophages on different sample surfaces, cells on the Ti surface appeared spherical, and no obvious spreading was observed. In contrast, the macrophages on the 3Y-TZP and NANO-Zr surfaces exhibited more pronounced spreading.
Figure 3B shows the results of the cell counting experiment. After 24 h of cultivation, 1.4-fold and 1.76-fold adherent cell numbers were detected on the 3Y-TZP and NANO-Zr surfaces, respectively, compared with the Ti group. Figure 3C presents the cell adhesion rate assay results for macrophages 2 h after inoculation on the three surfaces. The results indicate good cell adhesion across all material groups, with adhesion rates of 90% for titanium, 94.4% for 3Y-TZP, and 96.7% for NANO-Zr. These differences were statistically significant. These results demonstrated that both the 3Y-TZP and NANO-Zr surfaces could promote early macrophage adhesion compared to the Ti surface, with the NANO-Zr surface showing the best effect in promoting cell adhesion.
Figure 3D displayed scanning electron microscopy (SEM) images of macrophages cultured for one day on different surfaces. Panels d1, d3, and d5 represented macrophages on the Ti, 3Y-TZP, and NANO-Zr surfaces, respectively, while d2, d4, and d6 showed correspondingly higher magnification images. Macrophages on the Ti samples displayed smaller cell surface areas, fewer and shorter pseudopodia, and less intercellular connection. On the 3Y-TZP and NANO-Zr surfaces, macrophages exhibited longer pseudopodia, larger surface areas, and closer intercellular connections. The results indicated that compared to pure titanium, the 3Y-TZP and NANO-Zr surfaces exhibited better macrophage adhesion-promoting effects, with the NANO-Zr group showing the most significant effect on macrophage spreading.

3.2.2. Cell Proliferation and Polarization

Macrophage proliferation was detected using the CCK-8 kit. As shown in Figure 4A, the cell viability in both the 3Y-TZP and NANO-Zr groups was higher than in the Ti group after the first day of culture. On the 3rd, 5th, and 7th days, the cell viability of all groups increased over time, with the 3Y-TZP and NANO-Zr groups showing higher viability than the Ti group. However, there was no significant difference between the 3Y-TZP and NANO-Zr groups. These results indicate that both 3Y-TZP and NANO-Zr surfaces promoted the proliferation of RAW 264.7 macrophages compared to the Ti surface.
Figure 4B,C shows the expression of inflammation-related genes in RAW 264.7 macrophages cultured on different surfaces for 3 days. Compared to the Ti group, the expression of M1 pro-inflammatory genes (IL-6, TNF-α) was reduced in the 3Y-TZP and NANO-Zr groups (Figure 4B), while the expression of M2 pro-restorative genes (IL-10, TGF-β) was increased (Figure 4C). Notably, the TGF-β expression level in the NANO-Zr group was higher than that in the 3Y-TZP group, with statistical significance. This result suggested that both 3Y-TZP and NANO-Zr surfaces can promote macrophage polarization towards the M2 phenotype to a certain extent, with NANO-Zr potentially offering the most favorable pro-restorative effect.

3.3. Osteoblasts Behaviors on Different Surfaces with Macrophage CM

3.3.1. Cell Adhesion and Morphology

Rhodamine-phalloidin and DAPI staining were used to observe the cytoskeleton and cell nuclei of osteoblasts, as shown in Figure 5A. In the presence of macrophage-conditioned medium, after 1 day of co-culture with different sample surfaces, the osteoblasts on the Ti surface exhibited a spindle shape, growing along the direction of polishing scratches with limited spreading and fewer cytoskeletal connections. However, the 3Y-TZP and NANO-Zr groups showed significantly greater spreading areas compared to the Ti group, with osteoblasts extending in multiple directions, exhibiting well-spread cytoskeletons and more extensive intercellular connections.
As shown in Figure 5B, after 1 day of cultivation in CM, the number of adherent cells on the 3Y-TZP and NANO-Zr surfaces was 1.4-fold and 1.6-fold higher, respectively, compared to the Ti pristine surface. These results indicated that in the presence of macrophage CM, osteoblasts exhibited the highest adhesion on the NANO-Zr substrate.
Figure 5C presents the morphology of osteoblasts cultured on different sample surfaces in macrophage-conditioned medium. Panels c1, c3, and c5 showed the morphology of MC3T3-E1 cells on Ti, 3Y-TZP, and NANO-Zr surfaces, respectively, after 1 day of co-culture in CM. Panels c2, c4, and c6 were high-magnification images. The cells on the Ti surface stretched along the scratches of the material, displaying a slightly elongated spindle shape with fewer filopodia. Cells in the 3Y-TZP group exhibited better spreading than those in the Ti group, with more filopodia extensions. The NANO-Zr group showed the best spreading morphology, with a large number of filopodia extending in various directions.

3.3.2. Cell Proliferation, Differentiation and Mineralization

As shown in Figure 6A, the proliferation of osteoblasts on all samples increased over time in macrophage CM. On the first day of culture, the proliferation of osteoblasts in the 3Y-TZP and NANO-Zr groups was higher than in the Ti group. On the 3rd, 5th, and 7th days, the NANO-Zr group exhibited higher cell proliferation than both the Ti and 3Y-TZP groups, indicating that the NANO-Zr surface had the strongest ability to promote osteoblast proliferation in co-culture with macrophages.
Further, alkaline phosphatase (ALP) expression in the supernatants of osteoblasts cultured on different sample surfaces in macrophage CM was examined. As shown in Figure 6B, after 7 days of culture, there was no significant difference in ALP expression among the groups. However, by day 14, ALP expression in the NANO-Zr group was higher than that in the other two groups, with statistically significant differences.
Alizarin red staining results showed that calcium nodule formation in the NANO-Zr group exhibited a higher trend compared to the 3Y-TZP and Ti groups (Figure 6C). The semi-quantitative analysis further confirmed that after 21 days of culture, the NANO-Zr group had more calcium nodule formation than the 3Y-TZP and Ti groups, indicating that the NANO-Zr group had the best extracellular mineralization capacity (Figure 6D).

4. Discussion

Zirconia-based materials have become an important alternative to titanium implants in the field of oral implantation due to their excellent chemical stability. Zirconia has outstanding biocompatibility, and its osteointegration properties are comparable to those of titanium and titanium alloys [33]. Previous studies have shown that zirconium oxide promotes osteoblast adhesion, proliferation, and osteogenic differentiation [34,35]. Moreover, surface modification methods such as sandblasting, hydrofluoric acid combined with sandblasting, and ultraviolet (UV) light treatment can enhance biocompatibility and osseointegration to some extent [36,37]. However, surface modification also suffers from problems such as coating delamination or surface abrasion, which may lead to a reduction or even loss of bioactivity. In contrast, substrate modification is more reliable and can effectively avoid these potential drawbacks.
Some studies suggest that the zirconia surface may influence cell proliferation through immunomodulation [38]. In addition, the JAK-STAT signaling pathway may hold immunological significance in bone remodeling and formation [39]. However, the specific mechanisms remain unclear. Although there has been substantial research on the bone immunology of titanium implants [16,17,18], studies on the bone immune response to zirconia implants are relatively limited. Therefore, this study aims to investigate the effects of the zirconia surface on macrophages and how the regulation of macrophage polarization and the immune microenvironment influences osteoblast adhesion, proliferation, and osteogenic differentiation. The findings are expected to provide a basis for exploring the bone immunological properties of zirconia surfaces.

4.1. Effect of Zirconia Surface on the Biological Behavior of Macrophages

The surface characteristics of implants (including physical properties, chemical composition, and biological characteristics) are key factors that determine the interaction between cells and implants [40,41]. Surface topography and chemical composition have a crucial impact on the biological behavior of cells [27]. The adhesion, proliferation characteristics, and particularly the polarization type of macrophages play an important role in the response after implant placement. M1-type macrophages promote inflammatory responses, clear necrotic tissue, and inhibit the proliferation of surrounding cells, whereas M2-type macrophages can recruit repair cells such as mesenchymal stem cells and osteoblasts, promoting cell proliferation and postoperative repair responses, including osteogenesis and angiogenesis [42]. TNF-α and IL-6 are proinflammatory factors secreted by M1-type macrophages, while TGF-β and IL-10 are repair-promoting factors secreted by M2-type macrophages [43]. Previous studies have shown that modifying the surface of biomaterials and altering surface characteristics can regulate the biological activity of macrophages [44]. Nano-interfaces can regulate the polarization of macrophages from the proinflammatory M1 phenotype to the anti-inflammatory M2 phenotype [45]. Enhancing surface roughness can also influence the initial adhesion, spreading, and subsequent proliferation, differentiation, and mineralization of macrophages [46]. Additionally, materials with better hydrophilicity can effectively promote macrophage adhesion [47] and affect the transition of macrophages between M1 and M2 polarization states [48].
The SEM results of this study showed that the nano-zirconia surface exhibited its characteristic intergranular interpenetrating nanostructures, consistent with previous literature [14]. At the same time, the hydrophilicity of the NANO-Zr and 3Y-TZP groups was similar to that of the Ti group. Cytoskeleton staining and SEM observations revealed enhanced adhesion and spreading of macrophages on the surfaces of the NANO-Zr and 3Y-TZP groups compared to the Ti group, with more adherent cell counts. This suggests that the nano-topography promotes macrophage adhesion and proliferation. The study further demonstrated that, compared to the Ti group, the expression of pro-restorative genes was upregulated, and proinflammatory genes were downregulated in macrophages cultured on the surfaces of the 3Y-TZP and especially the NANO-Zr group. This indicates that both NANO-Zr and 3Y-TZP can induce the polarization of macrophages from the M1 proinflammatory type to the M2 pro-repair type, with NANO-Zr showing a superior effect.
Research has shown that nano-topography can enhance protein interactions, thereby imparting stronger bioactivity to material surfaces [49]. Previous studies by our group found that nano-topographies on titanium surfaces, prepared by anodization, could promote macrophage adhesion, proliferation, and M2 polarization [17,50]. Based on this, we hypothesize that the nano-topography of the NANO-Zr surface is one of the factors promoting macrophage activity and inducing their polarization from the M1 proinflammatory type to the M2 pro-repair type. Additionally, chemical composition analysis showed that NANO-Zr consists mainly of zirconia, aluminum oxide, and cerium oxide, while 3Y-TZP is composed primarily of zirconia and yttrium oxide. Previous studies have found that cerium oxide can inhibit the activation of proinflammatory macrophages [51] and promote M2 macrophage polarization to reduce inflammation [52], suggesting it may also play a role in inducing M2 polarization of macrophages.
Although used as the gold standard material for implants, the potential drawbacks of Ti have gradually attracted attention. Several studies have shown that Ti releases submicron-sized particles that can induce inflammatory cytokine secretion [53,54]. In contrast, zirconia is reported to be more inert than titanium, has better corrosion resistance, and causes less soft tissue inflammation than titanium abutments in vivo experiments [55]. Corroborating previous findings, our study demonstrated that zirconia has better anti-inflammatory effects in vitro and may be a more desirable implant material.
Microscale roughness is a key factor influencing cellular behaviors such as adhesion, proliferation, and differentiation [56]. Generally, rough surfaces increase the contact area between cells and the material, promoting cell adhesion, spreading, and migration [57]. Additionally, rough surface structures can induce osteogenic differentiation and maturation of mesenchymal stem cells [58]. Studies have also shown that titanium with rough micro-nanostructures can induce macrophage differentiation toward the anti-inflammatory M2 phenotype [59,60]. In this study, the surface roughness of Ti was 0.2 ± 0.01 μm, while the roughness of the NANO-Zr and 3Y-TZP groups was about 0.06 ± 0.01 μm, with both being relatively similar. This result indicates that all three materials are smooth surfaces, with zirconia surfaces (zirconia and nano-zirconia) being relatively smoother. Previous studies have shown that smooth surfaces promote M1 polarization of macrophages [61]. We speculate that the surface roughness of zirconia-based materials may contribute to the M1 proinflammatory polarization of macrophages.

4.2. Effects of Zirconia Surface to Promote Osteogenesis by Immunoregulation

This study further explores how materials regulate macrophage polarization to promote osteogenesis. Osteogenic differentiation is a key physiological process in osseointegration, which is influenced by the physicochemical properties of implant surfaces [62,63,64]. Previous studies have mostly focused on the effects of materials on osteoblasts, neglecting the important role of immune cells in the process of osteogenesis. While the early inflammatory response induced by immune cells is essential for the initial stages of osseointegration, excessive inflammation can lead to bone resorption and inhibit bone tissue regeneration [65]. Based on the theory of osteoimmunology, regulating the biological activity of macrophages around implants can effectively promote the osseointegration of implants. Previous research by our group found that modified titanium implant surfaces could enhance the activity of osteoblasts through immune regulation—such as adhesion, proliferation, differentiation, and mineralization—thereby promoting osseointegration on the implant surface [17,50]. However, the impact of immune responses on osteogenic differentiation at the surface of zirconia substrates remains unclear. The role of regulating macrophage polarization to promote osteogenesis requires further investigation. Therefore, in this study, MC3T3-E1 pre-osteoblasts were selected as the research subject to further explore the effects of macrophage-mediated immune responses on the osteogenic differentiation of osteoblasts cultured on different surfaces in the presence of macrophage-conditioned media.
Our research group previously fabricated nanotube structures on titanium surfaces, which promoted macrophage polarization to the M2 type and enhanced the osteogenic activity of osteoblasts [50]. Additionally, we loaded zinc oxide onto these nanotube structures, inducing macrophages to polarize toward the M2 type and promoting osteoblast differentiation, thereby enhancing osseointegration [17]. This study demonstrates that in the presence of macrophage-conditioned media, cytoskeleton staining, SEM, and CCK-8 results all indicated that both the NANO-Zr and 3Y-TZP groups promoted osteoblast adhesion and proliferation more effectively than the Ti group. Alkaline phosphatase (ALP) and alizarin red staining were then used to evaluate the effects of different surfaces on osteoblast differentiation. ALP is a biochemical marker of early-stage osteoblast differentiation and bone formation, as well as a general indicator of osteoblast activity. Calcium nodules, indicative of late-stage osteoblast differentiation, were observed via alizarin red staining. Previous studies found that osteoblasts cultured on NANO-Zr samples exhibited higher ALP activity, while the ALP content of 3Y-TZP samples was lower than that of the Ti group [23]. This study further investigated the regulatory effects of immune-mediated osteogenesis under co-culture conditions with macrophages and osteoblasts on NANO-Zr surfaces. The results showed that, in the presence of macrophage-conditioned media, the NANO-Zr group exhibited upregulated ALP expression and increased calcium nodule formation, suggesting that osteoblast differentiation in the NANO-Zr group was superior to that of the Ti and 3Y-TZP groups. This implies that nano-topography plays a crucial role in promoting macrophage polarization, which in turn enhances osteoblast differentiation.
In addition to nano-topography, the chemical composition of the material may also affect osteogenic performance. It has been reported that the stabilizer used in zirconia could influence its osteogenic activity, with cerium oxide-stabilized zirconia possibly having lower osteogenic activity compared to yttrium-stabilized zirconia [66]. However, other studies have suggested that cerium oxide-stabilized zirconia exhibits similar osteogenic activity to yttrium-stabilized zirconia [23]. Previous findings also showed that cerium oxide could induce M2 polarization of macrophages, indicating that the effect of cerium oxide on the osteogenic activity of zirconia is complex and warrants further investigation. Furthermore, NANO-Zr possesses a unique interpenetrating crystal structure, with Al2O3 particles dispersed within ZrO2 crystals, and a high content of Al2O3 particles in NANO-Zr [27]. Some scholars have found that Al2O3 nanoparticles do not cause a significant increase in common inflammatory markers (such as TNF-α) in THP-1 macrophages [67], nor do they interfere with the activity of THP-1 macrophages and fibroblast cell lines [68]. Other studies have suggested that Al2O3 particles may induce an inflammatory response in macrophages [69], stimulating THP-1 macrophages to secrete IL-1β while reducing IL-6 expression [70]. Thus, the effects of Al2O3 nanoparticles on macrophages remain unclear. Previous studies have also shown that the nanostructured Al2O3 promotes the expression of osteogenic markers in osteoblasts [71]. Consistent with these findings, the present study revealed that, under co-culture conditions with macrophages, osteoblasts on the NANO-Zr surface exhibited better osteogenic performance. This suggests that the unique chemical composition and structure of nano-zirconia may contribute to its enhanced osteogenic activity, but the specific mechanisms remain complex and require further investigation. Since the hydrophilicity of Ti, NANO-Zr, and 3Y-TZP did not show significant differences, it is suggested that hydrophilicity may not be the main factor driving the osteogenic promotion of zirconia surfaces. Previous research by our group found that rough surfaces promote immune-mediated osteogenesis [17]. Although the results showed that the surface roughness of NANO-Zr and 3Y-TZP was lower than that of Ti, all three surfaces were relatively smooth. Since smooth surfaces have the potential to induce M1 macrophage polarization, roughness may negatively impact the osteogenic performance of nano-zirconia. The specific role and mechanism require further clarification.

4.3. Current Limitations and Future Perspectives

Our study showed that the NANO-Zr surface promotes macrophage adhesion, M2 polarization, and osteoblast differentiation. The influence of NANO-Zr surface on immune-mediated osteogenesis involved various factors such as surface morphology, chemical composition, and roughness, while the exact molecular mechanism is still unclear. Further studies are needed to elucidate how NANO-Zr regulates macrophage polarization and osteogenesis. Additionally, we plan to conduct in vivo animal experiments to further investigate the effects of NANO-Zr implants on immune-mediated osteogenesis and early bone integration, as well as to validate the associated anti-inflammatory mechanisms.

5. Conclusions

In summary, both NANO-Zr and 3Y-TZP exhibit good biocompatibility and osteogenic activity. Notably, NANO-Zr not only enhances the adhesion and proliferation of osteoblasts but also regulates macrophage polarization, facilitating the timely transition from M1 to M2 polarization. This fosters a favorable immune microenvironment that promotes osteogenesis, indicating promising potential for future applications in dental and orthopedic implants.

Author Contributions

Conceptualization, J.H., H.B., G.H. and Y.L.; data curation, Y.T., R.G., M.W. and S.L. (Sanwen Li); formal analysis, S.L. (Suli Lan), R.G., M.W. and S.L. (Sanwen Li); funding acquisition, Y.S.; investigation, Y.T., Y.S., S.L. (Suli Lan), R.G., M.W. and S.L. (Sanwen Li); methodology, Y.T., Y.S., S.L. (Suli Lan), R.G., M.W., S.L. (Sanwen Li) and J.H.; project administration, H.B., G.H. and Y.L.; resources, Y.T. and Y.S.; software, Y.T., Y.S. and S.L. (Suli Lan); supervision, H.B., G.H. and Y.L.; validation, Y.T., Y.S. and S.L. (Suli Lan); visualization, Y.T. and Y.S.; writing—original draft, Y.T., Y.S. and S.L. (Suli Lan); writing—review and editing, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science & Technology Development Fund of Tianjin Education Commission for Higher Education, grant number 2020KJ183.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We sincerely acknowledge Keiichi Sasaki from the Miyagi University for his invaluable assistance in the fabrication and characterization of the samples.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kellesarian, S.V.; Yunker, M.; Ramakrishnaiah, R.; Malmstrom, H.; Kellesarian, T.V.; Ros Malignaggi, V.; Javed, F. Does incorporating zinc in titanium implant surfaces influence osseointegration? A systematic review. J. Prosthet. Dent. 2017, 117, 41–47. [Google Scholar] [CrossRef] [PubMed]
  2. Evrard, L.; Waroquier, D.; Parent, D. Allergies to dental metals. Titanium: A new allergen. Rev. Medicale Brux. 2010, 31, 44–49. [Google Scholar]
  3. Shah, R.; Penmetsa, D.S.L.; Thomas, R.; Mehta, D.S. Titanium Corrosion: Implications For Dental Implants. Eur. J. Prosthodont. Restor. Dent. 2016, 24, 171–180. [Google Scholar] [CrossRef] [PubMed]
  4. Sivaraman, K.; Chopra, A.; Narayan, A.I.; Balakrishnan, D. Is zirconia a viable alternative to titanium for oral implant? A critical review. J. Prosthodont. Res. 2018, 62, 121–133. [Google Scholar] [CrossRef]
  5. Hilgenfeld, T.; Prager, M.; Schwindling, F.S.; Heil, A.; Kuchenbecker, S.; Rammelsberg, P.; Bendszus, M.; Heiland, S. Artefacts of implant-supported single crowns—Impact of material composition on artefact volume on dental MRI. Eur. J. Oral Implantol. 2016, 9, 301–308. [Google Scholar]
  6. Traini, T.; Pettinicchio, M.; Murmura, G.; Varvara, G.; Di Lullo, N.; Sinjari, B.; Caputi, S. Esthetic outcome of an immediately placed maxillary anterior single-tooth implant restored with a custom-made zirconia-ceramic abutment and crown: A staged treatment. Quintessence Int. 2011, 42, 103–108. [Google Scholar]
  7. Cionca, N.; Hashim, D.; Mombelli, A. Zirconia dental implants: Where are we now, and where are we heading? Periodontol. 2000 2017, 73, 241–258. [Google Scholar] [CrossRef]
  8. Hanawa, T. Zirconia versus titanium in dentistry: A review. Dent. Mater. J. 2020, 39, 24–36. [Google Scholar] [CrossRef]
  9. de Avila, E.D.; Avila-Campos, M.J.; Vergani, C.E.; Spolidorio, D.M.; Mollo Fde, A., Jr. Structural and quantitative analysis of a mature anaerobic biofilm on different implant abutment surfaces. J. Prosthet. Dent. 2016, 115, 428–436. [Google Scholar] [CrossRef]
  10. Att, W.; Takeuchi, M.; Suzuki, T.; Kubo, K.; Anpo, M.; Ogawa, T. Enhanced osteoblast function on ultraviolet light-treated zirconia. Biomaterials 2009, 30, 1273–1280. [Google Scholar] [CrossRef]
  11. Han, J.; Zhao, J.; Shen, Z. Zirconia ceramics in metal-free implant dentistry. Adv. Appl. Ceram. 2016, 116, 138–150. [Google Scholar] [CrossRef]
  12. Camposilvan, E.; Leone, R.; Gremillard, L.; Sorrentino, R.; Zarone, F.; Ferrari, M.; Chevalier, J. Aging resistance, mechanical properties and translucency of different yttria-stabilized zirconia ceramics for monolithic dental crown applications. Dent. Mater. 2018, 34, 879–890. [Google Scholar] [CrossRef] [PubMed]
  13. Yadav, R.; Saini, S.; Sonwal, S.; Meena, A.; Huh, Y.S.; Brambilla, E.; Ionescu, A.C. Optimization and ranking of dental restorative composites by ENTROPY-VIKOR and VIKOR-MATLAB. Polym. Adv. Technol. 2024, 35, e6526. [Google Scholar] [CrossRef]
  14. Han, J.M.; Hong, G.; Lin, H.; Shimizu, Y.; Wu, Y.; Zheng, G.; Zhang, H.; Sasaki, K. Biomechanical and histological evaluation of the osseointegration capacity of two types of zirconia implant. Int. J. Nanomed. 2016, 11, 6507–6516. [Google Scholar] [CrossRef] [PubMed]
  15. Saini, S.; Yadav, R.; Sonwal, S.; Meena, A.; Huh, Y.S.; Brambilla, E.; Ionescu, A.C. Tribological, mechanical, and thermal properties of nano tricalcium phosphate and silver particulates reinforced Bis-GMA/TEGDMA dental resin composites. Tribol. Int. 2024, 199, 110010. [Google Scholar] [CrossRef]
  16. Chen, B.; Wang, W.; Hu, M.; Liang, Y.; Wang, N.; Li, C.; Li, Y. “Photo-Thermo-Electric” Dental Implant for Anti-Infection and Enhanced Osteoimmunomodulation. ACS Nano 2024, 18, 24968–24983. [Google Scholar] [CrossRef]
  17. Chen, B.; You, Y.; Ma, A.; Song, Y.; Jiao, J.; Song, L.; Shi, E.; Zhong, X.; Li, Y.; Li, C. Zn-Incorporated TiO2 Nanotube Surface Improves Osteogenesis Ability Through Influencing Immunomodulatory Function of Macrophages. Int. J. Nanomed. 2020, 15, 2095–2118. [Google Scholar] [CrossRef]
  18. Chen, B.; Liang, Y.; Song, Y.; Liang, Y.; Jiao, J.; Bai, H.; Li, Y. Photothermal-Controlled Release of IL-4 in IL-4/PDA-Immobilized Black Titanium Dioxide (TiO2) Nanotubes Surface to Enhance Osseointegration: An In Vivo Study. Materials 2022, 15, 5962. [Google Scholar] [CrossRef]
  19. Nawa, M.; Nakamoto, S.; Sekino, T.; Niihara, K. Tough and strong Ce-TZP/Alumina nanocomposites doped with titania. Ceram. Int. 1998, 24, 497–506. [Google Scholar] [CrossRef]
  20. Sato, H.; Yamada, K.; Pezzotti, G.; Nawa, M.; Ban, S. Mechanical properties of dental zirconia ceramics changed with sandblasting and heat treatment. Dent. Mater. J. 2008, 27, 408–414. [Google Scholar] [CrossRef]
  21. Yamashita, D.; Machigashira, M.; Miyamoto, M.; Takeuchi, H.; Noguchi, K.; Izumi, Y.; Ban, S. Effect of surface roughness on initial responses of osteoblast-like cells on two types of zirconia. Dent. Mater. J. 2009, 28, 461–470. [Google Scholar] [CrossRef] [PubMed]
  22. Ban, S. Reliability and properties of core materials for all-ceramic dental restorations. Jpn. Dent. Sci. Rev. 2008, 44, 3–21. [Google Scholar] [CrossRef]
  23. Han, J.M.; Hong, G.; Matsui, H.; Shimizu, Y.; Zheng, G.; Lin, H.; Sasaki, K. The surface characterization and bioactivity of NANOZR in vitro. Dent. Mater. J. 2014, 33, 210–219. [Google Scholar] [CrossRef] [PubMed]
  24. Komasa, S.; Takao, S.; Yang, Y.; Zeng, Y.; Li, M.; Yan, S.; Zhang, H.; Komasa, C.; Kobayashi, Y.; Nishizaki, H.; et al. Effects of UV Treatment on Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANOZR). Materials 2020, 13, 2772. [Google Scholar] [CrossRef] [PubMed]
  25. Komasa, S.; Nishizaki, M.; Zhang, H.; Takao, S.; Yin, D.; Terada, C.; Kobayashi, Y.; Kusumoto, T.; Yoshimine, S.; Nishizaki, H.; et al. Osseointegration of Alkali-Modified NANOZR Implants: An In Vivo Study. Int. J. Mol. Sci. 2019, 20, 842. [Google Scholar] [CrossRef]
  26. Takao, S.; Komasa, S.; Agariguchi, A.; Kusumoto, T.; Pezzotti, G.; Okazaki, J. Effects of Plasma Treatment on the Bioactivity of Alkali-Treated Ceria-Stabilised Zirconia/Alumina Nanocomposite (NANOZR). Int. J. Mol. Sci. 2020, 21, 7476. [Google Scholar] [CrossRef]
  27. Liu, J.; Hong, G.; Wu, Y.H.; Endo, K.; Han, J.M.; Kumamoto, H.; Wada, T.; Kato, H.; Gao, P.; Sasaki, K. A novel method of surface modification by electrochemical deoxidation: Effect on surface characteristics and initial bioactivity of zirconia. J. Biomed. Mater. Res. Part B Appl. Biomater. 2017, 105, 2641–2652. [Google Scholar] [CrossRef]
  28. Bai, L.; Du, Z.; Du, J.; Yao, W.; Zhang, J.; Weng, Z.; Liu, S.; Zhao, Y.; Liu, Y.; Zhang, X.; et al. A multifaceted coating on titanium dictates osteoimmunomodulation and osteo/angio-genesis towards ameliorative osseointegration. Biomaterials 2018, 162, 154–169. [Google Scholar] [CrossRef]
  29. Zhang, Q.; Hwang, J.W.; Oh, J.H.; Park, C.H.; Chung, S.H.; Lee, Y.S.; Baek, J.H.; Ryoo, H.M.; Woo, K.M. Effects of the fibrous topography-mediated macrophage phenotype transition on the recruitment of mesenchymal stem cells: An in vivo study. Biomaterials 2017, 149, 77–87. [Google Scholar] [CrossRef]
  30. Zhao, Y.; Bai, L.; Zhang, Y.; Yao, R.; Sun, Y.; Hang, R.; Chen, X.; Wang, H.; Yao, X.; Xiao, Y.; et al. Type I collagen decorated nanoporous network on titanium implant surface promotes osseointegration through mediating immunomodulation, angiogenesis, and osteogenesis. Biomaterials 2022, 288, 121684. [Google Scholar] [CrossRef]
  31. Chen, M.; Huang, L.; Shen, X.; Li, M.; Luo, Z.; Cai, K.; Hu, Y. Construction of multilayered molecular reservoirs on a titanium alloy implant for combinational drug delivery to promote osseointegration in osteoporotic conditions. Acta Biomater. 2020, 105, 304–318. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, Z.; Yuen, J.; Crawford, R.; Chang, J.; Wu, C.; Xiao, Y. The effect of osteoimmunomodulation on the osteogenic effects of cobalt incorporated β-tricalcium phosphate. Biomaterials 2015, 61, 126–138. [Google Scholar] [CrossRef] [PubMed]
  33. Bormann, K.H.; Gellrich, N.C.; Kniha, H.; Schild, S.; Weingart, D.; Gahlert, M. A prospective clinical study to evaluate the performance of zirconium dioxide dental implants in single-tooth edentulous area: 3-year follow-up. BMC Oral Health 2018, 18, 181. [Google Scholar] [CrossRef] [PubMed]
  34. Depprich, R.; Zipprich, H.; Ommerborn, M.; Naujoks, C.; Wiesmann, H.P.; Kiattavorncharoen, S.; Lauer, H.C.; Meyer, U.; Kubler, N.R.; Handschel, J. Osseointegration of zirconia implants compared with titanium: An in vivo study. Head Face Med. 2008, 4, 30. [Google Scholar] [CrossRef]
  35. Sun, Y.; Sun, J.; Wu, X.; Li, Y.; Li, X.; Li, R.; Wang, T.; Bi, W.; Cui, W.; Yu, Y. Mechanism of zirconia microgroove surface structure for osseointegration. Mater. Today Adv. 2021, 12, 100159. [Google Scholar] [CrossRef]
  36. Fischer, J.; Schott, A.; Mrtin, S. Surface micro-structuring of zirconia dental implants. Clin. Oral Implant. Res. 2016, 27, 162–166. [Google Scholar] [CrossRef]
  37. Henningsen, A.; Smeets, R.; Heuberger, R.; Jung, O.T.; Hanken, H.; Heiland, M.; Cacaci, C.; Precht, C. Changes in surface characteristics of titanium and zirconia after surface treatment with ultraviolet light or non-thermal plasma. Eur. J. Oral Sci. 2020, 126, 126–134. [Google Scholar] [CrossRef]
  38. Carinci, F.; Pezzetti, F.; Volinia, S.; Francioso, F.; Arcelli, D.; Farina, E.; Piattelli, A. Zirconium oxide: Analysis of MG63 osteoblast-like cell response by means of a microarray technology. Biomaterials 2004, 25, 215–228. [Google Scholar] [CrossRef]
  39. Mukaddam, K.; Ruggiero, S.; Berger, S.M.; Cholewa, D.; Kuhl, S.; Vegh, D.; Payer, M.; Bornstein, M.M.; Alhawasli, F.; Fasler-Kan, E. Cytokines Activate JAK-STAT Signaling Pathway in MG-63 Cells on Titanium and Zirconia. Materials 2022, 15, 5621. [Google Scholar] [CrossRef]
  40. Wang, X.; Liu, W.; Yu, X.; Wang, B.; Xu, Y.; Yan, X.; Zhang, X. Advances in surface modification of tantalum and porous tantalum for rapid osseointegration: A thematic review. Front. Bioeng. Biotechnol. 2022, 10, 983695. [Google Scholar] [CrossRef]
  41. Li, Y.; Xiao, Y.; Liu, C. The Horizon of Materiobiology: A Perspective on Material-Guided Cell Behaviors and Tissue Engineering. Chem. Rev. 2017, 117, 4376–4421. [Google Scholar] [CrossRef] [PubMed]
  42. Horwood, N.J. Macrophage Polarization and Bone Formation: A review. Clin. Rev. Allergy Immunol. 2016, 51, 79–86. [Google Scholar] [CrossRef] [PubMed]
  43. Bai, L.; Liu, Y.; Du, Z.; Weng, Z.; Yao, W.; Zhang, X.; Huang, X.; Yao, X.; Crawford, R.; Hang, R.; et al. Differential effect of hydroxyapatite nano-particle versus nano-rod decorated titanium micro-surface on osseointegration. Acta Biomater. 2018, 76, 344–358. [Google Scholar] [CrossRef] [PubMed]
  44. Xu, Y.; Shen, Z.; Zhou, Y.; Zhou, Y.H.; Zhou, J.Y.; Qian, X.N.; Wei, Y.W.; Qiu, J. Osteogenic and anti-inflammatory effects of SLA titanium substrates doped with chitosan-stabilized selenium nanoparticles via a covalent coupling strategy. Colloids Surf. B Biointerfaces 2023, 224, 113217. [Google Scholar] [CrossRef] [PubMed]
  45. Xu, L.; Fang, J.; Pan, J.; Qi, H.; Yin, Y.; He, Y.; Gan, X.; Li, Y.; Li, Y.; Guo, J. Zinc finger-inspired peptide-metal-phenolic nanointerface enhances bone-implant integration under bacterial infection microenvironment through immune modulation and osteogenesis promotion. Bioact. Mater. 2024, 41, 564–576. [Google Scholar] [CrossRef]
  46. Anselme, K. Osteoblast adhesion on biomaterials. Biomaterials 2000, 21, 667–681. [Google Scholar] [CrossRef]
  47. Sunarso; Toita, R.; Tsuru, K.; Ishikawa, K. A superhydrophilic titanium implant functionalized by ozone gas modulates bone marrow cell and macrophage responses. J. Mater. Sci. Mater. Med. 2016, 27, 127. [Google Scholar] [CrossRef]
  48. Shu, Y.; Li, K.; Li, J.; Ding, Y.; Yang, G.; Zheng, X. Ferrocene-functionalized polydopamine film timely mediates M1-to-M2 macrophage polarization through adaptive wettability. Colloids Surf. B Biointerfaces 2024, 236, 113825. [Google Scholar] [CrossRef]
  49. Webster, T.J.; Ergun, C.; Doremus, R.H.; Siegel, R.W.; Bizios, R. Enhanced functions of osteoblasts on nanophase ceramics. Biomaterials 2000, 21, 1803–1810. [Google Scholar] [CrossRef]
  50. Ma, A.; You, Y.; Chen, B.; Wang, W.; Liu, J.; Qi, H.; Liang, Y.; Li, Y.; Li, C. Icariin/Aspirin Composite Coating on TiO2 Nanotubes Surface Induce Immunomodulatory Effect of Macrophage and Improve Osteoblast Activity. Coatings 2020, 10, 427. [Google Scholar] [CrossRef]
  51. Zhang, Y.; Lei, H.; Wang, P.; Zhou, Q.; Yu, J.; Leng, X.; Ma, R.; Wang, D.; Dong, K.; Xing, J.; et al. Restoration of dysregulated intestinal barrier and inflammatory regulation through synergistically ameliorating hypoxia and scavenging reactive oxygen species using ceria nanozymes in ulcerative colitis. Biomater. Res. 2023, 27, 75. [Google Scholar] [CrossRef] [PubMed]
  52. Jiang, C.; Shi, Q.; Yang, J.; Ren, H.; Zhang, L.; Chen, S.; Si, J.; Liu, Y.; Sha, D.; Xu, B.; et al. Ceria nanozyme coordination with curcumin for treatment of sepsis-induced cardiac injury by inhibiting ferroptosis and inflammation. J. Adv. Res. 2024, 63, 159–170. [Google Scholar] [CrossRef] [PubMed]
  53. Taira, M.; Kagiya, T.; Harada, H.; Sasaki, M.; Kimura, S.; Narushima, T.; Nezu, T.; Araki, Y. Microscopic observations and inflammatory cytokine productions of human macrophage phagocytising submicron titanium particles. J. Mater. Sci. Mater. Med. 2010, 21, 267–275. [Google Scholar] [CrossRef] [PubMed]
  54. Kheder, W.; Al Kawas, S.; Khalaf, K.; Samsudin, A.R. Impact of tribocorrosion and titanium particles release on dental implant complications—A narrative review. Jpn. Dent. Sci. Rev. 2021, 57, 182–189. [Google Scholar] [CrossRef] [PubMed]
  55. Wang, M.; Zhang, S.; Chen, L.J.; Zou, H.X.; Wang, Y.N.; Xia, H.B. Early soft tissue response to zirconium oxide and titanium healing abutments in vivo: A study in dogs. BMC Oral Health 2021, 21, 416. [Google Scholar] [CrossRef]
  56. Hou, Y.; Xie, W.; Yu, L.; Camacho, L.C.; Nie, C.; Zhang, M.; Haag, R.; Wei, Q. Surface Roughness Gradients Reveal Topography-Specific Mechanosensitive Responses in Human Mesenchymal Stem Cells. Small 2020, 16, e1905422. [Google Scholar] [CrossRef]
  57. Long, E.G.; Buluk, M.; Gallagher, M.B.; Schneider, J.M.; Brown, J.L. Human mesenchymal stem cell morphology, migration, and differentiation on micro and nano-textured titanium. Bioact. Mater. 2019, 4, 249–255. [Google Scholar] [CrossRef]
  58. Boyan, B.D.; Cheng, A.; Olivares-Navarrete, R.; Schwartz, Z. Implant Surface Design Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv. Dent. Res. 2016, 28, 10–17. [Google Scholar] [CrossRef]
  59. Hotchkiss, K.M.; Reddy, G.B.; Hyzy, S.L.; Schwartz, Z.; Boyan, B.D.; Olivares-Navarrete, R. Titanium surface characteristics, including topography and wettability, alter macrophage activation. Acta Biomater. 2016, 31, 425–434. [Google Scholar] [CrossRef]
  60. Luu, T.U.; Gott, S.C.; Woo, B.W.K.; Rao, M.P.; Liu, W.F. Micro- and Nanopatterned Topographical Cues for Regulating Macrophage Cell Shape and Phenotype. ACS Appl. Mater. Interfaces 2015, 7, 28665–28672. [Google Scholar] [CrossRef]
  61. Shirazi, S.; Ravindran, S.; Cooper, L.F. Topography-mediated immunomodulation in osseointegration; Ally or Enemy. Biomaterials 2022, 291, 121903. [Google Scholar] [CrossRef] [PubMed]
  62. Bai, L.; Wu, R.; Wang, Y.; Wang, X.; Zhang, X.; Huang, X.; Qin, L.; Hang, R.; Zhao, L.; Tang, B. Osteogenic and angiogenic activities of silicon-incorporated TiO2 nanotube arrays. J. Mater. Chem. B 2016, 4, 5548–5559. [Google Scholar] [CrossRef] [PubMed]
  63. Bose, S.; Roy, M.; Bandyopadhyay, A. Recent advances in bone tissue engineering scaffolds. Trends Biotechnol. 2012, 30, 546–554. [Google Scholar] [CrossRef] [PubMed]
  64. Gao, A.; Hang, R.; Huang, X.; Zhao, L.; Zhang, X.; Wang, L.; Tang, B.; Ma, S.; Chu, P.K. The effects of titania nanotubes with embedded silver oxide nanoparticles on bacteria and osteoblasts. Biomaterials 2014, 35, 4223–4235. [Google Scholar] [CrossRef] [PubMed]
  65. Mosser, D.M.; Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008, 8, 958–969. [Google Scholar] [CrossRef]
  66. Pandey, A.K.; Pati, F.; Mandal, D.; Dhara, S.; Biswas, K. In vitro evaluation of osteoconductivity and cellular response of zirconia and alumina based ceramics. Mater. Sci. Eng. C Mater. Biol. Appl. 2013, 33, 3923–3930. [Google Scholar] [CrossRef]
  67. Bylski, D.; Wedemeyer, C.; Xu, J.; Sterner, T.; Löer, F.; von Knoch, M. Alumina ceramic particles, in comparison with titanium particles, hardly affect the expression of RANK-, TNF-alpha-, and OPG-mRNA in the THP-1 human monocytic cell line. J. Biomed. Mater. Res. Part A 2009, 89, 707–716. [Google Scholar] [CrossRef]
  68. Radziun, E.; Dudkiewicz Wilczyńska, J.; Książek, I.; Nowak, K.; Anuszewska, E.L.; Kunicki, A.; Olszyna, A.; Ząbkowski, T. Assessment of the cytotoxicity of aluminium oxide nanoparticles on selected mammalian cells. Toxicol. Vitr. 2011, 25, 1694–1700. [Google Scholar] [CrossRef]
  69. Flaherty, N.L.; Chandrasekaran, A.; del Pilar Sosa Peña, M.; Roth, G.A.; Brenner, S.A.; Begley, T.J.; Melendez, J.A. Comparative analysis of redox and inflammatory properties of pristine nanomaterials and commonly used semiconductor manufacturing nano-abrasives. Toxicol. Lett. 2015, 239, 205–215. [Google Scholar] [CrossRef]
  70. Taylor, A.J.; McClure, C.D.; Shipkowski, K.A.; Thompson, E.A.; Hussain, S.; Garantziotis, S.; Parsons, G.N.; Bonner, J.C. Atomic layer deposition coating of carbon nanotubes with aluminum oxide alters pro-fibrogenic cytokine expression by human mononuclear phagocytes in vitro and reduces lung fibrosis in mice in vivo. PLoS ONE 2014, 9, e106870. [Google Scholar] [CrossRef]
  71. Oshima, Y.; Iwasa, F.; Tachi, K.; Baba, K. Effect of Nanofeatured Topography on Ceria-Stabilized Zirconia/Alumina Nanocomposite on Osteogenesis and Osseointegration. Int. J. Oral Maxillofac. Implant. 2017, 32, 81–91. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Representative SEM images of Ti (AC), 3Y-TZP (DF), and NANO-Zr (GI) samples with different magnifications. Bars indicate 10 µm (A,D,G), 2 µm (B,E,H), and 400 nm (C,F,I), respectively.
Figure 1. Representative SEM images of Ti (AC), 3Y-TZP (DF), and NANO-Zr (GI) samples with different magnifications. Bars indicate 10 µm (A,D,G), 2 µm (B,E,H), and 400 nm (C,F,I), respectively.
Coatings 14 01460 g001
Figure 2. Sample surface characterization. EDS elemental mapping of Ti (A), 3Y-TZP (B), and NANO-Zr (C) respectively. EDS energy spectrum (D), surface roughness (E,F), and contact angle detection (G) of different samples. Data are expressed as the mean ± standard deviation (n = 3). * indicates statistical significance p < 0.05 vs. Ti groups.
Figure 2. Sample surface characterization. EDS elemental mapping of Ti (A), 3Y-TZP (B), and NANO-Zr (C) respectively. EDS energy spectrum (D), surface roughness (E,F), and contact angle detection (G) of different samples. Data are expressed as the mean ± standard deviation (n = 3). * indicates statistical significance p < 0.05 vs. Ti groups.
Coatings 14 01460 g002
Figure 3. Macrophage adhesion and morphology on the surface of different samples. (A) Fluorescent staining of the cytoskeleton. (B) 24-h adherent cell counting. (C) 2-h cell adhesion rate. (D) Morphological observation. Panels d1, d3, and d5 represented macrophages on the Ti, 3Y-TZP, and NANO-Zr surfaces, respectively, while d2, d4, and d6 showed correspondingly higher magnification images. Data are expressed as the mean ± standard deviation (n = 3). * and # indicate statistical significance p < 0.05 vs. Ti and 3Y-TZP groups, respectively.
Figure 3. Macrophage adhesion and morphology on the surface of different samples. (A) Fluorescent staining of the cytoskeleton. (B) 24-h adherent cell counting. (C) 2-h cell adhesion rate. (D) Morphological observation. Panels d1, d3, and d5 represented macrophages on the Ti, 3Y-TZP, and NANO-Zr surfaces, respectively, while d2, d4, and d6 showed correspondingly higher magnification images. Data are expressed as the mean ± standard deviation (n = 3). * and # indicate statistical significance p < 0.05 vs. Ti and 3Y-TZP groups, respectively.
Coatings 14 01460 g003
Figure 4. Macrophage proliferation and polarization on the surface of different samples. (A) Cell proliferation of macrophages. Pro-inflammatory (B) and pro-restorative (C) gene expression levels in macrophages. Data are expressed as the mean ± standard deviation (n = 3). * and # indicate statistical significance p < 0.05 vs. Ti and 3Y-TZP groups, respectively.
Figure 4. Macrophage proliferation and polarization on the surface of different samples. (A) Cell proliferation of macrophages. Pro-inflammatory (B) and pro-restorative (C) gene expression levels in macrophages. Data are expressed as the mean ± standard deviation (n = 3). * and # indicate statistical significance p < 0.05 vs. Ti and 3Y-TZP groups, respectively.
Coatings 14 01460 g004
Figure 5. Osteoblast adhesion and morphology cultured with different samples in macrophage CM for 1 day. (A) Fluorescent staining of cytoskeleton. (B) Adherent cell counting. (C) Morphological observation. Panels c1, c3, and c5 showed the morphology of MC3T3-E1 cells on Ti, 3Y-TZP, and NANO-Zr surfaces, respectively. Panels c2, c4, and c6 were high-magnification images of panels c1, c3, and c5, respectively. Data are expressed as the mean ± standard deviation (n = 3). * indicates statistical significance p < 0.05 vs. Ti groups.
Figure 5. Osteoblast adhesion and morphology cultured with different samples in macrophage CM for 1 day. (A) Fluorescent staining of cytoskeleton. (B) Adherent cell counting. (C) Morphological observation. Panels c1, c3, and c5 showed the morphology of MC3T3-E1 cells on Ti, 3Y-TZP, and NANO-Zr surfaces, respectively. Panels c2, c4, and c6 were high-magnification images of panels c1, c3, and c5, respectively. Data are expressed as the mean ± standard deviation (n = 3). * indicates statistical significance p < 0.05 vs. Ti groups.
Coatings 14 01460 g005
Figure 6. Osteoblast proliferation, differentiation, and mineralization performance of different samples in macrophage CM. (A) Cell proliferation. (B) Quantitative analysis of alkaline phosphatase (ALP). Images (C) and semi-quantitative analysis (D) of Alizarin red staining. Data are expressed as the mean ± standard deviation (n = 3). * and # indicate statistical significance p < 0.05 vs. Ti and 3Y-TZP groups, respectively.
Figure 6. Osteoblast proliferation, differentiation, and mineralization performance of different samples in macrophage CM. (A) Cell proliferation. (B) Quantitative analysis of alkaline phosphatase (ALP). Images (C) and semi-quantitative analysis (D) of Alizarin red staining. Data are expressed as the mean ± standard deviation (n = 3). * and # indicate statistical significance p < 0.05 vs. Ti and 3Y-TZP groups, respectively.
Coatings 14 01460 g006
Table 1. The mechanical and other properties of the samples used in this study.
Table 1. The mechanical and other properties of the samples used in this study.
CodeProduct Name CompositionDensity (g/cm3)Hardness (Vickers)Flexural Strength (MPa)Fracture Toughness (MPa m1/2)Elastic Modulus (GPa)Manufacturer
NANO-ZrP-NANO-Zr70 vol% 10 mol CeO2-ZrO2
30 vol% Al2O3
5.531160150018 245Panasonic Health Care
Co., Ltd.
Tokyo, Japan
3Y-TZPAadva Zr3 mol Y2O3-ZrO26.05125012009.5 210GC Co., Ltd.
Tokyo, Japan
TiASTM F67
unalloyed Ti, grade 2
99.7% titanium-----Baoji Lian Zhong Titanium Metal Material Co., Ltd., Baoji, China
Note: The above information of the material is provided by the manufacturer.
Table 2. Primers for real-time PCR analysis.
Table 2. Primers for real-time PCR analysis.
GeneDNA PrimerSequence (5′ to 3′)
IL-6ForwardCCAGAGATACAAAGAAATGATGG
ReverseACTCCAGAAGACCAGAGGAAAT
TNF-αForwardTGCCTATGTCTCAGCCTCTTC
ReverseGAGGCCATTTGGGAACTTCT
IL-10ForwardGCCAGAGCCACATGCTCCTA
ReverseGTCCAGCTGGTCCTTTGTTTG
TGF-βForwardTTGCTTCAGCTCCACAGAGA
ReverseTGGTTGTAGAGGGCAAGGAC
GAPDHForwardGGTGAAGGTCGGTGTGAACG
ReverseCTCGCTCCTGGAAGATGGTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tian, Y.; Song, Y.; Lan, S.; Geng, R.; Wang, M.; Li, S.; Han, J.; Bai, H.; Hong, G.; Li, Y. Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization. Coatings 2024, 14, 1460. https://doi.org/10.3390/coatings14111460

AMA Style

Tian Y, Song Y, Lan S, Geng R, Wang M, Li S, Han J, Bai H, Hong G, Li Y. Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization. Coatings. 2024; 14(11):1460. https://doi.org/10.3390/coatings14111460

Chicago/Turabian Style

Tian, Yuan, Yunjia Song, Suli Lan, Ruoting Geng, Muxiang Wang, Sanwen Li, Jianmin Han, Hong Bai, Guang Hong, and Ying Li. 2024. "Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization" Coatings 14, no. 11: 1460. https://doi.org/10.3390/coatings14111460

APA Style

Tian, Y., Song, Y., Lan, S., Geng, R., Wang, M., Li, S., Han, J., Bai, H., Hong, G., & Li, Y. (2024). Ceria-Stabilized Zirconia/Alumina Nanocomposite (NANO-Zr) Surface Enhances Osteogenesis Through Regulation of Macrophage Polarization. Coatings, 14(11), 1460. https://doi.org/10.3390/coatings14111460

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop