Hydroxyapatite–Silicon Scaffold Promotes Osteogenic Differentiation of CGF Primary Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. HA-Si Scaffold Fabrication and Characterization
2.2. Preparation of CGF and Culture of CGF Primary Cells
2.3. Proliferation Assay
2.4. Osteogenic Differentiation Process
2.5. SEM Analysis
- HA-Si scaffold not incubated in the presence of CGF pieces, used as a negative control;
- HA-Si scaffold incubated with CGF for 21 days in BM;
- HA-Si scaffold incubated with CGF for 21 days in OM.
2.6. Alizarin Red Staining
2.7. DNA Quantification
2.8. Real-Time PCR
- Undifferentiated CGF primary cells, used as a negative control;
- CGF primary cells grown on HA-Si scaffolds for 21 days in BM;
- CGF primary cells grown on HA-Si scaffolds for 21 days in OM.
2.9. Statistical Analysis
3. Results
3.1. HA-Si Scaffold Characterizations
3.2. HA-Si Scaffold Biocompatibility for CGF Primary Cells
3.3. Effect of HA-Si Scaffolds on Matrix Mineralization of CGF Primary Cells
3.4. Effects of HA-Si Scaffolds on Osteogenic Differentiation Markers of CGF Primary Cells
3.5. Structural Characterization of CGF Primary Cells Grown on HA-Si Scaffolds
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rodella, L.F.; Favero, G.; Boninsegna, R.; Buffoli, B.; Labanca, M.; Scarì, G.; Sacco, L.; Batani, T.; Rezzani, R. Growth factors, CD34 positive cells, and fibrin network analysis in concentrated growth factors fraction. Microsc. Res. Tech. 2011, 74, 772–777. [Google Scholar] [CrossRef]
- Stanca, E.; Calabriso, N.; Giannotti, L.; Nitti, P.; Damiano, F.; Stanca, B.D.C.; Carluccio, M.A.; De Benedetto, G.E.; Demitri, C.; Palermo, A.; et al. Analysis of CGF Biomolecules, Structure and Cell Population: Characterization of the Stemness Features of CGF Cells and Osteogenic Potential. Int. J. Mol. Sci. 2021, 22, 8867. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Sun, X.; Yu, J.; Wang, J.; Zhai, P.; Chen, S.; Liu, M.; Zhou, Y. Platelet-Rich Fibrin as a Bone Graft Material in Oral and Maxillofacial Bone Regeneration: Classification and Summary for Better Application. BioMed. Res. Int. 2019, 2019, 3295756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kobayashi, E.; Flückiger, L.; Fujioka-Kobayashi, M.; Sawada, K.; Sculean, A.; Schaller, B.; Miron, R.J. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clin. Oral. Investig. 2016, 20, 2353–2360. [Google Scholar] [CrossRef] [PubMed]
- Masuki, H.; Okudera, T.; Watanebe, T.; Suzuki, M.; Nishiyama, K.; Okudera, H.; Nakata, K.; Uematsu, K.; Su, C.Y.; Kawase, T. Growth factor and pro-inflammatory cytokine contents in platelet-rich plasma (PRP), plasma rich in growth factors (PRGF), advanced platelet-rich fibrin (A-PRF), and concentrated growth factors (CGF). Int. J. Implant Dent. 2016, 2, 19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choukroun, J. Advanced PRF, &i-PRF: Platelet concentrates or blood concentrates? J. Periodont. Med. Clin. Pract. 2014, 1, 3. [Google Scholar]
- Sacco, L. Lecture, International Academy of implant prosthesis and osteoconnection. Lecture 2006, 12, 4. [Google Scholar]
- Sohn, D.S.; Heo, J.U.; Kwak, D.H.; Kim, D.E.; Kim, J.M.; Moon, J.W.; Lee, J.H.; Park, I.S. Bone regeneration in the maxillary sinus using an autologous fibrin-rich block with concentrated growth factors alone. Implant. Dent. 2011, 20, 389–395. [Google Scholar] [CrossRef] [Green Version]
- Bernardi, S.; Mummolo, S.; Tecco, S.; Continenza, M.A.; Marzo, G. Histological characterization of Sacco’s concentrated growth factors membrane. Int. J. Morphol. 2017, 35, 114–119. [Google Scholar] [CrossRef] [Green Version]
- Rochira, A.; Siculella, L.; Damiano, F.; Palermo, A.; Ferrante, F.; Carluccio, M.A.; Calabriso, N.; Giannotti, L.; Stanca, E. Concentrated Growth Factors (CGF) Induce Osteogenic Differentiation in Human Bone Marrow Stem Cells. Biology 2020, 9, 370. [Google Scholar] [CrossRef]
- Honda, H.; Tamai, N.; Naka, N.; Yoshikawa, H.; Myoui, A. Bone tissue engineering with bone marrow-derived stromal cells integrated with concentrated growth factor in Rattus norvegicus calvaria defect model. J. Artif. Organs. 2013, 16, 305–315. [Google Scholar] [CrossRef] [PubMed]
- Borsani, E.; Bonazza, V.; Buffoli, B.; Cocchi, M.A.; Castrezzati, S.; Scarì, G.; Baldi, F.; Pandini, S.; Licenziati, S.; Parolini, S.; et al. Biological Characterization and In Vitro Effects of Human Concentrated Growth Factor Preparation: An Innovative Approach to Tissue Regeneration. Biol. Med. 2015, 7, 256. [Google Scholar] [CrossRef] [Green Version]
- Calabriso, N.; Stanca, E.; Rochira, A.; Damiano, F.; Giannotti, L.; Di Chiara Stanca, B.; Massaro, M.; Scoditti, E.; Demitri, C.; Nitti, P.; et al. Angiogenic Properties of Concentrated Growth Factors (CGFs): The Role of Soluble Factors and Cellular Components. Pharmaceutics 2021, 13, 635. [Google Scholar] [CrossRef] [PubMed]
- Tabatabaei, F.; Aghamohammadi, Z.; Tayebi, L. In vitro and in vivo effects of concentrated growth factor on cells and tissues. J. Biomed. Mater. Res. A 2020, 108, 1338–1350. [Google Scholar] [CrossRef]
- Anghelina, M.; Krishnan, P.; Moldovan, L.; Moldovan, N.I. Monocytes/macrophages cooperate with progenitor cells during neovascularization and tissue repair. Am. J. Pathol. 2006, 168, 529–541. [Google Scholar] [CrossRef] [Green Version]
- Manole, E.; Niculite, C.; Lambrescu, I.M.; Gaina, G.; Ioghen, O.; Ceafalan, L.C.; Hinescu, M.E. Macrophages and Stem Cells-Two to Tango for Tissue Repair? Biomolecules 2021, 11, 697. [Google Scholar] [CrossRef]
- Ho-Shui-Ling, A.; Bolander, J.; Rustom, L.E.; Johnson, A.W.; Luyten, F.; Picart, C. Bone regeneration strategies: Engineered scaffolds, bioactive molecules and stem cells current stage and future perspectives. Biomaterials 2018, 180, 143–162. [Google Scholar] [CrossRef]
- Ansari, M. Bone tissue regeneration: Biology, strategies and interface studies. Prog. Biomater. 2019, 8, 223–237. [Google Scholar] [CrossRef] [Green Version]
- Bružauskaite, I.; Bironaitė, D.; Bagdonas, E.; Bernotienė, E. Scaffolds and Cells for Tissue Regeneration: Different Scaffold Pore Sizes—Different Cell Effects. Cytotechnology 2016, 68, 355–369. [Google Scholar] [CrossRef] [Green Version]
- Abbasi, N.; Hamlet, S.; Love, R.M.; Nguyen, N.-T. Porous Scaffolds for Bone Regeneration. J. Sci. Adv. Mater. Devices 2020, 5, 1–9. [Google Scholar] [CrossRef]
- Kim, S.R.; Lee, J.H.; Kim, Y.T.; Riu, D.H.; Jung, S.J.; Lee, Y.J.; Chung, S.C.; Kim, Y.H. Synthesis of Si, Mg Substituted Hydroxyap-atites and Their Sintering Behaviors. Biomaterials 2003, 24, 1389–1398. [Google Scholar] [CrossRef] [PubMed]
- Kunjalukkal Padmanabhan, S.; Nitti, P.; Stanca, E.; Rochira, A.; Siculella, L.; Raucci, M.G.; Madaghiele, M.; Licciulli, A.; Demitri, C. Mechanical and Biological Properties of Magnesium- and Silicon-Substituted Hydroxyapatite Scaffolds. Materials 2021, 14, 6942. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Liu, X.; She, H.; Wang, R.; Bai, F.; Xiang, B. A silk fibroin/chitosan/nanohydroxyapatite biomimetic bone scaffold combined with autologous concentrated growth factor promotes the proliferation and osteogenic differentiation of BMSCs and repair of critical bone defects. Regen. Ther. 2022, 21, 307–321. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Tong, S.; Huang, S.; Ma, L.; Liu, Z.; Zhang, D. Application of a New Type of Natural Calcined Bone Repair Material Combined with Concentrated Growth Factors in Bone Regeneration in Rabbit Critical-Sized Calvarial Defect. Biomed. Res. Int. 2020, 2020, 8810747. [Google Scholar] [CrossRef] [PubMed]
- Nitti, P.; Padmanabhan, S.K.; Cortazzi, S.; Stanca, E.; Siculella, L.; Licciulli, A.; Demitri, C. Enhancing Bioactivity of Hydroxyapatite Scaffolds Using Fibrous Type I Collagen. Front. Bioeng. Biotechnol. 2021, 9, 631177. [Google Scholar] [CrossRef]
- Friuli, M.; Nitti, P.; Aneke, C.I.; Demitri, C.; Cafarchia, C.; Otranto, D. Freeze-drying of Beauveria bassiana suspended in Hydroxyethyl cellulose based hydrogel as possible method for storage: Evaluation of survival, growth and stability of conidial concentration before and after processing. Results Eng. 2021, 12, 100283. [Google Scholar] [CrossRef]
- Nitti, P.; Gallo, N.; Palazzo, B.; Sannino, A.; Polini, A.; Verri, T.; Barca, A.; Gervaso, F. Effect of L-Arginine treatment on the in vitro stability of electrospun aligned chitosan nanofiber mats. Polym. Test. 2020, 91, 106758. [Google Scholar] [CrossRef]
- Friuli, M.; Nitti, P.; Madaghiele, M.; Demitri, C. A possible method to avoid skin effect in polymeric scaffold produced through thermally induced phase separation. Results Eng. 2021, 12, 100282. [Google Scholar] [CrossRef]
- Khani, F.; Thaler, R.; Paradise, C.R.; Deyle, D.R.; Kruijthof-de Julio, M.; Galindo, M.; Gordon, J.A.; Stein, G.S.; Dudakovic, A.; Van Wijnen, A.J. Histone H4 Methyltransferase Suv420h2 Maintains Fidelity of Osteoblast Differentiation. J. Cell. Biochem. 2017, 118, 1262–1272. [Google Scholar] [CrossRef] [Green Version]
- Silva, L.P.; Lorenzi, P.L.; Purwaha, P.; Yong, V.; Hawke, D.H.; Weinstein, J.N. Measurement of DNA concentration as a normalization strategy for metabolomic data from adherent cell lines. Anal. Chem. 2013, 85, 9536–9542. [Google Scholar] [CrossRef] [Green Version]
- Xing, H.; Yin, H.; Sun, C.; Ren, X.; Tian, Y.; Yu, M.; Jiang, T. Preparation of an acellular spinal cord scaffold to improve its biological properties. Mol. Med. Rep. 2019, 20, 1075–1084. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palermo, A.; Giannotti, L.; Di Chiara Stanca, B.; Ferrante, F.; Gnoni, A.; Nitti, P.; Calabriso, N.; Demitri, C.; Damiano, F.; Batani, T.; et al. Use of CGF in Oral and Implant Surgery: From Laboratory Evidence to Clinical Evaluation. Int. J. Mol. Sci. 2022, 23, 15164. [Google Scholar] [CrossRef] [PubMed]
- Di Liddo, R.; Bertalot, T.; Borean, A.; Pirola, I.; Argentoni, A.; Schrenk, S.; Cenzi, C.; Capelli, S.; Conconi, M.T.; Parnigotto, P.P. Leucocyte and Platelet-rich Fibrin: A carrier of autologous multipotent cells for regenerative medicine. J. Cell. Mol. Med. 2018, 22, 1840–1854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barbon, S.; Stocco, E.; Grandi, F.; Rajendran, S.; Borean, A.; Pirola, I.; Capelli, S.; Bagno, A.; Tavano, R.; Contran, M.; et al. Biofabrication of a novel leukocyte-fibrin-platelet membrane as a cells and growth factors delivery platform for tissue engineering applications. J. Tissue. Eng. Regen. Med. 2018, 12, 1891–1906. [Google Scholar] [CrossRef]
- Caloprisco, G.; Borean, A.; De Angeli, S.; Gaio, G.B.; Boito, K.; Del Pup, L.; Pavan, E.; Casale, V.; Varinelli, I. New method to produce hemocomponents for regenerative use from peripheral blood: Integration among platelet growth factors monocytes and stem cells. Transfus. Apher. Sci. 2010, 42, 117–124. [Google Scholar] [CrossRef]
- Chen, X.; Wang, J.; Yu, L.; Zhou, J.; Zheng, D.; Zhang, B. Effect of Concentrated Growth Factor (CGF) on the promotion of osteogenesis in Bone Marrow Stromal Cells (BMSC) in vivo. Sci. Rep. 2018, 8, 5876. [Google Scholar] [CrossRef] [Green Version]
- Pirraco, R.P.; Reis, R.L.; Marques, A.P. Effect of monocytes/macrophages on the early osteogenic differentiation of hBMSCs. J. Tissue Eng. Regen. Med. 2012, 7, 392–400. [Google Scholar] [CrossRef] [Green Version]
- Rutkovskiy, A.; Stensløkken, K.-O.; Vaage, I.J. Osteoblast differentiation at a glance. Med. Sci. Monit. Basic Res. 2016, 22, 95–106. [Google Scholar] [CrossRef] [Green Version]
- Kuwana, M.; Okazaki, Y.; Kodama, H.; Izumi, K.; Yasuoka, H.; Ogawa, Y.; Kawakami, Y.; Ikeda, Y. Human circulating CD14+ monocytes as a source of progenitors that exhibit mesenchymal cell differentiation. J. Leukoc. Biol. 2003, 74, 833–845. [Google Scholar] [CrossRef]
- Samavedi, S.; Poindexter, L.K.; Van Dyke, M.; Goldstein, A.S. Chapter 7—Synthetic biomaterials for regenerative medicine applications. In Regenerative Medicine Applications in Organ Transplantation; Orlando, G., Lerut, J., Soker, S., Stratta, R.J., Eds.; Academic Press: Boston, MA, USA, 2014; pp. 81–99. [Google Scholar] [CrossRef]
- Langenbach, F.; Handschel, J. Effects of dexamethasone, ascorbic acid and β-glycerophosphate on the osteogenic differentiation of stem cells in vitro. Stem Cell Res. Ther. 2013, 4, 117. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Accession Number | Sequences (5′-3′) | pb |
---|---|---|---|
PTPRC (CD45) | NM_080921.3 | F: atgaccatgtatttgtggctta R: tgggggaaggtgttgggc | 97 |
Endoglin (CD105) | NM_001278138.1 | F: gccagcattgtctcacttca R: atgcgcaacaagctctttct | 180 |
RunX2 | NM_001278478.2 | F: gacaaccgcaccatggtgg R: tctggtacctctccgaggg | 160 |
OCN | NM_199173.6 | F: gctacctgtatcaatggct R: cgatgtggtcagccaactc | 111 |
GAPDH | AJ005371.1 | F: atggccttccgtgtccccac R: acgcctgcttcaccaccttc | 245 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Giannotti, L.; Di Chiara Stanca, B.; Nitti, P.; Spedicato, F.; Damiano, F.; Demitri, C.; Calabriso, N.; Carluccio, M.A.; Palermo, A.; Ferrante, F.; et al. Hydroxyapatite–Silicon Scaffold Promotes Osteogenic Differentiation of CGF Primary Cells. Biology 2023, 12, 528. https://doi.org/10.3390/biology12040528
Giannotti L, Di Chiara Stanca B, Nitti P, Spedicato F, Damiano F, Demitri C, Calabriso N, Carluccio MA, Palermo A, Ferrante F, et al. Hydroxyapatite–Silicon Scaffold Promotes Osteogenic Differentiation of CGF Primary Cells. Biology. 2023; 12(4):528. https://doi.org/10.3390/biology12040528
Chicago/Turabian StyleGiannotti, Laura, Benedetta Di Chiara Stanca, Paola Nitti, Francesco Spedicato, Fabrizio Damiano, Christian Demitri, Nadia Calabriso, Maria Annunziata Carluccio, Andrea Palermo, Franco Ferrante, and et al. 2023. "Hydroxyapatite–Silicon Scaffold Promotes Osteogenic Differentiation of CGF Primary Cells" Biology 12, no. 4: 528. https://doi.org/10.3390/biology12040528