Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery
Abstract
:1. Introduction
2. Patients and Methods
2.1. Study Design and Participants
2.2. Sample Collection and Processing
2.3. Protein Expression Studies by Immunohistochemistry
2.4. Gene Expression Analysis Using Real-Time Quantitative PCR
2.5. Statistical Analysis
3. Results
3.1. The Placentas of Women with Late-Onset Preeclampsia Show Enhanced Gene and Protein Expression of NLRP3 and ASC
3.2. Women with Late-Onset Preeclampsia Display an Increased Expression of Caspase 1, Caspase 5, and Caspase 8
3.3. The Placental Tissue of Women with Late-Onset Preeclampsia Exhibits Augmented Expression of IL-1β and IL-18
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Garovic, V.D.; White, W.M.; Vaughan, L.; Saiki, M.; Parashuram, S.; Garcia-Valencia, O.; Weissgerber, T.L.; Milic, N.; Weaver, A.; Mielke, M.M. Incidence and Long-Term Outcomes of Hypertensive Disorders of Pregnancy. J. Am. Coll. Cardiol. 2020, 75, 2323–2334. [Google Scholar] [CrossRef] [PubMed]
- Hutcheon, J.A.; Lisonkova, S.; Joseph, K. Epidemiology of Pre-Eclampsia and the Other Hypertensive Disorders of Pregnancy. Best Pract. Res. Clin. Obstet. Gynaecol. 2011, 25, 391–403. [Google Scholar] [CrossRef] [PubMed]
- Voto, L.S.; Zeitune, M.G. Preeclampsia. In Perinatology; Springer: Cham, Switzerland, 2022; pp. 707–746. [Google Scholar] [CrossRef]
- Filipek, A.; Jurewicz, E. Preeclampsia—A Disease of Pregnant Women. Postep. Biochem. 2018, 64, 229–232. [Google Scholar] [CrossRef]
- Ives, C.W.; Sinkey, R.; Rajapreyar, I.; Tita, A.T.N.; Oparil, S. Preeclampsia-Pathophysiology and Clinical Presentations: JACC State-of-the-Art Review. J. Am. Coll. Cardiol. 2020, 76, 1690–1702. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Sáez, M.A.; Álvarez-Mon, M.A.; Torres-Carranza, D.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; Bravo, C.; et al. The Pivotal Role of the Placenta in Normal and Pathological Pregnancies: A Focus on Preeclampsia, Fetal Growth Restriction, and Maternal Chronic Venous Disease. Cells 2022, 11, 568. [Google Scholar] [CrossRef]
- American College of Obstetricians and Gynecologists. Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222. Obstet. Gynecol. 2020, 135, e237–e260. [Google Scholar] [CrossRef]
- Herzog, E.M.; Eggink, A.J.; Reijnierse, A.; Kerkhof, M.A.M.; de Krijger, R.R.; Roks, A.J.M.; Reiss, I.K.M.; Nigg, A.L.; Eilers, P.H.C.; Steegers, E.A.P.; et al. Impact of Early- and Late-Onset Preeclampsia on Features of Placental and Newborn Vascular Health. Placenta 2017, 49, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Ren, Z.; Gao, Y.; Gao, Y.; Liang, G.; Chen, Q.; Jiang, S.; Yang, X.; Fan, C.; Wang, H.; Wang, J.; et al. Distinct Placental Molecular Processes Associated with Early-Onset and Late-Onset Preeclampsia. Theranostics 2021, 11, 5028. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, V.R.; Romao-Veiga, M.; Romagnoli, G.G.; Matias, M.L.; Nunes, P.R.; Borges, V.T.M.; Peracoli, J.C.; Peracoli, M.T.S. Association between Cytokine Profile and Transcription Factors Produced by T-cell Subsets in Early- and Late-onset Pre-eclampsia. Immunology 2017, 152, 163. [Google Scholar] [CrossRef]
- Staff, A.C. The Two-Stage Placental Model of Preeclampsia: An Update. J. Reprod. Immunol. 2019, 134–135, 1–10. [Google Scholar] [CrossRef]
- Rathinam, V.A.K.; Chan, F.K.M. Inflammasome, Inflammation and Tissue Homeostasis. Trends Mol. Med. 2018, 24, 304. [Google Scholar] [CrossRef]
- Ortega, M.A.; De Leon-Oliva, D.; García-Montero, C.; Fraile-Martinez, O.; Boaru, D.L.; de Castro, A.V.; Saez, M.A.; Lopez-Gonzalez, L.; Bujan, J.; Alvarez-Mon, M.A.; et al. Reframing the Link between Metabolism and NLRP3 Inflammasome: Therapeutic Opportunities. Front. Immunol. 2023, 14, 1232629. [Google Scholar] [CrossRef] [PubMed]
- Alfian, I.; Chakraborty, A.; Yong, H.E.J.; Saini, S.; Lau, R.W.K.; Kalionis, B.; Dimitriadis, E.; Alfaidy, N.; Ricardo, S.D.; Samuel, C.S.; et al. The Placental NLRP3 Inflammasome and Its Downstream Targets, Caspase-1 and Interleukin-6, Are Increased in Human Fetal Growth Restriction: Implications for Aberrant Inflammation-Induced Trophoblast Dysfunction. Cells 2022, 11, 1413. [Google Scholar] [CrossRef] [PubMed]
- Gomez-Lopez, N.; Motomura, K.; Miller, D.; Garcia-Flores, V.; Galaz, J.; Romero, R. Inflammasomes: Their role in normal and complicated pregnancies. J. Immunol. 2019, 203, 2757. [Google Scholar] [CrossRef] [PubMed]
- Weel, I.C.; Romao-Veiga, M.; Matias, M.L.; Fioratti, E.G.; Peracoli, J.C.; Borges, V.T.; Araujo Jr, J.P.; Serrao Peracoli, M.T. Inflammasome Activation in Placenta from Pregnant Women with Preeclampsia: Immune and Inflammatory Mechanisms. Pregnancy Hypertens. Int. J. Women’s Cardiovasc. Health 2016, 6, 189–190. [Google Scholar] [CrossRef]
- Von Dadelszen, P.; Payne, B.; Li, J.; Ansermino, J.M.; Pipkin, F.B.; Côté, A.M.; Douglas, M.J.; Gruslin, A.; Hutcheon, J.A.; Joseph, K.S.; et al. Prediction of Adverse Maternal Outcomes in Pre-Eclampsia: Development and Validation of the FullPIERS Model. Lancet 2011, 377, 219–227. [Google Scholar] [CrossRef]
- Sibai, B.M. Evaluation and Management of Severe Preeclampsia before 34 Weeks’ Gestation. Am. J. Obstet. Gynecol. 2011, 205, 191–198. [Google Scholar] [CrossRef]
- Ortega, M.A.; Fraile-Martinez, O.; García-Montero, C.; Funes Moñux, R.M.; Rodriguez-Martín, S.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Saez, M.A.; Guijarro, L.G.; et al. The Placentas of Women Who Suffer an Episode of Psychosis during Pregnancy Have Increased Lipid Peroxidation with Evidence of Ferroptosis. Biomolecules 2023, 13, 120. [Google Scholar] [CrossRef]
- García-Montero, C.; Fraile-Martinez, O.; Rodriguez-Martín, S.; Funes Moñux, R.M.; Saz, J.V.; Bravo, C.; De Leon-Luis, J.A.; Ruiz-Minaya, M.; Pekarek, L.; Saez, M.A.; et al. Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease. Antioxidants 2022, 11, 2277. [Google Scholar] [CrossRef]
- Ortega, M.A.; Sáez, M.A.; Fraile-Martínez, O.; Álvarez-Mon, M.A.; García-Montero, C.; Guijarro, L.G.; Asúnsolo, Á.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; et al. Overexpression of Glycolysis Markers in Placental Tissue of Pregnant Women with Chronic Venous Disease: A Histological Study. Int. J. Med. Sci. 2022, 19, 186. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Vallone, P.M.; Butler, J.M. AutoDimer: A Screening Tool for Primer-Dimer and Hairpin Structures. Biotechniques 2004, 37, 226–231. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Fraile-Martinez, O.; Pekarek, L.; García-Montero, C.; Alvarez-Mon, M.A.; Castellanos, A.J.; García-Honduvilla, N.; Buján, J.; Alvarez-Mon, M.; Sáez, M.A.; et al. Oxidative Stress Markers Are Associated with a Poor Prognosis in Patients with Pancreatic Cancer. Antioxidants 2022, 11, 759. [Google Scholar] [CrossRef] [PubMed]
- Verlohren, S.; Melchiorre, K.; Khalil, A.; Thilaganathan, B. Uterine Artery Doppler, Birth Weight and Timing of Onset of Pre-Eclampsia: Providing Insights into the Dual Etiology of Late-Onset Pre-Eclampsia. Ultrasound Obstet. Gynecol. 2014, 44, 293–298. [Google Scholar] [CrossRef]
- Marín, R.; Chiarello, D.I.; Abad, C.; Rojas, D.; Toledo, F.; Sobrevia, L. Oxidative Stress and Mitochondrial Dysfunction in Early-Onset and Late-Onset Preeclampsia. Biochim. Biophys. Acta-Mol. Basis Dis. 2020, 1866, 165961. [Google Scholar] [CrossRef]
- Kelley, N.; Jeltema, D.; Duan, Y.; He, Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int. J. Mol. Sci. 2019, 20, 3328. [Google Scholar] [CrossRef]
- Yin, Y.; Yan, Y.; Jiang, X.; Mai, J.; Chen, N.C.; Wang, H.; Yang, X.F. Inflammasomes are differentially expressed in cardiovascualr and other tissues. Int. J. Immunopathol. Pharmacol. 2009, 22, 311. [Google Scholar] [CrossRef]
- Nahed, R.A.; Mikhael, M.E.; Reynaud, D.; Collet, C.; Lemaitre, N.; Michy, T.; Hoffmann, P.; Sergent, F.; Marquette, C.; Murthi, P.; et al. Role of NLRP7 in Normal and Malignant Trophoblast Cells. Biomedicines 2022, 10, 252. [Google Scholar] [CrossRef]
- Liu, X.; Zhu, L.; Huang, Z.; Li, Z.; Duan, R.; Li, H.; Xie, L.; Chen, X.; Ding, W.; Chen, B.; et al. A Dynamic Peripheral Immune Landscape during Human Pregnancy. Fundam. Res. 2022; in press. [Google Scholar] [CrossRef]
- Shirasuna, K.; Karasawa, T.; Takahashi, M. Role of the NLRP3 Inflammasome in Preeclampsia. Front. Endocrinol. 2020, 11, 80. [Google Scholar] [CrossRef]
- Nunes, P.R.; Romao-Veiga, M.; Peracoli, M.T.S.; Peracoli, J.C.; Sandrim, V.C. Potential Role of Uric Acid to Activate NLRP3 Inflammasome Triggering Endothelial Dysfunction in Preeclampsia. Clin. Immunol. Commun. 2022, 2, 69–75. [Google Scholar] [CrossRef]
- Braga, T.T.; Forni, M.F.; Correa-Costa, M.; Ramos, R.N.; Barbuto, J.A.; Branco, P.; Castoldi, A.; Hiyane, M.I.; Davanso, M.R.; Latz, E.; et al. Soluble Uric Acid Activates the NLRP3 Inflammasome. Sci. Rep. 2017, 7, 39884. [Google Scholar] [CrossRef] [PubMed]
- Matias, M.L.; Romão, M.; Weel, I.C.; Ribeiro, V.R.; Nunes, P.R.; Borges, V.T.; Araújo, J.P.; Peraçoli, J.C.; De Oliveira, L.; Peraçoli, M.T. Endogenous and Uric Acid-Induced Activation of NLRP3 Inflammasome in Pregnant Women with Preeclampsia. PLoS ONE 2015, 10, e0129095. [Google Scholar] [CrossRef]
- Agrawal, I.; Jha, S. Comprehensive Review of ASC Structure and Function in Immune Homeostasis and Disease. Mol. Biol. Rep. 2020, 47, 3077–3096. [Google Scholar] [CrossRef]
- Masumoto, J.; Taniguchi, S.; Nakayama, J.; Shiohara, M.; Hidaka, E.; Katsuyama, T.; Murase, S.; Sagara, J. Expression of Apoptosis-Associated Speck-like Protein Containing a Caspase Recruitment Domain, a Pyrin N-Terminal Homology Domain-Containing Protein, in Normal Human Tissues. J. Histochem. Cytochem. 2001, 49, 1269–1275. [Google Scholar] [CrossRef] [PubMed]
- Compan, V.; Martín-Sánchez, F.; Baroja-Mazo, A.; López-Castejón, G.; Gomez, A.I.; Verkhratsky, A.; Brough, D.; Pelegrín, P. Apoptosis-Associated Speck-like Protein Containing a CARD Forms Specks but Does Not Activate Caspase-1 in the Absence of NLRP3 during Macrophage Swelling. J. Immunol. 2015, 194, 1261–1273. [Google Scholar] [CrossRef]
- Afonina, I.S.; Müller, C.; Martin, S.J.; Beyaert, R. Proteolytic Processing of Interleukin-1 Family Cytokines: Variations on a Common Theme. Immunity 2015, 42, 991–1004. [Google Scholar] [CrossRef]
- Tapia, V.S.; Daniels, M.J.D.; Palazón-Riquelme, P.; Dewhurst, M.; Luheshi, N.M.; Rivers-Auty, J.; Green, J.; Redondo-Castro, E.; Kaldis, P.; Lopez-Castejon, G.; et al. The Three Cytokines IL-1β, IL-18, and IL-1α Share Related but Distinct Secretory Routes. J. Biol. Chem. 2019, 294, 8325. [Google Scholar] [CrossRef]
- Lee, J.K.; Kim, S.H.; Lewis, E.C.; Azam, T.; Reznikov, L.L.; Dinarello, C.A. Differences in Signaling Pathways by IL-1β and IL-18. Proc. Natl. Acad. Sci. USA 2004, 101, 8815. [Google Scholar] [CrossRef]
- Southcombe, J.H.; Redman, C.W.G.; Sargent, I.L.; Granne, I. Interleukin-1 Family Cytokines and Their Regulatory Proteins in Normal Pregnancy and Pre-Eclampsia. Clin. Exp. Immunol. 2015, 181, 480. [Google Scholar] [CrossRef]
- Löb, S.; Vilsmaier, T.; Schmoeckel, E.; Mahner, S.; Wöckel, A.; Jeschke, U. The Cytokines IL-1b and IL-18 Are Upregulated in the Placenta of Recurrent Miscarriage Patients. J. Reprod. Immunol. 2023, 158, 103583. [Google Scholar] [CrossRef]
- Yockey, L.J.; Iwasaki, A. Interferons and Proinflammatory Cytokines in Pregnancy and Fetal Development. Immunity 2018, 49, 397–412. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, S.M.; Sobey, C.G.; Latz, E.; Mansell, A.; Drummond, G.R. IL–1β and IL–18: Inflammatory Markers or Mediators of Hypertension? Br. J. Pharmacol. 2014, 171, 5589. [Google Scholar] [CrossRef] [PubMed]
- Weel, C.I.; Romão-Veiga, M.; Matias, M.L.; Fioratti, E.G.; Peraçoli, J.C.; Borges, V.T.; Araujo, J.P.; Peraçoli, M.T. Increased Expression of NLRP3 Inflammasome in Placentas from Pregnant Women with Severe Preeclampsia. J. Reprod. Immunol. 2017, 123, 40–47. [Google Scholar] [CrossRef]
- Bolívar, B.E.; Brown-Suedel, A.N.; Rohrman, B.A.; Charendoff, C.I.; Yazdani, V.; Belcher, J.D.; Vercellotti, G.M.; Flanagan, J.M.; Bouchier-Hayes, L. Noncanonical Roles of Caspase-4 and Caspase-5 in Heme-Driven IL-1β Release and Cell Death. J. Immunol. 2021, 206, 1878–1889. [Google Scholar] [CrossRef]
- Matikainen, S.; Nyman, T.A.; Cypryk, W. Function and Regulation of Noncanonical Caspase-4/5/11 Inflammasome. J. Immunol. 2020, 204, 3063–3069. [Google Scholar] [CrossRef]
- Yi, Y.S. Regulatory Roles of the Caspase-11 Non-Canonical Inflammasome in Inflammatory Diseases. Immune Netw. 2018, 18, e41. [Google Scholar] [CrossRef]
- Mandal, R.; Barrón, J.C.; Kostova, I.; Becker, S.; Strebhardt, K. Caspase-8: The Double-Edged Sword. Biochim. Biophys. Acta-Rev. Cancer 2020, 1873, 188357. [Google Scholar] [CrossRef]
- Gurung, P.; Kanneganti, T.D. Novel Roles for Caspase-8 in IL-1β and Inflammasome Regulation. Am. J. Pathol. 2015, 185, 17–25. [Google Scholar] [CrossRef]
- Belousova, V.; Svitich, O.; Timokhina, E.; Ignatko, I.; Bogomazova, I.; Pesegova, S.; Silaeva, T.; Kuzmina, T.; Skorobogatova, O. Caspase-3, Caspase-8 and XIAP Gene Expression in the Placenta: Exploring the Causes of Spontaneous Preterm Labour. Int. J. Mol. Sci. 2023, 24, 1692. [Google Scholar] [CrossRef]
- Salman, H.; Shah, M.; Habib, S.H.; Rapisarda, A.M.C.; Riemma, G.; Fichera, M. Pathogenesis of Preeclampsia: Implications of Apoptotic Markers and Oxidative Stress. Hum. Exp. Toxicol. 2013, 32, 27–52. [Google Scholar] [CrossRef]
HC (n = 43) | LO-PE (n = 68) | p-Value | |
Maternal Age (years) Mean ± SD | 31,348 ± 5117 | 29,015 ± 4816 | * p = 0.0154 |
Nulliparous (%) Total number | 14 (32.56) | 53 (77.94) | *** p < 0.0001 |
Gestation (weeks) | 39,069 ± 1486 | 38,627 ± 1434 | NS |
C-Section (%) Total number | 8 (18.60) | 15 (22.06) | NS |
Placental Weight (g) | 500,977 ± 65,331 | 370,254 ± 61,647 | *** p < 0.0001 |
Antigen | Species | Dilution | Provider | Protocol Specifications |
---|---|---|---|---|
NLRP3 | Rabbit Monoclonal | 1:500 | Abcam (ab263,899) | 10 mM Sodium citrate pH = 6, before incubation with blocking solution |
ASC | Rabbit monoclonal | 1:250 | Abcam (ab283,684) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
Caspase 1 | Rabbit Polyclonal | 1:500 | Abcam (ab62,698) | EDTA pH = 9, before incubation with blocking solution |
Caspase 5 | Rabbit monoclonal | 1:100 | Abcam (ab40,887) | 10 mM Sodium citrate pH = 6, before incubation with blocking solution |
Caspase 8 | Rabbit polyclonal | 1:250 | Abcam (ab25,901) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
IL-1β | Rabbit recombinant multiclonal | 1:50 | Abcam (ab283,818) | Not Specifications |
IL-18 | Rabbit monoclonal | 1:50 | Abcam (ab243,091) | Not Specifications |
IgG (Rabbit) | Mouse | 1:1000 | Sigma-Aldrich (RG96/B5283) | Not Specifications |
GENE | SEQUENCE Fwd (5′→3′) | SEQUENCE Rev (5′→3′) | Temp |
---|---|---|---|
TBP | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | 60 °C |
NLRP3 | GCTGGCATCTGGATGAGGAA | GTGTGTCCTGAGCCATGGAA | 61 °C |
ASC | ATCCAGGCCCCTCCTCAG | AGAGCTTCCGCATCTTGCTT | 60 °C |
Caspase 1 | GAAAAGCCATGGCCGACAAG | GCTGTCAGAGGTCTTGTGCT | 57 °C |
Caspase 5 | TGTTAGCTATGGCTGAAGACAGT | TTGATGAGCCACGCGATTCT | 58 °C |
Caspase 8 | GTCTGTACCTTTCTGGCGGA | CTCAGGCTCTGGCAAAGTGA | 60 °C |
IL-1β | AGCCATGGCAGAAGTACCTG | TGAAGCCCTTGCTGTAGTGG | 60 °C |
IL-18 | GCTGAAGATGATGAAAACCTGGA | GAGGCCGATTTCCTTGGTCA | 59 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Garcia-Puente, L.M.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; Pintado, P.; Ruiz-Labarta, F.J.; Álvarez-Mon, M.; et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules 2023, 13, 1644. https://doi.org/10.3390/biom13111644
Garcia-Puente LM, Fraile-Martinez O, García-Montero C, Bujan J, De León-Luis JA, Bravo C, Rodríguez-Benitez P, Pintado P, Ruiz-Labarta FJ, Álvarez-Mon M, et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules. 2023; 13(11):1644. https://doi.org/10.3390/biom13111644
Chicago/Turabian StyleGarcia-Puente, Luis M., Oscar Fraile-Martinez, Cielo García-Montero, Julia Bujan, Juan A. De León-Luis, Coral Bravo, Patrocinio Rodríguez-Benitez, Pilar Pintado, Francisco Javier Ruiz-Labarta, Melchor Álvarez-Mon, and et al. 2023. "Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery" Biomolecules 13, no. 11: 1644. https://doi.org/10.3390/biom13111644