Apocynin Prevents Anxiety-Like Behavior and Histone Deacetylases Overexpression Induced by Sub-Chronic Stress in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Drug Treatment
2.3. Forced Swim Stress
2.4. Novelty-Suppressed Feeding Test
2.5. Lipid Peroxidation Measurement
2.6. RNA Isolation and Reverse Transcription Quantitative Real-Time PCR
2.7. Western Blot
2.8. Statistical Analysis
3. Results
3.1. Apocynin Treatment Prevented the Enhancement of Anxiety-Like Phenotype Induced by FSS
3.2. Apocynin Treatment Prevented the Enhancement of Oxidative Stress Induced by FSS
3.3. Apocynin Treatment Prevented the Enhancement of Hippocampal p47phox Induced by FSS
3.4. Apocynin Treatment Prevented the Enhancement of Hippocampal Hdacs Induced by FSS
3.5. Apocynin Treatment Prevented the Reduction of Hippocampal H3 Acetylation Induced by FSS
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Leonardo, E.D.; Hen, R. Anxiety as a developmental disorder. Neuropsychopharmacology 2008, 33, 134–140. [Google Scholar] [CrossRef] [PubMed]
- Kessler, R.C.; Aguilar-Gaxiola, S.; Alonso, J.; Chatterji, S.; Lee, S.; Ormel, J.; Üstün, T.B.; Wang, P.S. The global burden of mental disorders: An update from the WHO World Mental Health (WMH) surveys. Epidemiol. Psichiatr. Soc. 2009, 18, 23–33. [Google Scholar] [CrossRef] [Green Version]
- Popoli, M.; Yan, Z.; McEwen, B.S.; Sanacora, G. The stressed synapse: The impact of stress and glucocorticoids on glutamate transmission. Nat. Rev. Neurosci. 2012, 13, 22–37. [Google Scholar] [CrossRef] [Green Version]
- McEwen, B.S.; Bowles, N.P.; Gray, J.D.; Hill, M.N.; Hunter, R.G.; Karatsoreos, I.N.; Nasca, C. Mechanisms of stress in the brain. Nat. Neurosci. 2015, 18, 1353–1363. [Google Scholar] [CrossRef]
- Lin, E.; Tsai, S.J. Gene-environment interactions and role of epigenetics in anxiety disorders. In Advances in Experimental Medicine and Biology; Springer: Berlin/Heidelberg, Germany, 2020; Volume 1191, pp. 93–102. [Google Scholar] [CrossRef]
- Mallei, A.; Ieraci, A.; Popoli, M. Chronic social defeat stress differentially regulates the expression of BDNF transcripts and epigenetic modifying enzymes in susceptible and resilient mice. World J. Biol. Psychiatry 2019, 20, 555–566. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Liang, M.; Li, Y.; Feng, X.; Hong, J.; Zhou, R. Involvement of epigenetic modifications of gabaergic interneurons in basolateral amygdala in anxiety-like phenotype of prenatally stressed mice. Int. J. Neuropsychopharmacol. 2018, 21, 570–581. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Emeny, R.T.; Baumert, J.; Zannas, A.S.; Kunze, S.; Wahl, S.; Iurato, S.; Arloth, J.; Erhardt, A.; Balsevich, G.; Schmidt, M.V.; et al. Anxiety associated increased CpG methylation in the promoter of Asb1: A translational approach evidenced by epidemiological and clinical studies and a murine model. Neuropsychopharmacology 2018, 43, 342–353. [Google Scholar] [CrossRef] [Green Version]
- Penner-Goeke, S.; Binder, E.B. Epigenetics and depression. Dialogues Clin. Neurosci. 2019, 21, 397–405. [Google Scholar] [CrossRef] [PubMed]
- Tardito, D.; Mallei, A.; Popoli, M. Lost in translation. New unexplored avenues for neuropsychopharmacology: Epigenetics and microRNAs. Expert. Opin. Investig. Drugs 2013, 22, 217–233. [Google Scholar] [CrossRef]
- Whittle, N.; Singewald, N. HDAC inhibitors as cognitive enhancers in fear, anxiety and trauma therapy: Where do we stand? Biochem. Soc. Trans. 2014, 42, 569–581. [Google Scholar] [CrossRef]
- Covington, H.E.; Maze, I.; LaPlant, Q.C.; Vialou, V.F.; Ohnishi, Y.N.; Berton, O.; Fass, D.M.; Renthal, W.; Rush, A.J.; Wu, E.Y.; et al. Antidepressant Actions of Histone Deacetylase Inhibitors. J. Neurosci. 2009, 29, 11451–11460. [Google Scholar] [CrossRef]
- Hobara, T.; Uchida, S.; Otsuki, K.; Matsubara, T.; Funato, H.; Matsuo, K.; Suetsugi, M.; Watanabe, Y. Altered gene expression of histone deacetylases in mood disorder patients. J. Psychiatr. Res. 2010, 44, 263–270. [Google Scholar] [CrossRef]
- Tsankova, N.M.; Berton, O.; Renthal, W.; Kumar, A.; Neve, R.L.; Nestler, E.J. Sustained hippocampal chromatin regulation in a mouse model of depression and antidepressant action. Nat. Neurosci. 2006, 9, 519–525. [Google Scholar] [CrossRef]
- Ieraci, A.; Mallei, A.; Musazzi, L.; Popoli, M. Physical exercise and acute restraint stress differentially modulate hippocampal brain-derived neurotrophic factor transcripts and epigenetic mechanisms in mice. Hippocampus 2015, 25, 1380–1392. [Google Scholar] [CrossRef] [Green Version]
- Misztak, P.; Pańczyszyn-Trzewik, P.; Sowa-Kućma, M. Histone deacetylases (HDACs) as therapeutic target for depressive disorders. Pharmacol. Rep. 2018, 70, 398–408. [Google Scholar] [CrossRef]
- Black, C.N.; Bot, M.; Scheffer, P.G.; Cuijpers, P.; Penninx, B.W.J.H. Is depression associated with increased oxidative stress? A systematic review and meta-analysis. Psychoneuroendocrinology 2015, 51, 164–175. [Google Scholar] [CrossRef] [Green Version]
- Smaga, I.; Niedzielska, E.; Gawlik, M.; Moniczewski, A.; Krzek, J.; Przegaliński, E.; Pera, J.; Filip, M. Oxidative stress as an etiological factor and a potential treatment target of psychiatric disorders. Part 2. Depression, anxiety, schizophrenia and autism. Pharmacol. Rep. 2015, 67, 569–580. [Google Scholar] [CrossRef]
- Fedoce, A. das G.; Ferreira, F.; Bota, R.G.; Bonet-Costa, V.; Sun, P.Y.; Davies, K.J.A. The role of oxidative stress in anxiety disorder: Cause or consequence? Free Radic. Res. 2018, 52, 737–750. [Google Scholar] [CrossRef] [PubMed]
- Ng, F.; Berk, M.; Dean, O.; Bush, A.I. Oxidative stress in psychiatric disorders: Evidence base and therapeutic implications. Int. J. Neuropsychopharmacol. 2008, 11, 851–876. [Google Scholar] [CrossRef] [Green Version]
- Salim, S. Oxidative stress and the central nervous system. J. Pharmacol. Exp. Ther. 2017, 360, 201–205. [Google Scholar] [CrossRef] [PubMed]
- van Velzen, L.S.; Wijdeveld, M.; Black, C.N.; van Tol, M.J.; van der Wee, N.J.A.; Veltman, D.J.; Penninx, B.W.J.H.; Schmaal, L. Oxidative stress and brain morphology in individuals with depression, anxiety and healthy controls. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2017, 76, 140–144. [Google Scholar] [CrossRef] [PubMed]
- Gawryluk, J.W.; Wang, J.F.; Andreazza, A.C.; Shao, L.; Young, L.T. Decreased levels of glutathione, the major brain antioxidant, in post-mortem prefrontal cortex from patients with psychiatric disorders. Int. J. Neuropsychopharmacol. 2011, 14, 123–130. [Google Scholar] [CrossRef] [Green Version]
- Kim, G.H.; Ryan, J.J.; Archer, S.L. The role of redox signaling in epigenetics and cardiovascular disease. Antioxid. Redox Signal. 2013, 18, 1920–1936. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.E.; Kwon, H.J.; Choi, J.; Seo, J.S.; Han, P.L. Aging increases vulnerability to stress-induced depression via upregulation of NADPH oxidase in mice. Commun. Biol. 2020, 3. [Google Scholar] [CrossRef]
- Seo, J.S.; Park, J.Y.; Choi, J.; Kim, T.K.; Shin, J.H.; Lee, J.K.; Han, P.L. NADPH oxidase mediates depressive behavior induced by chronic stress in mice. J. Neurosci. 2012, 32, 9690–9699. [Google Scholar] [CrossRef] [Green Version]
- Ieraci, A.; Herrera, D.G. Nicotinamide Inhibits Ethanol-Induced Caspase-3 and PARP-1 Over-activation and Subsequent Neurodegeneration in the Developing Mouse Cerebellum. Cerebellum 2018, 17, 326–335. [Google Scholar] [CrossRef] [PubMed]
- Ramli, N.Z.; Yahaya, M.F.; Tooyama, I.; Damanhuri, H.A. A mechanistic evaluation of antioxidant nutraceuticals on their potential against age-associated neurodegenerative diseases. Antioxidants 2020, 9, 1019. [Google Scholar] [CrossRef] [PubMed]
- Moritz, B.; Schmitz, A.E.; Rodrigues, A.L.S.; Dafre, A.L.; Cunha, M.P. The role of vitamin C in stress-related disorders. J. Nutr. Biochem. 2020, 85. [Google Scholar] [CrossRef] [PubMed]
- Vukovic, R.; Kumburovic, I.; Jovic, J.J.; Jovicic, N.; Stankovic, J.S.K.; Mihailovic, V.; Djuric, M.; Velickovic, S.; Arnaut, A.; Selakovic, D.; et al. N-acetylcysteine protects against the anxiogenic response to cisplatin in rats. Biomolecules 2019, 9, 892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Savla, S.R.; Laddha, A.P.; Kulkarni, Y.A. Pharmacology of apocynin: A natural acetophenone. Drug Metab. Rev. 2021, 1–21. [Google Scholar] [CrossRef]
- Kim, J.Y.; Park, J.; Lee, J.E.; Yenari, M.A. NOX inhibitors—A promising avenue for ischemic stroke. Exp. Neurobiol. 2017, 26, 195–205. [Google Scholar] [CrossRef]
- Bedard, K.; Krause, K.H. The NOX family of ROS-generating NADPH oxidases: Physiology and pathophysiology. Physiol. Rev. 2007, 87, 245–313. [Google Scholar] [CrossRef] [PubMed]
- Heumüller, S.; Wind, S.; Barbosa-Sicard, E.; Schmidt, H.H.H.W.; Busse, R.; Schröder, K.; Brandes, R.P. Apocynin is not an inhibitor of vascular NADPH oxidases but an antioxidant. Hypertension 2008, 51, 211–217. [Google Scholar] [CrossRef]
- Tanriverdi, L.H.; Parlakpinar, H.; Ozhan, O.; Ermis, N.; Polat, A.; Vardi, N.; Tanbek, K.; Yildiz, A.; Acet, A. Inhibition of NADPH oxidase by apocynin promotes myocardial antioxidant response and prevents isoproterenol-induced myocardial oxidative stress in rats. Free Radic. Res. 2017, 51, 772–786. [Google Scholar] [CrossRef] [PubMed]
- Xianchu, L.; Kang, L.; Beiwan, D.; Huan, P.; Ming, L. Apocynin ameliorates cognitive deficits in streptozotocin––induced diabetic rats. Bratislava Med. J. 2021, 122, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Smith, R.E.; Luchtefeld, R.; Sun, A.Y.; Simonyi, A.; Luo, R.; Sun, G.Y. Bioavailability of apocynin through its conversion to glycoconjugate but not to diapocynin. Phytomedicine 2008, 15, 496–503. [Google Scholar] [CrossRef] [Green Version]
- Sandrini, L.; Ieraci, A.; Amadio, P.; Popoli, M.; Tremoli, E.; Barbieri, S.S. Apocynin Prevents Abnormal Megakaryopoiesis and Platelet Activation Induced by Chronic Stress. Oxid. Med. Cell. Longev. 2017, 2017. [Google Scholar] [CrossRef] [Green Version]
- Sailaja, B.S.; Cohen-Carmon, D.; Zimmerman, G.; Soreq, H.; Meshorer, E. Stress-induced epigenetic transcriptional memory of acetylcholinesterase by HDAC4. Proc. Natl. Acad. Sci. USA 2012, 109, E3687–E3695. [Google Scholar] [CrossRef] [Green Version]
- Ieraci, A.; Madaio, A.I.; Mallei, A.; Lee, F.S.; Popoli, M. Brain-Derived Neurotrophic Factor Val66Met Human Polymorphism Impairs the Beneficial Exercise-Induced Neurobiological Changes in Mice. Neuropsychopharmacology 2016, 41, 3070–3079. [Google Scholar] [CrossRef] [Green Version]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef]
- Mallei, A.; Ieraci, A.; Corna, S.; Tardito, D.; Lee, F.S.; Popoli, M. Global epigenetic analysis of BDNF Val66Met mice hippocampus reveals changes in dendrite and spine remodeling genes. Hippocampus 2018, 28, 783–795. [Google Scholar] [CrossRef]
- Ieraci, A.; Herrera, D.G. Early Postnatal Ethanol Exposure in Mice Induces Sex-Dependent Memory Impairment and Reduction of Hippocampal NMDA-R2B Expression in Adulthood. Neuroscience 2020, 427, 105–115. [Google Scholar] [CrossRef] [PubMed]
- Ibi, M.; Liu, J.; Arakawa, N.; Kitaoka, S.; Kawaji, A.; Matsuda, K.; Iwata, K.; Matsumoto, M.; Katsuyama, M.; Zhu, K.; et al. Depressive-like behaviors are regulated by NOX1/NADPH oxidase by redox modification of NMDA receptor 1. J. Neurosci. 2017, 37, 4200–4212. [Google Scholar] [CrossRef]
- Huang, X.; Xiaokaiti, Y.; Yang, J.; Pan, J.; Li, Z.; Luria, V.; Li, Y.; Song, G.; Zhu, X.; Zhang, H.T.; et al. Inhibition of phosphodiesterase 2 reverses gp91phox oxidase-mediated depression- and anxiety-like behavior. Neuropharmacology 2018, 143, 176–185. [Google Scholar] [CrossRef]
- Lv, H.; Zhu, C.; Wu, R.; Ni, H.; Lian, J.; Xu, Y.; Xia, Y.; Shi, G.; Li, Z.; Caldwell, R.B.; et al. Chronic mild stress induced anxiety-like behaviors can Be attenuated by inhibition of NOX2-derived oxidative stress. J. Psychiatr. Res. 2019, 114, 55–66. [Google Scholar] [CrossRef]
- Altenhöfer, S.; Radermacher, K.A.; Kleikers, P.W.M.; Wingler, K.; Schmidt, H.H.H.W. Evolution of NADPH oxidase inhibitors: Selectivity and mechanisms for target engagement. Antioxid. Redox Signal. 2015, 23, 406–427. [Google Scholar] [CrossRef] [PubMed]
- Barbieri, S.S.; Cavalca, V.; Eligini, S.; Brambilla, M.; Caiani, A.; Tremoli, E.; Colli, S. Apocynin prevents cyclooxygenase 2 expression in human monocytes through NADPH oxidase and glutathione redox-dependent mechanisms. Free Radic. Biol. Med. 2004, 37, 156–165. [Google Scholar] [CrossRef] [PubMed]
- Shi, Q.; Gibson, G.E. Oxidative stress and transcriptional regulation in Alzheimer disease. Alzheimer Dis. Assoc. Disord. 2007, 21, 276–291. [Google Scholar] [CrossRef] [Green Version]
- Manea, A.; Manea, S.A.; Florea, I.C.; Luca, C.M.; Raicu, M. Positive regulation of NADPH oxidase 5 by proinflammatory-related mechanisms in human aortic smooth muscle cells. Free Radic. Biol. Med. 2012, 52, 1497–1507. [Google Scholar] [CrossRef]
- Manea, A.; Manea, S.A.; Gafencu, A.V.; Raicu, M.; Simionescu, M. AP-1-dependent transcriptional regulation of NADPH oxidase in human aortic smooth muscle cells: Role of p22phox subunit. Arterioscler. Thromb. Vasc. Biol. 2008, 28, 878–885. [Google Scholar] [CrossRef] [Green Version]
- Niu, Y.; Desmarais, T.L.; Tong, Z.; Yao, Y.; Costa, M. Oxidative stress alters global histone modification and DNA methylation. Free Radic. Biol. Med. 2015, 82, 22–28. [Google Scholar] [CrossRef] [Green Version]
- Ceccarelli, V.; Ronchetti, S.; Marchetti, M.C.; Calvitti, M.; Riccardi, C.; Grignani, F.; Vecchini, A. Molecular mechanisms underlying eicosapentaenoic acid inhibition of HDAC1 and DNMT expression and activity in carcinoma cells. Biochim. Biophys. Acta-Gene Regul. Mech. 2020, 1863. [Google Scholar] [CrossRef] [PubMed]
- Vallée, A.; Lecarpentier, Y. Crosstalk between peroxisome proliferator-activated receptor gamma and the canonical WNT/β-catenin pathway in chronic inflammation and oxidative stress during carcinogenesis. Front. Immunol. 2018, 9. [Google Scholar] [CrossRef] [Green Version]
- Abel, T.; Zukin, R.S. Epigenetic targets of HDAC inhibition in neurodegenerative and psychiatric disorders. Curr. Opin. Pharmacol. 2008, 8, 57–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palmisano, M.; Pandey, S.C. Epigenetic mechanisms of alcoholism and stress-related disorders. Alcohol 2017, 60, 7–18. [Google Scholar] [CrossRef] [PubMed]
- Martins de Carvalho, L.; Chen, W.Y.; Lasek, A.W. Epigenetic mechanisms underlying stress-induced depression. Int. Rev. Neurobiol. 2021, 156, 87–126. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
p47phox | ACCGGCTATTTCCCATCCAT | TGGATGCTCTGTGCGTTGC |
p67phox | GCCAGCTTCGGAACATGGT | GACAGGAGCAGAAGCTCGTG |
Hdac1 | GAGTTCTGTCAGTTGTCCACGG | TTCAGACTTCTTTGCATGGTGC |
Hdac2 | GGGACAGGCTTGGTTGTTTC | GAGCATCAGCAATGGCAAGT |
Hdac4 | CAATCCCACAGTCTCCGTGT | CAGCACCCCACTAAGGTTCA |
Hdac5 | TGTCACCGCCAGATGTTTTG | TGAGCAGAGCCGAGACACAG |
Gapdh | CGTGCCGCCTGGAGAAACC | TGGAAGAGTGGGAGTTGCTGTTG |
Rps18 | TGGAGCGAGTGATCACCATCA | CCTCACGCAGCTTGTTGTCTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barbieri, S.S.; Sandrini, L.; Musazzi, L.; Popoli, M.; Ieraci, A. Apocynin Prevents Anxiety-Like Behavior and Histone Deacetylases Overexpression Induced by Sub-Chronic Stress in Mice. Biomolecules 2021, 11, 885. https://doi.org/10.3390/biom11060885
Barbieri SS, Sandrini L, Musazzi L, Popoli M, Ieraci A. Apocynin Prevents Anxiety-Like Behavior and Histone Deacetylases Overexpression Induced by Sub-Chronic Stress in Mice. Biomolecules. 2021; 11(6):885. https://doi.org/10.3390/biom11060885
Chicago/Turabian StyleBarbieri, Silvia S., Leonardo Sandrini, Laura Musazzi, Maurizio Popoli, and Alessandro Ieraci. 2021. "Apocynin Prevents Anxiety-Like Behavior and Histone Deacetylases Overexpression Induced by Sub-Chronic Stress in Mice" Biomolecules 11, no. 6: 885. https://doi.org/10.3390/biom11060885