Proteomics-Based Investigation of Different Live Prey Administered to Freshwater Dark Sleeper (Odontobutis potamophila): Examining the Effects on Glycolipids and Energy Metabolism
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Conditions
2.2. Experimental Diets
2.3. Sample Collection
2.4. RNA Extraction and Sequencing
2.5. Protein Collection and Isolation
2.6. Protein Digestion and TMT Labeling
2.7. Liquid Chromatography with Tandem Mass Spectrometry (LC-MS/MS)
2.8. Protein Quantification and Bioinformatics Analysis
2.9. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Differentially Expressed Genes
3.3. DEP Identification in O. potamophila Larvae
3.4. Functional Enrichment Analysis of DEPs in O. potamophila Larvae
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bergeon, L.; Azémar, F.; Carré, C.; Dubillot, B.; Emery, C.; Agogué, H.; Pineau, P.; Lacoue-Labarthe, T.; Bouvy, M.; Tackx, M.; et al. Distribution and trophic functioning of planktonic communities in coastal marshes in Atlantic Coast of France. Estuarine Coast. Shelf Sci. 2023, 291, 108430. [Google Scholar] [CrossRef]
- de Bernardi, R.; Giussani, G.; Manca, M. Cladocera: Predators and prey. Hydrobiologia 1987, 145, 225–243. [Google Scholar] [CrossRef]
- Forró, L.; Korovchinsky, N.M.; Kotov, A.A.; Petrusek, A. Global diversity of cladocerans (Cladocera; Crustacea) in freshwater. Hydrobiologia 2007, 595, 177–184. [Google Scholar] [CrossRef]
- Olivotto, I.; Rollo, A.; Sulpizio, R.; Avella, M.; Tosti, L.; Carnevali, O. Breeding and rearing the Sunrise Dottyback Pseudochromis flavivertex: The importance of live prey enrichment during larval development. Aquaculture 2006, 255, 480–487. [Google Scholar] [CrossRef]
- Cahu, C.; Infante, J.Z. Substitution of live food by formulated diets in marine fish larvae. Aquaculture 2001, 200, 161–180. [Google Scholar] [CrossRef]
- Donadelli, V.; Longobardi, A.; Finoia, M.G.; Marino, G. Feeding hatchery-reared dusky grouper Epinephelus marginatus juveniles on live prey: Implications for restocking. Environ. Biol. Fishes 2015, 98, 1757–1766. [Google Scholar] [CrossRef]
- Duy Khoa, T.N.; Waqalevu, V.; Honda, A.; Shiozaki, K.; Kotani, T. Comparative study on early digestive enzyme activity and expression in red sea bream (Pagrus major) fed on live feed and micro-diet. Aquaculture 2020, 519, 734721. [Google Scholar] [CrossRef]
- Pascual, E.; Fernández-Diaz, C.; Yúfera, M. Feeding behaviour and prey size selection of gilthead seabream, Sparus aurata, larvae fed on inert and live food. Mar. Biol. 1994, 118, 323–328. [Google Scholar]
- Irvine, J.R.; Northcote, T.G. Selection by Young Rainbow Trout (Salmo gairdneri) in Simulated Stream Environments For Live and Dead Prey of Different Sizes. Can. J. Fish. Aquat. Sci. 1983, 40, 1745–1749. [Google Scholar] [CrossRef]
- Arndt, C.; Sommer, U.; Ueberschär, B. A comparative in-vitro-test on the digestibility of live prey for fish larvae under specific consideration of trypsin. Aquaculture 2015, 446, 12–16. [Google Scholar] [CrossRef]
- Liao, I.C.; Su, H.M.; Chang, E.Y. Techniques in finfish larviculture in Taiwan. Aquaculture 2001, 200, 1–31. [Google Scholar] [CrossRef]
- Holm, J.C. Yolk sac absorption and early food selection in Atlantic salmon feeding on live prey. Aquaculture 1986, 54, 173–183. [Google Scholar]
- Kolkovski, S. Digestive enzymes in fish larvae and juveniles—Implications and applications to formulated diets. Aquaculture 2001, 200, 181–201. [Google Scholar] [CrossRef]
- Holm, J.C.; Møller, D. Growth and prey selection by Atlantic salmon yearlings reared on live freshwater zooplankton. Aquaculture 1984, 43, 401–412. [Google Scholar] [CrossRef]
- Ondiba, R.N.; Ogello, E.O.; Kembenya, E.; Gichana, Z.; Obiero, K. Future demand and supply of aquafeed ingredients: Outlines to commercialize non-conventional protein ingredients to enhance aquaculture production for food security in sub-Saharan Africa. Aquat. Ecosyst. Health Manag. 2022, 25, 75–84. [Google Scholar] [CrossRef]
- Rasdi, N.W.; Qin, J.G. Improvement of copepod nutritional quality as live food for aquaculture: A review. Aquac. Res. 2014, 47, 1–20. [Google Scholar] [CrossRef]
- Liu, G.; Zhu, C.; Gao, X.; Zheng, Y.; Zhu, X.; Jiang, H.; Wei, W.; Jiang, Q.; Zhang, X. Single-cell transcriptome analysis reveals a cellular immune response in freshwater dark sleeper (Odontobutis potamophila) after infection with Aeromonas veronii. Front. Physiol. 2023, 14, 1201914. [Google Scholar] [CrossRef] [PubMed]
- He, S.; You, J.-J.; Liang, X.-F.; Zhang, Z.-L.; Zhang, Y.-P. Transcriptome sequencing and metabolome analysis of food habits domestication from live prey fish to artificial diets in mandarin fish (Siniperca chuatsi). BMC Genom. 2021, 22, 129. [Google Scholar] [CrossRef]
- Korovchinsky, N.M. How many species of Cladocera are there? Hydrobiologia 1996, 321, 191–204. [Google Scholar] [CrossRef]
- Elissen, H.; Mulder, W.; Hendrickx, T.; Elbersen, H.; Beelen, B.; Temmink, H.; Buisman, C. Aquatic worms grown on biosolids: Biomass composition and potential applications. Bioresour. Technol. 2010, 101, 804–811. [Google Scholar] [CrossRef]
- Hansen, J.A.; Lipton, J.; Welsh, P.G.; Cacela, D.; MacConnell, B. Reduced growth of rainbow trout (Oncorhynchus mykiss) fed a live invertebrate diet pre-exposed to metal-contaminated sediments. Environ. Toxicol. Chem. 2004, 23, 1902–1911. [Google Scholar] [CrossRef] [PubMed]
- Naseri, M.; Abedi, E.; Mohammadzadeh, B.; Afsharnaderi, A. Effect of frying in different culinary fats on the fatty acid composition of silver carp. Food Sci. Nutr. 2013, 1, 292–297. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Hou, Y.; Zhang, M.; Hou, P.; Liu, C.; Dou, L.; Chen, X.; Zhao, L.; Su, L.; Jin, Y. Unraveling proteome changes of Sunit lamb meat in different feeding regimes and its relationship to flavor analyzed by TMT-labeled quantitative proteomic. Food Chem. 2023, 437, 137657. [Google Scholar] [CrossRef]
- Chen, X.; Sun, C.; Dong, J.; Li, W.; Tian, Y.; Hu, J.; Ye, X. Comparative Analysis of the Gut Microbiota of Mandarin Fish (Siniperca chuatsi) Feeding on Compound Diets and Live Baits. Front. Genet. 2022, 13, 797420. [Google Scholar] [CrossRef] [PubMed]
- Stejskal, V.; Gebauer, T.; Sebesta, R.; Nowosad, J.; Sikora, M.; Biegaj, M.; Kucharczyk, D. Effect of feeding strategy on survival, growth, intestine development, and liver status of maraena whitefish Coregonus maraena larvae. J. World Aquac. Soc. 2021, 52, 829–842. [Google Scholar] [CrossRef]
- Agbu, P.; Carthew, R.W. MicroRNA-mediated regulation of glucose and lipid metabolism. Nat. Rev. Mol. Cell Biol. 2021, 22, 425–438. [Google Scholar] [CrossRef] [PubMed]
- Evans, R.L.; Amatuzio, D.S. Protein Metabolism and Interactions. Science 1953, 118, 558–560. [Google Scholar] [CrossRef] [PubMed]
- Furuta, E.; Pai, S.K.; Zhan, R.; Bandyopadhyay, S.; Watabe, M.; Mo, Y.-Y.; Hirota, S.; Hosobe, S.; Tsukada, T.; Miura, K.; et al. Fatty Acid Synthase Gene Is Up-regulated by Hypoxia via Activation of Akt and Sterol Regulatory Element Binding Protein-1. Cancer Res. 2008, 68, 1003–1011. [Google Scholar] [CrossRef]
- Pour, N.J.A.; Zabihi-Mahmoudabadi, H.; Ebrahimi, R.; Yekaninejad, M.S.; Hashemnia, S.M.R.; Meshkani, R.; Emamgholipour, S. Principal component analysis of adipose tissue gene expression of lipogenic and adipogenic factors in obesity. BMC Endocr. Disord. 2023, 23, 94. [Google Scholar]
- Sekiya, M.; Yahagi, N.; Matsuzaka, T.; Najima, Y.; Nakakuki, M.; Nagai, R.; Ishibashi, S.; Osuga, J.-I.; Yamada, N.; Shimano, H. Polyunsaturated fatty acids ameliorate hepatic steatosis in obese mice by SREBP-1 suppression. Hepatology 2003, 38, 1529–1539. [Google Scholar] [CrossRef]
- Sargent, J.R. Fish oils and human diet. Br. J. Nutr. 1997, 78, S5–S13. [Google Scholar] [CrossRef] [PubMed]
- Gnoni, A.; Giudetti, A.M. Dietary long-chain unsaturated fatty acids acutely and differently reduce the activities of lipogenic enzymes and of citrate carrier in rat liver. J. Physiol. Biochem. 2016, 72, 485–494. [Google Scholar] [CrossRef] [PubMed]
- Gosmain, Y.; Dif, N.; Berbe, V.; Loizon, E.; Rieusset, J.; Vidal, H.; Lefai, E. Regulation of SREBP-1 expression and transcriptional action on HKII and FAS genes during fasting and refeeding in rat tissues. J. Lipid Res. 2005, 46, 697–705. [Google Scholar] [CrossRef] [PubMed]
- Deng, W.; Yu, H.-B.; Sun, J.; Chang, Z.-G.; Gou, N.-N.; Huang, C.-C.; Zhao, J.-L.; Zhou, J.-S.; Ji, H. Molecular characterization and tissue distribution of SREBP-1 and PPARα in Onychostoma macrolepis and their mRNA expressions in response to thermal exposure. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2019, 230, 16–27. [Google Scholar] [CrossRef]
- Ma, L.; Zhang, J.; Qiao, Y.; Sun, X.; Mao, T.; Lei, S.; Zheng, Q.; Liu, Y. Intermittent Hypoxia Composite Abnormal Glucose Metabolism-Mediated Atherosclerosis In Vitro and In Vivo: The Role of SREBP-1. Oxidative Med. Cell. Longev. 2019, 2019, e4862760. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Zhu, J.; Wang, W.; Ruan, P.; Rajeshkumar, S.; Li, X. Biochemical and molecular impacts of glyphosate-based herbicide on the gills of common carp. Environ. Pollut. 2019, 252, 1288–1300. [Google Scholar] [CrossRef] [PubMed]
- Yin, X.; Liao, W.; Li, Q.; Zhang, H.; Liu, Z.; Zheng, X.; Zheng, L.; Feng, X. Interactions between resveratrol and gut microbiota affect the development of hepatic steatosis: A fecal microbiota transplantation study in high-fat diet mice. J. Funct. Foods 2020, 67, 103883. [Google Scholar] [CrossRef]
- Aleksic, M.; Golic, I.; Jankovic, A.; Cvoro, A.; Korac, A. ACOX-driven peroxisomal heterogeneity and functional compartmentalization in brown adipocytes of hypothyroid rats. R. Soc. Open Sci. 2023, 10, 230109. [Google Scholar] [CrossRef]
- Kim, S.; Kim, K.J. Crystal Structure of Acyl-CoA Oxidase 3 from Yarrowia lipolytica with Specificity for Short-Chain Acyl-CoA. J. Microbiol. Biotechnol. 2018, 28, 597–605. [Google Scholar] [CrossRef]
- Zhang, Q.; Jiang, Q.; Zhang, X.; Wang, D. Model test on development characteristics and displacement variation of water and mud inrush on tunnel in fault fracture zone. Nat. Hazards 2019, 99, 467–492. [Google Scholar] [CrossRef]
- Madureira, T.V.; Castro, L.F.C.; Rocha, E. Acyl-coenzyme A oxidases 1 and 3 in brown trout (Salmo trutta f. fario): Can peroxisomal fatty acid β-oxidation be regulated by estrogen signaling? Fish Physiol. Biochem. 2016, 42, 389–401. [Google Scholar] [CrossRef] [PubMed]
- Lopes-Marques, M.; Delgado, I.L.S.; Ruivo, R.; Torres, Y.; Sainath, S.B.; Rocha, E.; Cunha, I.; Santos, M.M.; Castro, L.F.C. The Origin and Diversity of Cpt1 Genes in Vertebrate Species. PLoS ONE 2015, 10, e0138447. [Google Scholar] [CrossRef]
- Horibata, Y.; Sugimoto, H. Differential contributions of choline phosphotransferases CPT1 and CEPT1 to the biosynthesis of choline phospholipids. J. Lipid Res. 2021, 62, 100100. [Google Scholar] [CrossRef] [PubMed]
- Lu, Q.; Guo, P.; Liu, A.; Ares, I.; Martínez-Larrañaga, M.; Wang, X.; Anadón, A.; Martínez, M. The role of long noncoding RNA in lipid, cholesterol, and glucose metabolism and treatment of obesity syndrome. Med. Res. Rev. 2020, 41, 1751–1774. [Google Scholar] [CrossRef] [PubMed]
- Bao, C.; Zhu, S.; Song, K.; He, C. HK2: A potential regulator of osteoarthritis via glycolytic and non-glycolytic pathways. Cell Commun. Signal. 2022, 20, 132. [Google Scholar] [CrossRef]
- Addonizio, K.; Al-Samkari, H.; Glader, B.; Morton, D.H.; Chonat, S.; Thompson, A.A.; Kuo, K.H.M.; Ravindranath, Y.; Wang, H.; Rothman, J.A.; et al. Pyruvate Kinase (PK) Protein and Enzyme Levels in the Diagnosis and Clinical Phenotype of PK Deficiency. Blood 2019, 134 (Suppl. 1), 3515. [Google Scholar] [CrossRef]
- Al-Samkari, H.; Addonizio, K.; Glader, B.; Morton, D.H.; Chonat, S.; Thompson, A.A.; Kuo, K.H.M.; Ravindranath, Y.; Wang, H.; Rothman, J.A.; et al. The pyruvate kinase (PK) to hexokinase enzyme activity ratio and erythrocyte PK protein level in the diagnosis and phenotype of PK deficiency. Br. J. Haematol. 2020, 192, 1092–1096. [Google Scholar] [CrossRef] [PubMed]
- Seenappa, V.; Joshi, M.B.; Satyamoorthy, K. Intricate Regulation of Phosphoenolpyruvate Carboxykinase (PEPCK) Isoforms in Normal Physiology and Disease. Curr. Mol. Med. 2019, 19, 247–272. [Google Scholar] [CrossRef]
- Wang, T.; Geng, S.L.; Guan, Y.M.; Xu, W.H. Deacetylation of metabolic enzymes by Sirt2 modulates pyruvate homeostasis to extend insect lifespan. Aging 2018, 10, 1053–1072. [Google Scholar] [CrossRef]
- Swagell, C.D.; Morris, C.P.; Henly, D.C. Effect of fatty acids, glucose, and insulin on hepatic glucose uptake and glycolysis. Nutrition 2006, 22, 672–678. [Google Scholar] [CrossRef]
- Chen, X.; Liu, L.; Kang, S.; Gnanaprakasam, J.R.; Wang, R. The lactate dehydrogenase (LDH) isoenzyme spectrum enables optimally controlling T cell glycolysis and differentiation. Sci. Adv. 2023, 9, eadd9554. [Google Scholar] [CrossRef] [PubMed]
- Sharma, D.; Singh, M.; Rani, R. Role of LDH in tumor glycolysis: Regulation of LDHA by small molecules for cancer therapeutics. Semin. Cancer Biol. 2022, 87, 184–195. [Google Scholar] [CrossRef] [PubMed]
- Schoebel, S.; Mi, W.; Stein, A.; Ovchinnikov, S.; Pavlovicz, R.; DiMaio, F.; Baker, D.; Chambers, M.G.; Su, H.; Li, D.; et al. Cryo-EM structure of the protein-conducting ERAD channel Hrd1 in complex with Hrd3. Nature 2017, 548, 352–355. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Kim, M.J.; Hullinger, R.; O’riordan, K.J.; Burger, C.; Pehar, M.; Puglielli, L. Improved proteostasis in the secretory pathway rescues Alzheimer’s disease in the mouse. Brain 2016, 139, 937–952. [Google Scholar] [CrossRef] [PubMed]
- Hegde, R.S.; Voigt, S.; A Rapoport, T.; Lingappa, V.R. TRAM Regulates the Exposure of Nascent Secretory Proteins to the Cytosol during Translocation into the Endoplasmic Reticulum. Cell 1998, 92, 621–631. [Google Scholar] [CrossRef] [PubMed]
- Yaku, K.; Okabe, K.; Nakagawa, T. NAD metabolism: Implications in aging and longevity. Ageing Res. Rev. 2018, 47, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Katsyuba, E.; Romani, M.; Hofer, D.; Auwerx, J. NAD+ homeostasis in health and disease. Nat. Metab. 2020, 2, 9–31. [Google Scholar] [CrossRef] [PubMed]
- Shao, X.; Zhang, H.; Yang, Z.; Zhong, H.; Xia, Y.; Cai, Z. NAD tagSeq for transcriptome-wide identification and characterization of NAD+-capped RNAs. Nat. Protoc. 2020, 15, 2813–2836. [Google Scholar] [CrossRef]
- Fuchs, E.; Cleveland, D.W. A Structural Scaffolding of Intermediate Filaments in Health and Disease. Science 1998, 279, 514–519. [Google Scholar] [CrossRef]
- Etienne-Manneville, S. Cytoplasmic Intermediate Filaments in Cell Biology. Annu. Rev. Cell Dev. Biol. 2018, 34, 1–28. [Google Scholar] [CrossRef]
- Evans, R.M. Intermediate filaments and lipoprotein cholesterol. Trends Cell Biol. 1994, 4, 149–151. [Google Scholar] [CrossRef] [PubMed]
- Brini, M.; Calì, T. SERCA2 phosphorylation at the heart of the disease. Cell Calcium 2023, 115, 102784. [Google Scholar] [CrossRef] [PubMed]
- Sie, H.-G.; Hablanian, A.; Fishman, W.H. Solubilization of Mouse Liver Glycogen Synthetase and Phosphorylase during Starvation Glycogenolysis and its Reversal by Cortisol. Nature 1964, 201, 393–394. [Google Scholar] [CrossRef] [PubMed]
- Neess, D.; Kiilerich, P.; Sandberg, M.B.; Helledie, T.; Nielsen, R.; Mandrup, S. ACBP–A PPAR and SREBP modulated housekeeping gene. Mol. Cell. Biochem. 2006, 284, 149–157. [Google Scholar] [CrossRef] [PubMed]
- Shchelkunova, T.A.; Morozov, I.A.; Rubtsov, P.M.; Bobryshev, Y.V.; Sobenin, I.A.; Orekhov, A.N.; Andrianova, I.V.; Smirnov, A.N. Lipid Regulators during Atherogenesis: Expression of LXR, PPAR, and SREBP mRNA in the Human Aorta. PLoS ONE 2013, 8, e63374. [Google Scholar] [CrossRef] [PubMed]
- Garcia, D.; Shaw, R.J. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol. Cell 2017, 66, 789–800. [Google Scholar] [CrossRef]
- López, M.; Nogueiras, R.; Tena-Sempere, M.; Diéguez, C. Hypothalamic AMPK: A canonical regulator of whole-body energy balance. Nat. Rev. Endocrinol. 2016, 12, 421–432. [Google Scholar] [CrossRef]
- Zhou, Q.; Hao, B.; Cao, X.; Gao, L.; Yu, Z.; Zhao, Y.; Zhu, M.; Zhong, G.; Chi, F.; Dai, X.; et al. Energy sensor AMPK gamma regulates translation via phosphatase PPP6C independent of AMPK alpha. Mol. Cell 2022, 82, 4700–4711.e12. [Google Scholar] [CrossRef]
- Stockard, B.; Wu, H.; Guingab, J.D.; Garrett, T.J.; Rubnitz, J.; Pounds, S.; Lamba, J.K. Metabolomics Profiling Reveals Markers for Chemosensitivity and Clinical Outcomes in Pediatric AML Patients. Blood 2018, 132 (Suppl. 1), 1536. [Google Scholar] [CrossRef]
Primer | Sequence | Temperature |
---|---|---|
FAS-F | GGCAACAACACGGATGGATAC | 55 °C |
FAS-R | CTCGCTTTGATTGACAGAACAC | 55 °C |
SREBP-1-F | GAGCAAGTCTCTGAAGGATCTGGT | 55 °C |
SREBP-1-R | CCTCATCCACAAAGAAGCGGTG | 55 °C |
ACOX1-F | GATCATCGGCACCTACGCT | 55 °C |
ACOX1-R | TGACTGTGGGACTGTTCAAGAC | 55 °C |
ACOX3-F | CAGGGCAATTACTTGAGCG | 55 °C |
ACOX3-R | TTGAGGATGAAATCAGTGGGT | 55 °C |
CPT1-α-F | GCCTTTCAGTTCACCATCACA | 55 °C |
CPT1-α-R | ATGCGGCTGACTCGTTTCTT | 55 °C |
HK-F | GGGCATGAAAGGCGTGTC | 55 °C |
HK-R | TCTCCCTCGCAGCCTGAT | 55 °C |
PK-F | ACGGGTCGGTTATCTGGTTG | 55 °C |
PK-R | GCCTTTGCGACTTCCCAGA | 55 °C |
LDH-F | CGCCCTGGTGGATGTGAT | 55 °C |
LDH-R | CGATGCGGGAGTTTGCTG | 55 °C |
PEPCK-F | GGAGATGAGCTGGATGCAAATG | 55 °C |
PEPCK-R | CATCAAAGCTCTTGTGAACAA | 55 °C |
GK-F | ACAGAGTGGTGGACGAGACC | 55 °C |
GK-R | TCGTTCACCAGCTTCATCAG | 55 °C |
β-Actin-F | ATCGCCGCACTGGTTGTTGAC | 55 °C |
β-Actin-R | CCTGTTGGCTTTGGGGTTC | 55 °C |
Groups | IBW (g) | FBW (g) | WGR (%) | SGR (%) | SR (%) |
---|---|---|---|---|---|
C | 0.14 ± 0.01 | 0.49 ± 0.03 a | 263.52 ± 31.48 a | 4.60 ± 0.31 a | 0.93 ± 0.01 |
L | 0.14 ± 0.01 | 0.66 ± 0.02 b | 376.04 ± 31.23 b | 5.57 ± 0.23 b | 0.93 ± 0.01 |
H | 0.14 ± 0.01 | 0.49 ± 0.02 a | 262.27 ± 35.60 a | 4.58 ± 0.36 a | 0.92 ± 0.01 |
M | 0.14 ± 0.01 | 0.71 ± 0.04 c | 410.10 ± 25.05 b | 5.82 ± 0.18 b | 0.93 ± 0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Z.; Jiang, Q.; Zheng, Y.; Hao, C.; Ding, S.; Guo, M.; Zhao, Y.; Liu, G.; Miao, S. Proteomics-Based Investigation of Different Live Prey Administered to Freshwater Dark Sleeper (Odontobutis potamophila): Examining the Effects on Glycolipids and Energy Metabolism. Metabolites 2024, 14, 85. https://doi.org/10.3390/metabo14020085
Zhou Z, Jiang Q, Zheng Y, Hao C, Ding S, Guo M, Zhao Y, Liu G, Miao S. Proteomics-Based Investigation of Different Live Prey Administered to Freshwater Dark Sleeper (Odontobutis potamophila): Examining the Effects on Glycolipids and Energy Metabolism. Metabolites. 2024; 14(2):85. https://doi.org/10.3390/metabo14020085
Chicago/Turabian StyleZhou, Zihan, Qichen Jiang, You Zheng, Chen Hao, Shuyan Ding, Mengya Guo, Yunlong Zhao, Guoxing Liu, and Shuyan Miao. 2024. "Proteomics-Based Investigation of Different Live Prey Administered to Freshwater Dark Sleeper (Odontobutis potamophila): Examining the Effects on Glycolipids and Energy Metabolism" Metabolites 14, no. 2: 85. https://doi.org/10.3390/metabo14020085