Identification of miR-128 Target mRNAs That Are Expressed in B Cells Using a Modified Dual Luciferase Vector
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Cells, Cell Lines and Cell Culture Conditions
2.3. Cloning of Fragments with Predicted miR-128 Binding Sites for Luciferase Assays
2.4. Construction of miRNA Expression Vectors
2.5. Construction of psiCHECK-3 and psiCHECK-4 Vectors
2.6. Northern Blot Analysis
2.7. Transfection of HEK-293 Cells and Luciferase Assays
2.8. Quantification of miRNAs by TaqMan Quantitative RT-PCR Analysis
3. Results
3.1. Northern Blot Analysis Shows That Only Primary Brain Cells Express Mature miR-128
3.2. Generation of Compatible Dual Luciferase Vectors to Facilitate the Transfer of Fragments from Single Luciferase Vectors
3.3. Comparison of Single vs. Dual Luciferase Constructs for miRNA Target Analysis
3.4. Verification of In Vivo Identified miR-128 Binding Sites by the Dual Luciferase Assay
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lee, Y.; Ahn, C.; Han, J.; Choi, H.; Kim, J.; Yim, J.; Lee, J.; Provost, P.; Radmark, O.; Kim, S.; et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 2003, 425, 415–419. [Google Scholar] [CrossRef]
- Gregory, R.I.; Yan, K.P.; Amuthan, G.; Chendrimada, T.; Doratotaj, B.; Cooch, N.; Shiekhattar, R. The Microprocessor complex mediates the genesis of microRNAs. Nature 2004, 432, 235–240. [Google Scholar] [CrossRef]
- Yi, R.; Qin, Y.; Macara, I.G.; Cullen, B.R. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes. Dev. 2003, 17, 3011–3016. [Google Scholar] [CrossRef]
- Lund, E.; Guttinger, S.; Calado, A.; Dahlberg, J.E.; Kutay, U. Nuclear export of microRNA precursors. Science 2004, 303, 95–98. [Google Scholar] [CrossRef]
- Bohnsack, M.T.; Czaplinski, K.; Gorlich, D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 2004, 10, 185–191. [Google Scholar] [CrossRef]
- Bernstein, E.; Caudy, A.A.; Hammond, S.M.; Hannon, G.J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001, 409, 363–366. [Google Scholar] [CrossRef]
- Bartel, D.P. Metazoan MicroRNAs. Cell 2018, 173, 20–51. [Google Scholar] [CrossRef]
- Krek, A.; Grun, D.; Poy, M.N.; Wolf, R.; Rosenberg, L.; Epstein, E.J.; MacMenamin, P.; da Piedade, I.; Gunsalus, K.C.; Stoffel, M.; et al. Combinatorial microRNA target predictions. Nat. Genet. 2005, 37, 495–500. [Google Scholar] [CrossRef]
- Friedman, R.C.; Farh, K.K.; Burge, C.B.; Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef]
- Paraskevopoulou, M.D.; Georgakilas, G.; Kostoulas, N.; Vlachos, I.S.; Vergoulis, T.; Reczko, M.; Filippidis, C.; Dalamagas, T.; Hatzigeorgiou, A.G. DIANA-microT web server v5.0: Service integration into miRNA functional analysis workflows. Nucleic Acids Res. 2013, 41, W169–W173. [Google Scholar] [CrossRef] [PubMed]
- Madhumita, M.; Paul, S. A review on methods for predicting miRNA-mRNA regulatory modules. J. Integr. Bioinform. 2022, 19, 20200048. [Google Scholar] [CrossRef] [PubMed]
- Chi, S.W.; Zang, J.B.; Mele, A.; Darnell, R.B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 2009, 460, 479–486. [Google Scholar] [CrossRef] [PubMed]
- Ebert, M.S.; Neilson, J.R.; Sharp, P.A. MicroRNA sponges: Competitive inhibitors of small RNAs in mammalian cells. Nat. Methods 2007, 4, 721–726. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Chen, Z.; Liu, X.; Zhou, X. Evaluating the microRNA targeting sites by luciferase reporter gene assay. Methods Mol. Biol. 2013, 936, 117–127. [Google Scholar] [CrossRef]
- Sempere, L.F.; Freemantle, S.; Pitha-Rowe, I.; Moss, E.; Dmitrovsky, E.; Ambros, V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004, 5, R13. [Google Scholar] [CrossRef]
- Bak, M.; Silahtaroglu, A.; Møller, M.; Christensen, M.; Rath, M.F.; Skryabin, B.; Tommerup, N.; Kauppinen, S. MicroRNA expression in the adult mouse central nervous system. RNA 2008, 14, 432–444. [Google Scholar] [CrossRef]
- Lee, E.J.; Baek, M.; Gusev, Y.; Brackett, D.J.; Nuovo, G.J.; Schmittgen, T.D. Systematic evaluation of microRNA processing patterns in tissues, cell lines, and tumors. RNA 2008, 14, 35–42. [Google Scholar] [CrossRef]
- Tan, C.L.; Plotkin, J.L.; Veno, M.T.; von Schimmelmann, M.; Feinberg, P.; Mann, S.; Handler, A.; Kjems, J.; Surmeier, D.J.; O’Carroll, D.; et al. MicroRNA-128 governs neuronal excitability and motor behavior in mice. Science 2013, 342, 1254–1258. [Google Scholar] [CrossRef]
- Kuchen, S.; Resch, W.; Yamane, A.; Kuo, N.; Li, Z.; Chakraborty, T.; Wei, L.; Laurence, A.; Yasuda, T.; Peng, S.; et al. Regulation of microRNA expression and abundance during lymphopoiesis. Immunity 2010, 32, 828–839. [Google Scholar] [CrossRef]
- Petriv, O.I.; Kuchenbauer, F.; Delaney, A.D.; Lecault, V.; White, A.; Kent, D.; Marmolejo, L.; Heuser, M.; Berg, T.; Copley, M.; et al. Comprehensive microRNA expression profiling of the hematopoietic hierarchy. Proc. Natl. Acad. Sci. USA 2010, 107, 15443–15448. [Google Scholar] [CrossRef] [PubMed]
- Spierings, D.C.; McGoldrick, D.; Hamilton-Easton, A.M.; Neale, G.; Murchison, E.P.; Hannon, G.J.; Green, D.R.; Withoff, S. Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage. Blood 2011, 117, 5340–5349. [Google Scholar] [CrossRef] [PubMed]
- Nikhat, S.; Yadavalli, A.D.; Prusty, A.; Narayan, P.K.; Palakodeti, D.; Murre, C.; Pongubala, J.M.R. A regulatory network of microRNAs confers lineage commitment during early developmental trajectories of B and T lymphocytes. Proc. Natl. Acad. Sci. USA 2021, 118, e2104297118. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Xu, J.; Chen, H.; Fei, X.; Tang, Y.; Yan, Y.; Zhang, H.; Zhang, J. MiR-128-2 inhibits common lymphoid progenitors from developing into progenitor B cells. Oncotarget 2016, 7, 17520–17531. [Google Scholar] [CrossRef] [PubMed]
- Budi, H.S.; Younus, L.A.; Lafta, M.H.; Parveen, S.; Mohammad, H.J.; Al-Qaim, Z.H.; Jawad, M.A.; Parra, R.M.R.; Mustafa, Y.F.; Alhachami, F.R.; et al. The role of miR-128 in cancer development, prevention, drug resistance, and immunotherapy. Front. Oncol. 2022, 12, 1067974. [Google Scholar] [CrossRef] [PubMed]
- Ching, A.S.; Ahmad-Annuar, A. A Perspective on the Role of microRNA-128 Regulation in Mental and Behavioral Disorders. Front. Cell Neurosci. 2015, 9, 465. [Google Scholar] [CrossRef]
- Alshahrani, S.H.; Alameri, A.A.; Kahar, F.; Alexis Ramirez-Coronel, A.; Fadhel Obaid, R.; Alsaikhan, F.; Zabibah, R.S.; Qasim, Q.A.; Altalbawy, F.M.A.; Fakri Mustafa, Y.; et al. Overview of the role and action mechanism of microRNA-128 in viral infections. Microb. Pathog. 2023, 176, 106020. [Google Scholar] [CrossRef]
- Shang, Q.; Shen, G.; Chen, G.; Zhang, Z.; Yu, X.; Zhao, W.; Zhang, P.; Chen, H.; Tang, K.; Yu, F.; et al. The emerging role of miR-128 in musculoskeletal diseases. J. Cell Physiol. 2021, 236, 4231–4243. [Google Scholar] [CrossRef]
- Wang, L.; Sinnott-Armstrong, N.; Wagschal, A.; Wark, A.R.; Camporez, J.P.; Perry, R.J.; Ji, F.; Sohn, Y.; Oh, J.; Wu, S.; et al. A MicroRNA Linking Human Positive Selection and Metabolic Disorders. Cell 2020, 183, 684–701.e14. [Google Scholar] [CrossRef]
- Lanza, M.; Cuzzocrea, S.; Oddo, S.; Esposito, E.; Casili, G. The Role of miR-128 in Neurodegenerative Diseases. Int. J. Mol. Sci. 2023, 24, 6024. [Google Scholar] [CrossRef]
- Kilikevicius, A.; Meister, G.; Corey, D.R. Reexamining assumptions about miRNA-guided gene silencing. Nucleic Acids Res. 2022, 50, 617–634. [Google Scholar] [CrossRef] [PubMed]
- Krichevsky, A.M.; King, K.S.; Donahue, C.P.; Khrapko, K.; Kosik, K.S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 2003, 9, 1274–1281. [Google Scholar] [CrossRef] [PubMed]
- Franzoni, E.; Booker, S.A.; Parthasarathy, S.; Rehfeld, F.; Grosser, S.; Srivatsa, S.; Fuchs, H.R.; Tarabykin, V.; Vida, I.; Wulczyn, F.G. miR-128 regulates neuronal migration, outgrowth and intrinsic excitability via the intellectual disability gene Phf6. eLife 2015, 4, e04263. [Google Scholar] [CrossRef] [PubMed]
- Mouse Genome Sequencing, C.; Waterston, R.H.; Lindblad-Toh, K.; Birney, E.; Rogers, J.; Abril, J.F.; Agarwal, P.; Agarwala, R.; Ainscough, R.; Alexandersson, M.; et al. Initial sequencing and comparative analysis of the mouse genome. Nature 2002, 420, 520–562. [Google Scholar] [CrossRef]
- Gey, G.O.; Coffman, W.D.; Kubicek, M.T. Tissue culture studies of the proliferative capacity of cervical carcinoma and normal epithelium. Cancer Res. 1952, 12, 264–265. [Google Scholar]
- Alt, F.; Rosenberg, N.; Lewis, S.; Thomas, E.; Baltimore, D. Organization and reorganization of immunoglobulin genes in A-MULV-transformed cells: Rearrangement of heavy but not light chain genes. Cell 1981, 27, 381–390. [Google Scholar] [CrossRef]
- Taussig, M.J.; Holliman, A.; Wright, L.J. Hybridization between T and B lymphoma cell lines. Immunology 1980, 39, 57–60. [Google Scholar]
- Kearney, J.F.; Radbruch, A.; Liesegang, B.; Rajewsky, K. A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines. J. Immunol. 1979, 123, 1548–1550. [Google Scholar] [CrossRef]
- Lanier, L.L.; Arnold, L.W.; Raybourne, R.B.; Russell, S.; Lynes, M.A.; Warner, N.L.; Haughton, G. Transplantable B-cell lymphomas in B10. H-2aH-4bp/Wts mice. Immunogenetics 1982, 16, 367–371. [Google Scholar] [CrossRef]
- Burger, R.; Neipel, F.; Fleckenstein, B.; Savino, R.; Ciliberto, G.; Kalden, J.R.; Gramatzki, M. Human herpesvirus type 8 interleukin-6 homologue is functionally active on human myeloma cells. Blood 1998, 91, 1858–1863. [Google Scholar] [CrossRef]
- Jainchill, J.L.; Aaronson, S.A.; Todaro, G.J. Murine sarcoma and leukemia viruses: Assay using clonal lines of contact-inhibited mouse cells. J. Virol. 1969, 4, 549–553. [Google Scholar] [CrossRef] [PubMed]
- Graham, F.L.; Smiley, J.; Russell, W.C.; Nairn, R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 1977, 36, 59–74. [Google Scholar] [CrossRef] [PubMed]
- Giard, D.J.; Aaronson, S.A.; Todaro, G.J.; Arnstein, P.; Kersey, J.H.; Dosik, H.; Parks, W.P. In vitro cultivation of human tumors: Establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst. 1973, 51, 1417–1423. [Google Scholar] [CrossRef]
- Olmsted, J.B.; Carlson, K.; Klebe, R.; Ruddle, F.; Rosenbaum, J. Isolation of microtubule protein from cultured mouse neuroblastoma cells. Proc. Natl. Acad. Sci. USA 1970, 65, 129–136. [Google Scholar] [CrossRef]
- Smirnova, L.; Grafe, A.; Seiler, A.; Schumacher, S.; Nitsch, R.; Wulczyn, F.G. Regulation of miRNA expression during neural cell specification. Eur. J. Neurosci. 2005, 21, 1469–1477. [Google Scholar] [CrossRef] [PubMed]
- Heng, T.S.; Painter, M.W.; Immunological Genome Project, C. The Immunological Genome Project: Networks of gene expression in immune cells. Nat. Immunol. 2008, 9, 1091–1094. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Batzer, A.; Daly, R.; Yajnik, V.; Skolnik, E.; Chardin, P.; Bar-Sagi, D.; Margolis, B.; Schlessinger, J. Guanine-nucleotide-releasing factor hSos1 binds to Grb2 and links receptor tyrosine kinases to Ras signalling. Nature 1993, 363, 85–88. [Google Scholar] [CrossRef]
- Swiers, G.; de Bruijn, M.; Speck, N.A. Hematopoietic stem cell emergence in the conceptus and the role of Runx1. Int. J. Dev. Biol. 2010, 54, 1151–1163. [Google Scholar] [CrossRef]
- Zhao, N.; Zhang, G.; He, M.; Huang, H.; Cao, L.; Yin, A.; Wang, P.; Wang, L. SZRD1 is a Novel Protein that Functions as a Potential Tumor Suppressor in Cervical Cancer. J. Cancer 2017, 8, 2132–2141. [Google Scholar] [CrossRef]
- Krutzfeldt, J.; Rajewsky, N.; Braich, R.; Rajeev, K.G.; Tuschl, T.; Manoharan, M.; Stoffel, M. Silencing of microRNAs in vivo with ‘antagomirs’. Nature 2005, 438, 685–689. [Google Scholar] [CrossRef]
- Bai, J.; Zhang, X.; Shi, D.; Xiang, Z.; Wang, S.; Yang, C.; Liu, Q.; Huang, S.; Fang, Y.; Zhang, W.; et al. Exosomal miR-128-3p Promotes Epithelial-to-Mesenchymal Transition in Colorectal Cancer Cells by Targeting FOXO4 via TGF-beta/SMAD and JAK/STAT3 Signaling. Front. Cell Dev. Biol. 2021, 9, 568738. [Google Scholar] [CrossRef] [PubMed]
- Ciafre, S.A.; Galardi, S.; Mangiola, A.; Ferracin, M.; Liu, C.G.; Sabatino, G.; Negrini, M.; Maira, G.; Croce, C.M.; Farace, M.G. Extensive modulation of a set of microRNAs in primary glioblastoma. Biochem. Biophys. Res. Commun. 2005, 334, 1351–1358. [Google Scholar] [CrossRef] [PubMed]
- Godlewski, J.; Nowicki, M.O.; Bronisz, A.; Williams, S.; Otsuki, A.; Nuovo, G.; Raychaudhury, A.; Newton, H.B.; Chiocca, E.A.; Lawler, S. Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008, 68, 9125–9130. [Google Scholar] [CrossRef]
- Zhang, Y.; Chao, T.; Li, R.; Liu, W.; Chen, Y.; Yan, X.; Gong, Y.; Yin, B.; Liu, W.; Qiang, B.; et al. MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a. J. Mol. Med. 2009, 87, 43–51. [Google Scholar] [CrossRef] [PubMed]
- Treiber, T.; Treiber, N.; Plessmann, U.; Harlander, S.; Daiss, J.L.; Eichner, N.; Lehmann, G.; Schall, K.; Urlaub, H.; Meister, G. A Compendium of RNA-Binding Proteins that Regulate MicroRNA Biogenesis. Mol. Cell 2017, 66, 270–284.e13. [Google Scholar] [CrossRef] [PubMed]
- Kedde, M.; Strasser, M.J.; Boldajipour, B.; Oude Vrielink, J.A.; Slanchev, K.; le Sage, C.; Nagel, R.; Voorhoeve, P.M.; van Duijse, J.; Orom, U.A.; et al. RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell 2007, 131, 1273–1286. [Google Scholar] [CrossRef]
- Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from repression to activation: MicroRNAs can up-regulate translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef]
- Nelson, P.T.; De Planell-Saguer, M.; Lamprinaki, S.; Kiriakidou, M.; Zhang, P.; O’Doherty, U.; Mourelatos, Z. A novel monoclonal antibody against human Argonaute proteins reveals unexpected characteristics of miRNAs in human blood cells. RNA 2007, 13, 1787–1792. [Google Scholar] [CrossRef]
- Lu, J.; Getz, G.; Miska, E.A.; Alvarez-Saavedra, E.; Lamb, J.; Peck, D.; Sweet-Cordero, A.; Ebert, B.L.; Mak, R.H.; Ferrando, A.A.; et al. MicroRNA expression profiles classify human cancers. Nature 2005, 435, 834–838. [Google Scholar] [CrossRef]
- Matsuda, A.; Suzuki, Y.; Honda, G.; Muramatsu, S.; Matsuzaki, O.; Nagano, Y.; Doi, T.; Shimotohno, K.; Harada, T.; Nishida, E.; et al. Large-scale identification and characterization of human genes that activate NF-kappaB and MAPK signaling pathways. Oncogene 2003, 22, 3307–3318. [Google Scholar] [CrossRef]
- Baba, Y.; Kurosaki, T. Role of Calcium Signaling in B Cell Activation and Biology. Curr. Top. Microbiol. Immunol. 2016, 393, 143–174. [Google Scholar] [CrossRef] [PubMed]
Cell Line | Cell Properties | Citation |
---|---|---|
C57BL/6 | murine primary cells from brain | [34] |
HeLa | human cervical carcinoma cell line | [35] |
38B9 | murine pro-B cell line | [36] |
WEHI-231 | murine immature B cell line | [37] |
Ag8H | murine plasma B cell line, subclone of X63-Ag8.653 | [38] |
CH27 | murine mature splenic B cell line | [39] |
INA-6 | human plasma B cell line | [40] |
NIH3T3 | murine fibroblast cell line | [41] |
HEK-293 | human embryonic kidney cell line | [42] |
A172 | human glioblastoma cell line | [43] |
Neuro-2A | murine neuroblastoma cell line | [44] |
Gene Symbol | Refseq ID | 3′ UTR nts | Exon |
---|---|---|---|
SZRD1 | NM_001025608 | 36–925 | --- |
RUNX1 | NM_001111021 | 2747–3746 | --- |
SOS1 | NM_009231 | 16–1812 | --- |
CALM1 (Frag1) | NM_009790 | 777–1780 | --- |
CALM1 (Frag2) | NM_009790 | 2382–3376 | --- |
CALM2 | NM_007589 | 5–624 | --- |
LYN | NM_001111096 | 388–1403 | --- |
PRKCA | NM_011101 | --- | Exon 4 |
ATP2A2 | NM_001110140 | 828–1808 | --- |
PIK3C2A | NM_011083 | 3–888 | --- |
MAPK6 | NM_015806 | 110–1120 | --- |
MAPK14 | NM_011951 | 1–580 | --- |
Gene Symbol | Primer for (5′-3′) | Primer rev (5′-3′) | Product (bp) |
---|---|---|---|
SZRD1 | TCTAGACGCCTCCTGGATGGTCTG | GCGGCCGCGCCTTTCTGAGCCCAGAGTC | 903 |
RUNX1 | TCTAGACATCGCCATCGAGGGACT | GCGGCCGCAAAGCATGCCAGAATGAGGA | 1015 |
SOS1 | TCTAGAGATAGTTTCCTAGCCCCCAGA | GCGGCCGCCTTTGCATCCAAGAAGGGATT | 1810 |
CALM1 (Frag1) | TCTAGAATTGTACAGAATGTGTTAAATTTCTTG | GCGGCCGCGAGCAACAATTGGGTAAATTGTAA | 1017 |
CALM1 (Frag2) | TCTAGAGTCAAGGCAGTACCCCTGAG | GCGGCCGCGGCTGCAGAAATGTTTATTGAA | 1008 |
CALM2 | TCTAGAATTGTACAGAATGTGTTAAATTTCTTG | GCGGCCGCGAGCAACAATTGGGTAAATTGTAA | 633 |
LYN | ACTAGTTTACAGGTGAAGCCACAAGC | GCGGCCGCTCAATCCCTTCGCCTAGTCA | 1029 |
PRKCA | TCTAGAGACCCCAGGAGCAAGCAC | GCGGCCGCTGTCACATTTCATCCCTTGG | 126 |
ATP2A2 | TCTAGATGTCTTGTTCTTAATGGCCTTG | GCGGCCGCAGCTGGCTGCACACCTAAAC | 994 |
PIK3C2A | TCTAGATTCCGACTTCTGAGCTTTGG | GCGGCCGCCCTGAGCACGTTACCAAACA | 899 |
MAPK6 | TCTAGATGCAAGGATTTTTCTTGGTTC | GCGGCCGC GCCTAGGGATGGGGAATAGA | 1024 |
MAPK14 | TCTAGAGCACCTGGTTTCTGTTCTGTC | GCGGCCGCAACTATCTACGCGCCCTTCTC | 594 |
Plasmid | Primer for (5′-3′) | Primer rev (5′-3′) | Product (bp) |
---|---|---|---|
Mmu-miR-128-2 | GTTAACCTCGAGGCCCAAGTGCTTTGTTGTTT | TGATCATCTAGAATCGATCGCAGCAGGAGCTCTTTAGT | 478 |
Mmu-miR-201 | AAGCTTCCACCTCAATACTGACCCTAGAA | GATATCCGATATATCTTGCCTTCCACTTG | 488 |
MCS psiCHECK-4 | TCGACTCTAGAGC | GGCCGCTCTAGAG | --- |
Mmu-miR-128 probe | Exiqon, proprietary sequence | --- | --- |
Mmu-miR-16 probe | CGCCAATATTTACGTGCTGCTA | --- | --- |
Gene Symbol | Targetscan (Sites) | Context Score | Pictar (Sites) | Score (Mm) | DIANA microT (Sites) | miTG Score |
---|---|---|---|---|---|---|
SZRD1 | 4 | −0.98 | 6 | 21.8503 | 4 | 51.44 |
RUNX1 | 2 | −0.24 | not found | --- | 2 | 9.00 |
SOS1 | 4 | −0.23 | 2 | 6.6930 | 4 | 16.54 |
CALM1 (Frag1) | 0 | --- | 0 | --- | 1 | 7.33 |
CALM1 (Frag2) | 0 | --- | 0 | --- | 1 | 7.33 |
CALM2 | 0 | --- | 0 | --- | 0 | --- |
LYN | 0 | --- | not found | --- | 0 | --- |
PRKCA | n.a. 1 | --- | n.a. 1 | --- | n.a. 1 | --- |
ATP2A2 | 0 | --- | not found | --- | 0 | --- |
PIK3C2A | 0 | --- | 0 | --- | 0 | --- |
MAPK6 | 1 | −0.22 | 0 | --- | 1 | 11 |
MAPK14 | 2 | −0.77 | 2 | 4.6117 | 2 | 28.11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schreiber, S.; Daum, P.; Danzer, H.; Hauke, M.; Jäck, H.-M.; Wittmann, J. Identification of miR-128 Target mRNAs That Are Expressed in B Cells Using a Modified Dual Luciferase Vector. Biomolecules 2023, 13, 1517. https://doi.org/10.3390/biom13101517
Schreiber S, Daum P, Danzer H, Hauke M, Jäck H-M, Wittmann J. Identification of miR-128 Target mRNAs That Are Expressed in B Cells Using a Modified Dual Luciferase Vector. Biomolecules. 2023; 13(10):1517. https://doi.org/10.3390/biom13101517
Chicago/Turabian StyleSchreiber, Sandra, Patrick Daum, Heike Danzer, Manuela Hauke, Hans-Martin Jäck, and Jürgen Wittmann. 2023. "Identification of miR-128 Target mRNAs That Are Expressed in B Cells Using a Modified Dual Luciferase Vector" Biomolecules 13, no. 10: 1517. https://doi.org/10.3390/biom13101517