S100s and HMGB1 Crosstalk in Pancreatic Cancer Tumors
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Pancreatic Tumor cDNA Array
2.3. Real-Time PCR
2.4. Statistical Analysis
3. Results
3.1. S100A2
3.2. S100A4
3.3. S100A6
3.4. S100A7
3.5. S100A8
3.6. S100A9
3.7. S100A10
3.8. S100A11
3.9. S100A12
3.10. S100A13
3.11. S100A14
3.12. S100A16
3.13. S100P
3.14. HMGB1
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cancer.net. Pancreatic Cancer: Statistics. Available online: https://www.cancer.net/cancer-types/pancreatic-cancer/statistics#:~:text=The%205%2Dyear%20relative%20survival%20rate%20for%20pancreatic%20cancer%20in:well%20the%20treatment%20plan%20works (accessed on 20 May 2023).
- Halbrook, C.J.; Lyssiotis, C.A.; di Magliano, M.P.; Maitra, A. Pancreatic Cancer: Advances and Challenges. Cell 2023, 186, 1729–1754. [Google Scholar] [CrossRef] [PubMed]
- Leclerc, E.; Vetter, S.W. The Role of S100 Proteins and Their Receptor Rage in Pancreatic Cancer. Biochim. Biophys. Acta 2015, 1852, 2706–2711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, R.; Tang, D. The Dual Role of Hmgb1 in Pancreatic Cancer. J. Pancreatol. 2018, 1, 19–24. [Google Scholar] [CrossRef]
- Kang, R.; Chen, R.; Zhang, Q.; Hou, W.; Wu, S.; Cao, L.; Huang, J.; Yu, Y.; Fan, X.G.; Yan, Z.; et al. HMGB1 in Health and Disease. Mol. Aspects Med. 2014, 40, 1–116. [Google Scholar] [CrossRef] [Green Version]
- Marenholz, I.; Lovering, R.C.; Heizmann, C.W. An Update of the S100 Nomenclature. Biochim. Biophys. Acta 2006, 1763, 1282–1283. [Google Scholar] [CrossRef] [Green Version]
- Donato, R.; Cannon, B.R.; Sorci, G.; Riuzzi, F.; Hsu, K.; Weber, D.J.; Geczy, C.L. Functions of S100 Proteins. Curr. Mol. Med. 2013, 13, 24–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Donato, R. Intracellular and Extracellular Roles of S100 Proteins. Microsc. Res. Tech. 2003, 60, 540–551. [Google Scholar] [CrossRef] [PubMed]
- Bresnick, A.R.; Weber, D.J.; Zimmer, D.B. S100 Proteins in Cancer. Nat. Rev. Cancer 2015, 15, 96–109. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Xu, C.; Jin, Q.; Liu, Z. S100 Protein Family in Human Cancer. Am. J. Cancer Res. 2014, 4, 89–115. [Google Scholar]
- Arumugam, T.; Ramachandran, V.; Gomez, S.B.; Schmidt, A.M.; Logsdon, C.D. S100p-Derived Rage Antagonistic Peptide Reduces Tumor Growth and Metastasis. Clin. Cancer Res. 2012, 18, 4356–4364. [Google Scholar] [CrossRef] [Green Version]
- Arumugam, T.; Ramachandran, V.; Logsdon, C.D. Effect of Cromolyn on S100P Interactions with Rage and Pancreatic Cancer Growth and Invasion in Mouse Models. J. Natl. Cancer Inst. 2006, 98, 1806–1818. [Google Scholar] [CrossRef] [PubMed]
- Arumugam, T.; Ramachandran, V.; Sun, D.; Peng, Z.; Pal, A.; Maxwell, D.S.; Bornmann, W.G.; Logsdon, C.D. Designing and Developing S100P Inhibitor 5-Methyl Cromolyn for Pancreatic Cancer Therapy. Mol. Cancer Ther. 2013, 12, 654–662. [Google Scholar] [CrossRef] [Green Version]
- Arumugam, T.; Simeone, D.M.; Schmidt, A.M.; Logsdon, C.D. S100P Stimulates Cell Proliferation and Survival Via Receptor for Activated Glycation End Products (Rage). J. Biol. Chem. 2004, 279, 5059–5065. [Google Scholar] [CrossRef] [Green Version]
- Arumugam, T.; Simeone, D.M.; Van Golen, K.; Logsdon, C.D. S100p Promotes Pancreatic Cancer Growth, Survival, and Invasion. Clin. Cancer Res. 2005, 11, 5356–5364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sekine, H.; Chen, N.; Sato, K.; Saiki, Y.; Yoshino, Y.; Umetsu, Y.; Jin, G.; Nagase, H.; Gu, Z.; Fukushige, S.; et al. S100A4, Frequently Overexpressed in Various Human Cancers, Accelerates Cell Motility in Pancreatic Cancer Cells. Biochem. Biophys. Res. Commun. 2012, 429, 214–219. [Google Scholar] [CrossRef] [PubMed]
- Tabata, T.; Tsukamoto, N.; Fooladi, A.A.; Yamanaka, S.; Furukawa, T.; Ishida, M.; Sato, D.; Gu, Z.; Nagase, H.; Egawa, S.; et al. RNA Interference Targeting against S100A4 Suppresses Cell Growth and Motility and Induces Apoptosis in Human Pancreatic Cancer Cells. Biochem. Biophys. Res. Commun. 2009, 390, 475–480. [Google Scholar] [CrossRef]
- Deer, E.L.; Gonzalez-Hernandez, J.; Coursen, J.D.; Shea, J.E.; Ngatia, J.; Scaife, C.L.; Firpo, M.A.; Mulvihill, S.J. Phenotype and Genotype of Pancreatic Cancer Cell Lines. Pancreas 2010, 39, 425–435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsukamoto, N.; Egawa, S.; Akada, M.; Abe, K.; Saiki, Y.; Kaneko, N.; Yokoyama, S.; Shima, K.; Yamamura, A.; Motoi, F.; et al. The Expression of S100a4 in Human Pancreatic Cancer Is Associated with Invasion. Pancreas 2013, 42, 1027–1033. [Google Scholar] [CrossRef]
- Kozono, S.; Ohuchida, K.; Ohtsuka, T.; Cui, L.; Eguchi, D.; Fujiwara, K.; Zhao, M.; Mizumoto, K.; Tanaka, M. S100a4 Mrna Expression Level Is a Predictor of Radioresistance of Pancreatic Cancer Cells. Oncol. Rep. 2013, 30, 1601–1608. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Bunston, C.; Hodson, N.; Resaul, J.; Sun, P.H.; Cai, S.; Chen, G.; Gu, Y.; Satherley, L.K.; Bosanquet, D.C.; et al. Psoriasin Promotes Invasion, Aggregation and Survival of Pancreatic Cancer Cells; Association with Disease Progression. Int. J. Oncol. 2017, 50, 1491–1500. [Google Scholar] [CrossRef]
- Suzuki, S.; Yamayoshi, Y.; Nishimuta, A.; Tanigawara, Y. S100A10 Protein Expression Is Associated with Oxaliplatin Sensitivity in Human Colorectal Cancer Cells. Proteome Sci. 2011, 9, 76. [Google Scholar] [CrossRef] [Green Version]
- McKiernan, E.; McDermott, E.W.; Evoy, D.; Crown, J.; Duffy, M.J. The Role of S100 Genes in Breast Cancer Progression. Tumour Biol. 2011, 32, 441–450. [Google Scholar] [CrossRef]
- Katono, K.; Sato, Y.; Jiang, S.X.; Kobayashi, M.; Saito, K.; Nagashio, R.; Ryuge, S.; Satoh, Y.; Saegusa, M.; Masuda, N. Clinicopathological Significance of S100A10 Expression in Lung Adenocarcinomas. Asian Pac. J. Cancer Prev. 2016, 17, 289–294. [Google Scholar] [CrossRef] [Green Version]
- El-Rifai, W.; Moskaluk, C.A.; Abdrabbo, M.K.; Harper, J.; Yoshida, C.; Riggins, G.J.; Frierson, H.F., Jr.; Powell, S.M. Gastric Cancers Overexpress S100A Calcium-Binding Proteins. Cancer Res. 2002, 62, 6823–6826. [Google Scholar]
- Bydoun, M.; Sterea, A.; Liptay, H.; Uzans, A.; Huang, W.Y.; Rodrigues, G.J.; Weaver, I.C.G.; Gu, H.; Waisman, D.M. S100A10, a Novel Biomarker in Pancreatic Ductal Adenocarcinoma. Mol. Oncol. 2018, 12, 1895–1916. [Google Scholar] [CrossRef]
- Iacobuzio-Donahue, C.A.; Maitra, A.; Olsen, M.; Lowe, A.W.; van Heek, N.T.; Rosty, C.; Walter, K.; Sato, N.; Parker, A.; Ashfaq, R.; et al. Exploration of Global Gene Expression Patterns in Pancreatic Adenocarcinoma Using cDNA Microarrays. Am. J. Pathol. 2003, 162, 1151–1162. [Google Scholar] [CrossRef]
- Li, X.; Qiu, N.; Li, Q. Prognostic Values and Clinical Significance of S100 Family Member’s Individualized Mrna Expression in Pancreatic Adenocarcinoma. Front. Genet. 2021, 12, 758725. [Google Scholar] [CrossRef]
- Gross, S.R.; Sin, C.G.; Barraclough, R.; Rudland, P.S. Joining S100 Proteins and Migration: For Better or for Worse, in Sickness and in Health. Cell Mol. Life Sci. 2014, 71, 1551–1579. [Google Scholar] [CrossRef] [Green Version]
- Ohuchida, K.; Mizumoto, K.; Miyasaka, Y.; Yu, J.; Cui, L.; Yamaguchi, H.; Toma, H.; Takahata, S.; Sato, N.; Nagai, E.; et al. Over-Expression of S100A2 in Pancreatic Cancer Correlates with Progression and Poor Prognosis. J. Pathol. 2007, 213, 275–282. [Google Scholar] [CrossRef]
- Li, H.B.; Wang, J.L.; Jin, X.D.; Zhao, L.; Ye, H.L.; Kuang, Y.B.; Ma, Y.; Jiang, X.Y.; Yu, Z.Y. Comprehensive Analysis of the Transcriptional Expressions and Prognostic Value of S100A Family in Pancreatic Ductal Adenocarcinoma. BMC Cancer 2021, 21, 1039. [Google Scholar] [CrossRef]
- Bachet, J.B.; Marechal, R.; Demetter, P.; Bonnetain, F.; Cros, J.; Svrcek, M.; Bardier-Dupas, A.; Hammel, P.; Sauvanet, A.; Louvet, C.; et al. S100A2 Is a Predictive Biomarker of Adjuvant Therapy Benefit in Pancreatic Adenocarcinoma. Eur. J. Cancer 2013, 49, 2643–2653. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhu, T.; Miao, H.; Liang, B. The Calcium Binding Protein S100A11 and Its Roles in Diseases. Front. Cell Dev. Biol. 2021, 9, 693262. [Google Scholar] [CrossRef]
- Mitsui, Y.; Tomonobu, N.; Watanabe, M.; Kinoshita, R.; Sumardika, I.W.; Youyi, C.; Murata, H.; Yamamoto, K.I.; Sadahira, T.; Rodrigo, A.G.H.; et al. Upregulation of Mobility in Pancreatic Cancer Cells by Secreted S100A11 through Activation of Surrounding Fibroblasts. Oncol. Res. 2019, 27, 945–956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohuchida, K.; Mizumoto, K.; Ohhashi, S.; Yamaguchi, H.; Konomi, H.; Nagai, E.; Yamaguchi, K.; Tsuneyoshi, M.; Tanaka, M. S100a11, a Putative Tumor Suppressor Gene, Is Overexpressed in Pancreatic Carcinogenesis. Clin. Cancer Res. 2006, 12, 5417–5422. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, M.B.; Jiang, F.; Ni, W.K.; Chen, B.Y.; Lu, C.H.; Li, X.Y.; Ni, R.Z. High Expression of S100A11 in Pancreatic Adenocarcinoma Is an Unfavorable Prognostic Marker. Med. Oncol. 2012, 29, 1886–1891. [Google Scholar] [CrossRef]
- Xiao, M.; Li, T.; Ji, Y.; Jiang, F.; Ni, W.; Zhu, J.; Bao, B.; Lu, C.; Ni, R. S100A11 Promotes Human Pancreatic Cancer Panc-1 Cell Proliferation and Is Involved in the Pi3k/Akt Signaling Pathway. Oncol. Lett. 2018, 15, 175–182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pietas, A.; Schlüns, K.; Marenholz, I.; Schäfer, B.W.; Heizmann, C.W.; Petersen, I. Molecular Cloning and Characterization of the Human S100A14 Gene Encoding a Novel Member of the S100 Family. Genomics 2002, 79, 513–522. [Google Scholar] [CrossRef]
- Chen, H.; Yuan, Y.; Zhang, C.; Luo, A.; Ding, F.; Ma, J. Involvement of S100A14 Protein in Cell Invasion by Affecting Expression and Function of Matrix Metalloproteinase (Mmp)-2 Via P53-Dependent Transcriptional Regulation. J. Biol. Chem. 2012, 287, 17109–17119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Ismaeel, Q.; Neal, C.P.; Al-Mahmoodi, H.; Almutairi, Z.; Al-Shamarti, I.; Straatman, K.; Jaunbocus, N.; Irvine, A.; Issa, E.; Moreman, C.; et al. Zeb1 and Il-6/11-Stat3 Signalling Cooperate to Define Invasive Potential of Pancreatic Cancer Cells Via Differential Regulation of the Expression of S100 Proteins. Br. J. Cancer 2019, 121, 65–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gebhardt, C.; Nemeth, J.; Angel, P.; Hess, J. S100a8 and S100a9 in Inflammation and Cancer. Biochem. Pharmacol. 2006, 72, 1622–1631. [Google Scholar] [CrossRef]
- Soyfoo, M.S.; Roth, J.; Vogl, T.; Pochet, R.; Decaux, G. Phagocyte-Specific S100A8/A9 Protein Levels During Disease Exacerbations and Infections in Systemic Lupus Erythematosus. J. Rheumatol. 2009, 36, 2190–2194. [Google Scholar] [CrossRef] [PubMed]
- Ang, C.W.; Nedjadi, T.; Sheikh, A.A.; Tweedle, E.M.; Tonack, S.; Honap, S.; Jenkins, R.E.; Park, B.K.; Schwarte-Waldhoff, I.; Khattak, I.; et al. Smad4 Loss Is Associated with Fewer S100A8-Positive Monocytes in Colorectal Tumors and Attenuated Response to S100A8 in Colorectal and Pancreatic Cancer Cells. Carcinogenesis 2010, 31, 1541–1551. [Google Scholar] [CrossRef] [Green Version]
- Sheikh, A.A.; Vimalachandran, D.; Thompson, C.C.; Jenkins, R.E.; Nedjadi, T.; Shekouh, A.; Campbell, F.; Dodson, A.; Prime, W.; Crnogorac-Jurcevic, T.; et al. The Expression of S100A8 in Pancreatic Cancer-Associated Monocytes Is Associated with the Smad4 Status of Pancreatic Cancer Cells. Proteomics 2007, 7, 1929–1940. [Google Scholar] [CrossRef] [PubMed]
- Yin, C.; Li, H.; Zhang, B.; Liu, Y.; Lu, G.; Lu, S.; Sun, L.; Qi, Y.; Li, X.; Chen, W. Rage-Binding S100A8/A9 Promotes the Migration and Invasion of Human Breast Cancer Cells through Actin Polymerization and Epithelial-Mesenchymal Transition. Breast Cancer Res. Treat. 2013, 142, 297–309. [Google Scholar] [CrossRef]
- Wang, L.; Yan, W.; Li, X.; Liu, Z.; Tian, T.; Chen, T.; Zou, L.; Cui, Z. S100A10 Silencing Suppresses Proliferation, Migration and Invasion of Ovarian Cancer Cells and Enhances Sensitivity to Carboplatin. J. Ovarian Res. 2019, 12, 113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sturchler, E.; Cox, J.A.; Durussel, I.; Weibel, M.; Heizmann, C.W. S100A16, a Novel Calcium-Binding Protein of the Ef-Hand Superfamily. J. Biol. Chem. 2006, 281, 38905–38917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, W.; Xue, Y.; Liang, C.; Zhang, R.; Zhang, Z.; Li, H.; Su, D.; Liang, X.; Zhang, Y.; Huang, Q.; et al. S100A16 Promotes Cell Proliferation and Metastasis Via Akt and Erk Cell Signaling Pathways in Human Prostate Cancer. Tumour Biol. 2016, 37, 12241–12250. [Google Scholar] [CrossRef]
- Zhou, W.; Pan, H.; Xia, T.; Xue, J.; Cheng, L.; Fan, P.; Zhang, Y.; Zhu, W.; Xue, Y.; Liu, X.; et al. Up-Regulation of S100A16 Expression Promotes Epithelial-Mesenchymal Transition Via Notch1 Pathway in Breast Cancer. J. Biomed. Sci. 2014, 21, 97. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, M.; Ichikawa-Tomikawa, N.; Shishito, N.; Nishiura, K.; Miura, T.; Hozumi, A.; Chiba, H.; Yoshida, S.; Ohtake, T.; Sugino, T. Co-Expression of S100A14 and S100A16 Correlates with a Poor Prognosis in Human Breast Cancer and Promotes Cancer Cell Invasion. BMC Cancer 2015, 15, 53. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Wang, T.; Zhang, C.; Ning, K.; Guan, Z.R.; Chen, S.X.; Hong, T.T.; Hua, D. S100a16 Is a Prognostic Marker for Colorectal Cancer. J. Surg. Oncol. 2018, 117, 275–283. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.H.; Miao, Z.W.; Jiang, Q.Z.; Gan, D.X.; Wei, X.G.; Xue, X.Z.; Li, J.Q.; Zheng, F.; Qin, X.X.; Fang, W.G.; et al. Brain Microvascular Endothelial Cell Exosome-Mediated S100A16 up-Regulation Confers Small-Cell Lung Cancer Cell Survival in Brain. Faseb J. 2019, 33, 1742–1757. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tu, G.; Gao, W.; Li, Y.; Dian, Y.; Xue, B.; Niu, L.; Yu, X.; Zhu, H. Expressional and Prognostic Value of S100A16 in Pancreatic Cancer Via Integrated Bioinformatics Analyses. Front. Cell Dev. Biol. 2021, 9, 645641. [Google Scholar] [CrossRef]
- Arumugam, T.; Logsdon, C.D. S100P: A Novel Therapeutic Target for Cancer. Amino Acids 2011, 41, 893–899. [Google Scholar] [CrossRef]
- Ali, A.; Brown, V.; Denley, S.; Jamieson, N.B.; Morton, J.P.; Nixon, C.; Graham, J.S.; Sansom, O.J.; Carter, C.R.; McKay, C.J.; et al. Expression of Koc, S100P, Mesothelin and Muc1 in Pancreatico-Biliary Adenocarcinomas: Development and Utility of a Potential Diagnostic Immunohistochemistry Panel. BMC Clin. Pathol. 2014, 14, 35. [Google Scholar] [CrossRef] [Green Version]
- Hu, H.; Zhang, Q.; Huang, C.; Shen, Y.; Chen, X.; Shi, X.; Tang, W. Diagnostic Value of S100P for Pancreatic Cancer: A Meta-Analysis. Tumour Biol. 2014, 35, 9479–9485. [Google Scholar]
- Penumutchu, S.R.; Chou, R.H.; Yu, C. Interaction between S100P and the Anti-Allergy Drug Cromolyn. Biochem. Biophys. Res. Commun. 2014, 454, 404–409. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.E.; Lim, S.K.; Kim, J.S. In Vivo Antitumor Effect of Cromolyn in Pegylated Liposomes for Pancreatic Cancer. J. Control Release 2012, 157, 190–195. [Google Scholar]
- Dakhel, S.; Padilla, L.; Adan, J.; Masa, M.; Martinez, J.M.; Roque, L.; Coll, T.; Hervas, R.; Calvis, C.; Messeguer, R.; et al. S100P Antibody-Mediated Therapy as a New Promising Strategy for the Treatment of Pancreatic Cancer. Oncogenesis 2014, 3, e92. [Google Scholar]
- Swami, P.; O’Connell, K.A.; Thiyagarajan, S.; Crawford, A.; Patil, P.; Radhakrishnan, P.; Shin, S.; Caffrey, T.C.; Grunkemeyer, J.; Neville, T.; et al. Inhibition of the Receptor for Advanced Glycation End Products Enhances the Cytotoxic Effect of Gemcitabine in Murine Pancreatic Tumors. Biomolecules 2021, 11, 526. [Google Scholar] [CrossRef]
- Kang, R.; Livesey, K.M.; Zeh, H.J.; Loze, M.T.; Tang, D. HMGB1: A Novel Beclin 1-Binding Protein Active in Autophagy. Autophagy 2010, 6, 1209–1211. [Google Scholar] [CrossRef] [Green Version]
- Dong Xda, E.; Ito, N.; Lotze, M.T.; Demarco, R.A.; Popovic, P.; Shand, S.H.; Watkins, S.; Winikoff, S.; Brown, C.K.; Bartlett, D.L.; et al. High Mobility Group Box I (HMGB1) Release from Tumor Cells after Treatment: Implications for Development of Targeted Chemoimmunotherapy. J. Immunother. 2007, 30, 596–606. [Google Scholar] [CrossRef]
- Sims, G.P.; Rowe, D.C.; Rietdijk, S.T.; Herbst, R.; Coyle, A.J. HMGB1 and Rage in Inflammation and Cancer. Annu. Rev. Immunol. 2010, 28, 367–388. [Google Scholar] [CrossRef]
- Taguchi, A.; Blood, D.C.; del Toro, G.; Canet, A.; Lee, D.C.; Qu, W.; Tanji, N.; Lu, Y.; Lalla, E.; Fu, C.; et al. Blockade of Rage-Amphoterin Signalling Suppresses Tumour Growth and Metastases. Nature 2000, 405, 354–360. [Google Scholar] [CrossRef]
- Pierce, A.; Barron, N.; Linehan, R.; Ryan, E.; O’Driscoll, L.; Daly, C. Identification of a Novel, Functional Role for S100A13 in Invasive Lung Cancer Cell Lines. Eur. J. Cancer 2008, 44, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Xiong, T.F.; Pan, F.Q.; Li, D. Expression and Clinical Significance of S100 Family Genes in Patients with Melanoma. Melanoma Res. 2019, 29, 23–29. [Google Scholar] [CrossRef]
- Su, Y.; Xu, C.; Sun, Z.; Liang, Y.; Li, G.; Tong, T.; Chen, J. S100A13 Promotes Senescence-Associated Secretory Phenotype and Cellular Senescence Via Modulation of Non-Classical Secretion of Il-1alpha. Aging 2019, 11, 549–572. [Google Scholar] [CrossRef] [PubMed]
- Bernal, G.M.; Wu, L.; Voce, D.J.; Weichselbaum, R.R.; Yamini, B. P52 Signaling Promotes Cellular Senescence. Cell Biosci. 2022, 12, 43. [Google Scholar] [CrossRef]
- Slomnicki, L.P.; Lesniak, W. S100A6 (Calcyclin) Deficiency Induces Senescence-Like Changes in Cell Cycle, Morphology and Functional Characteristics of Mouse NIH 3T3 Fibroblasts. J. Cell Biochem. 2010, 109, 576–584. [Google Scholar]
- Saul, D.; Kosinsky, R.L.; Atkinson, E.J.; Doolittle, M.L.; Zhang, X.; LeBrasseur, N.K.; Pignolo, R.J.; Robbins, P.D.; Niedernhofer, L.J.; Ikeno, Y.; et al. A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways across Tissues. Nat. Commun. 2022, 13, 4827. [Google Scholar] [CrossRef]
- Ismail, T.M.; Fernig, D.G.; Rudland, P.S.; Terry, C.J.; Wang, G.; Barraclough, R. The Basic C-Terminal Amino Acids of Calcium-Binding Protein S100A4 Promote Metastasis. Carcinogenesis 2008, 29, 2259–2266. [Google Scholar] [CrossRef] [Green Version]
- Shang, S.; Hua, F.; Hu, Z.W. The Regulation of Beta-Catenin Activity and Function in Cancer: Therapeutic Opportunities. Oncotarget 2017, 8, 33972–33989. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rescher, U.; Gerke, V. S100A10/P11: Family, Friends and Functions. Pflugers Arch. 2008, 455, 575–582. [Google Scholar] [CrossRef]
- Murzik, U.; Hemmerich, P.; Weidtkamp-Peters, S.; Ulbricht, T.; Bussen, W.; Hentschel, J.; von Eggeling, F.; Melle, C. Rad54b Targeting to DNA Double-Strand Break Repair Sites Requires Complex Formation with S100a11. Mol. Biol. Cell 2008, 19, 2926–2935. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Austermann, J.; Nazmi, A.R.; Muller-Tidow, C.; Gerke, V. Characterization of the Ca2+-Regulated Ezrin-S100P Interaction and Its Role in Tumor Cell Migration. J. Biol. Chem. 2008, 283, 29331–29340. [Google Scholar] [CrossRef] [Green Version]
- Leclerc, E. Measuring Binding of S100 Proteins to RAGE by Surface Plasmon Resonance. Methods Mol. Biol. 2013, 963, 201–213. [Google Scholar]
- Leclerc, E.; Fritz, G.; Vetter, S.W.; Heizmann, C.W. Binding of S100 Proteins to RAGE: An Update. Biochim. Biophys. Acta 2009, 1793, 993–1007. [Google Scholar] [CrossRef] [Green Version]
- Riuzzi, F.; Sorci, G.; Donato, R. The Amphoterin (Hmgb1)/Receptor for Advanced Glycation End Products (Rage) Pair Modulates Myoblast Proliferation, Apoptosis, Adhesiveness, Migration, and Invasiveness. Functional Inactivation of Rage in L6 Myoblasts Results in Tumor Formation in Vivo. J. Biol. Chem. 2006, 281, 8242–8253. [Google Scholar] [CrossRef] [Green Version]
- Meghnani, V.; Wagh, A.; Indurthi, V.S.; Koladia, M.; Vetter, S.W.; Law, B.; Leclerc, E. The Receptor for Advanced Glycation End Products Influences the Expression of Its S100 Protein Ligands in Melanoma Tumors. Int. J. Biochem. Cell Biol. 2014, 57, 54–62. [Google Scholar] [CrossRef]
- Kang, R.; Hou, W.; Zhang, Q.; Chen, R.; Lee, Y.J.; Bartlett, D.L.; Lotze, M.T.; Tang, D.; Zeh, H.J. Rage Is Essential for Oncogenic Kras-Mediated Hypoxic Signaling in Pancreatic Cancer. Cell Death Dis. 2014, 5, e1480. [Google Scholar] [CrossRef] [Green Version]
- Yan, J.; Huang, Y.J.; Huang, Q.Y.; Liu, P.X.; Wang, C.S. Comprehensive Analysis of the Correlations of S100b with Hypoxia Response and Immune Infiltration in Hepatocellular Carcinoma. PeerJ 2022, 10, e13201. [Google Scholar] [CrossRef]
- Yan, J.; Huang, Y.J.; Huang, Q.Y.; Liu, P.X.; Wang, C.S. Transcriptional Activation of S100A2 Expression by Hif-1alpha Via Binding to the Hypomethylated Hypoxia Response Elements in Hcc Cells. Mol. Carcinog. 2022, 61, 494–507. [Google Scholar] [CrossRef]
- Zhang, R.; Fu, H.; Chen, D.; Hua, J.; Hu, Y.; Sun, K.; Sun, X. Subcellular Distribution of S100A4 and Its Transcriptional Regulation under Hypoxic Conditions in Gastric Cancer Cell Line Bgc823. Cancer Sci. 2010, 101, 1141–1146. [Google Scholar] [CrossRef] [PubMed]
- Grebhardt, S.; Veltkamp, C.; Strobel, P.; Mayer, D. Hypoxia and Hif-1 Increase S100A8 and S100A9 Expression in Prostate Cancer. Int. J. Cancer 2012, 131, 2785–2794. [Google Scholar] [CrossRef] [PubMed]
- Cheng, P.; Ma, Y.; Gao, Z.; Duan, L. High Mobility Group Box 1 (HMGB1) Predicts Invasion and Poor Prognosis of Glioblastoma Multiforme Via Activating Akt Signaling in an Autocrine Pathway. Med. Sci. Monit. 2018, 24, 8916–8924. [Google Scholar] [CrossRef]
- Huber, R.; Meier, B.; Otsuka, A.; Fenini, G.; Satoh, T.; Gehrke, S.; Widmer, D.; Levesque, M.P.; Mangana, J.; Kerl, K.; et al. Tumour Hypoxia Promotes Melanoma Growth and Metastasis Via High Mobility Group Box-1 and M2-Like Macrophages. Sci. Rep. 2016, 6, 29914. [Google Scholar] [CrossRef] [Green Version]
- Song, M.; Li, D.; Makaryan, S.Z.; Finley, S.D. Quantitative Modeling to Understand Cell Signaling in the Tumor Microenvironment. Curr. Opin. Syst. Biol. 2021, 27, 100345. [Google Scholar] [CrossRef]
- Akirav, E.M.; Preston-Hurlburt, P.; Garyu, J.; Henegariu, O.; Clynes, R.; Schmidt, A.M.; Herold, K.C. Rage Expression in Human T Cells: A Link between Environmental Factors and Adaptive Immune Responses. PLoS ONE 2012, 7, e34698. [Google Scholar] [CrossRef] [PubMed]
- Bierhaus, A.; Humpert, P.M.; Morcos, M.; Wendt, T.; Chavakis, T.; Arnold, B.; Stern, D.M.; Nawroth, P.P. Understanding Rage, the Receptor for Advanced Glycation End Products. J. Mol. Med. 2005, 83, 876–886. [Google Scholar] [CrossRef] [PubMed]
- Lohwasser, C.; Neureiter, D.; Weigle, B.; Kirchner, T.; Schuppan, D. The Receptor for Advanced Glycation End Products Is Highly Expressed in the Skin and Upregulated by Advanced Glycation End Products and Tumor Necrosis Factor-Alpha. J. Investig. Dermatol. 2006, 126, 291–299. [Google Scholar] [CrossRef] [Green Version]
Cell Line | Origin | Histologic Differentiation | KRAS | TP53 | P16 | SMAD4 |
---|---|---|---|---|---|---|
AsPC-1 | Ascites | Poor | G12D | R273H HD | WT | Conflicting results reported. WT/HD exons 1-11/Mut exon 2 |
BxPC-3 | Primary tumor | Moderate to poor | WT | Y220C | WT | HD exons 1-11 |
Capan-2 | Primary tumor | Well | G12V | WT | WT | WT |
CFPAC-1 | Liver metastasis | Well | G12V | C242R | WT | HD |
HPAF-2 | Ascites | Well | G12D | P151S | 20–25 Del | WT |
Hs766T | Lymph node metastasis | Non described | WT | WT | WT | HD |
MIA PaCa-2 | Primary tumor | Poor | G12C | R248W | HD | WT |
Panc-1 | Primary tumor | Poor | G12D | R273H | HD | WT |
Primer Names | Primer Sequence (5′- > 3′) |
---|---|
Fwd_qPCR_S100A2 | CACTACCTTCCACAAGTACT |
Rev_qPCR_S100A2 | GAAGTCATTGCACATGAC |
Fwd_qPCR_S100A4 | CAAGTACTCGGGCAAAGAGG |
Rev_qPCR_S100A4 | CTTCCTGGGCTGCTTATCTG |
Fwd_qPCR_S100A6 | GGACCGCTATAAGGCCAGTC |
Rev_qPCR_S100A6 | GGTCCAAGTCTTCCATCAGC |
Fwd_qPCR_S100A7 | ACGTGATGACAAGATTGACAAGC |
Rev_qPCR_S100A7 | GCGAGGTAATTTGTGCCCTTT |
Fwd_qPCR_S100A8 | TGATAAAGGGGAATTTCCATGCC |
Rev_qPCR_S100A8 | ACACTCGGTCTCTAGCAATTTCT |
Fwd_qPCR_S100A9 | GGTCATAGAACACATCATGGAGG |
Rev_qPCR_S100A9 | GGCCTGGCTTATGGTGGTG |
Fwd_qPCR_S100A10 | AAAGACCCTCTGGCTGTGG |
Rev_qPCR_S100A10 | AATCCTTCTATGGGGGAAGC |
Fwd_qPCR_S100A11 | CTGAGCGGTGCATCGAGTC |
Rev_qPCR_S100A11 | TGTGAAGGCAGCTAGTTCTGTA |
Fwd_qPCR_S100A12 | AGCATCTGGAGGGAATTGTCA |
Rev_qPCR_S100A12 | GCAATGGCTACCAGGGATATGAA |
Fwd_qPCR_S100A13 | ACCACCTTCTTCACCTTTGC |
Rev_qPCR_S100A13 | AGGCGGCTTTACTTCTTCCT |
Fwd_qPCR_S100A14 | CATGAGCCATCAGCTCCTCT |
Rev_qPCR_S100A14 | TTCTCTTCCAGGCCACAGTT |
Fwd_qPCR_S100A16 | ATGTCAGACTGCTACACGGAG |
Rev_qPCR_S100A16 | TTCTGGATGAGCTTATCCGCA |
Fwd_qPCR_S100P | ATGACGGAACTAGAGACAGCC |
Rev_qPCR_S100P | AGGAAGCCTGGTAGCTCCTT |
Rev_qPCR_HMGB | GGTGCATTGGGATCCTTGAA |
Fwd_qPCR_HMGB | GCTCAGAGAGGTGGAAGACCA |
Fwd_qPCR_human bactin | CACCATTGGCAATGAGCGGTTC |
Rev_qPCR_human-actin | AGGTCTTTGCGGATGTCCACGT |
Cell Line | A2 | A4 | A6 | A7 | A8 | A9 | A10 | A11 | A12 | A13 | A14 | A16 | P | HMGB1 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AsPC-1 | 17.35 +/− 3.53 | 1.86 +/− 0.26 | 11.04 +/− 1.75 | 15.9 +/− 0.53 | 13.27 +/− 0.99 | 12.25 +/− 1.00 | 3.34 +/− 0.90 | 7.07 +/− 1.37 | 9.26 +/− 0.21 | 8.33 +/− 0.11 | 11.33 +/− 0.72 | 6.25 +/− 1.02 | 8.89 +/− 0.61 | 7.33 +/− 0.62 |
BxPC-3 | 9.17 +/− 1.78 | 6.99 +/− 1.18 | 12.89 +/− 0.81 | 13.17 +/− 0.30 | 10.95 +/− 0.50 | 7.17 +/− 1.01 | 4.28 +/− 0.68 | 5.38 +/− 1.29 | 8.50 +/− 0.17 | 5.96 +/− 0.01 | 8.95 +/− 1.14 | 7.63 +/− 0.44 | 4.18 +/− 0.18 | 7.25 +/− 0.18 |
Capan-2 | 17.1 +/− 0.79 | 5.97 +/− 0.32 | 11.82 +/− 0.42 | 14.45 +/− 0.26 | 13.05 +/− 0.61 | 12.08 +/− 0.41 | 3.68 +/− 0.57 | 6.47 +/− 0.09 | 9.51 +/− 0.08 | 6.52 +/− 0.01 | 11.07 +/− 0.88 | 8.37 +/− 0.16 | 7.65 +/− 0.25 | 7.10 +/− 0.77 |
CFPAC-1 | 17.88 +/− 1.06 | 10.13 +/− 0.73 | 13.09 +/− 0.54 | 12.12 +/− 0.21 | 12.79 +/− 1.37 | 9.84 +/− 0.13 | 4.79 +/− 0.62 | 7.22 +/− 0.25 | 6.54 +/− 0.2 | 7.31 +/− 0.03 | 12.28 +/− 1.02 | 7.80 +/− 0.48 | 10.8 +/− 0.17 | 8.67 +/− 0.32 |
HPAF-2 | 17.59 +/− 0.77 | 7.84 +/− 0.45 | 12.25 +/− 0.43 | 15.16 +/− 0.22 | 10.85 +/− 1.63 | 10.42 +/− 1.14 | 3.36 +/− 0.19 | 6.59 +/− 0.55 | 10.38 +/− 0.13 | 6.71 +/− 0.08 | 10.29 +/− 1.36 | 9.16 +/− 0.20 | 3.88 +/− 0.63 | 7.33 +/− 1.23 |
Hs766T | 11.4 +/− 0.65 | 1.91 +/− 0.51 | 11.67 +/− 0.38 | 12.70 +/− 0.29 | 12.70 +/− 2.28 | 11.03 +/− 0.19 | 3.72 +/− 0.52 | 7.00 +/− 0.56 | 7.95 +/− 0.07 | 5.27 +/− 0.01 | 19.32 +/− 0.82 | 7.76 +/− 0.54 | 7.14 +/− 0.47 | 8.15 +/− 0.55 |
MIAPaCa-2 | 16.78 +/− 1.72 | 2.84 +/− 0.30 | 12.91 +/− 0.08 | 13.75 +/− 0.92 | 13.87 +/− 1.29 | 13.20 +/− 0.36 | 5.97 +/− 0.33 | 7.49 +/− 0.13 | 9.61 +/− 0.33 | 6.96 +/− 0.05 | 21.26 +/− 0.53 | 8.98 +/− 1.75 | 12.22 +/− 1.48 | 8.35 +/− 1.05 |
Panc-1 | 18.93 +/− 0.79 | 4.93 +/− 0.98 | 11.05 +/− 1.8 | 13.29 +/− 1.19 | 13.56 +/− 1.05 | 12.95 +/− 0.84 | 4.07 +/− 0.55 | 6.50 +/− 0.36 | 10.37 +/− 0.05 | 7.64 +/− 0.01 | 20.69 +/− 0.43 | 9.27 +/− 0.23 | 10.18 +/− 0.18 | 8.09 +/− 0.26 |
Mean Ct (Cancer cell lines) | 15.78 +/− 3.45 | 5.31 +/− 2.99 | 12.1 +/− 0.83 | 14.19 +/− 1.53 | 12.79 +/− 1.16 | 11.11 +/− 1.99 | 4.15 +/− 0.88 | 6.71 +/− 0.65 | 9.01 +/− 1.22 | 6.84 +/− 0.90 | 14.40 +/− 5.10 | 8.15 +/− 1.01 | 8.11 +/− 3.01 | 7.78 +/− 0.59 |
HPNE | 19.80 +/− 0.12 | 3.62 +/− 0.75 | 7.93 +/− 0.31 | 5.93 +/− 1.64 | ND | ND | 6.93 +/− 1.05 | 7.70 +/− 0.87 | 8.12 +/− 0.67 | 4.78 +/− 1.33 | ND | 10.12 +/− 0.33 | ND | 9.63 +/− 0.40 |
Pairs | A2 | A4 | A6 | A7 | A8 | A9 | A10 | A11 | A12 | A13 | A14 | A16 | S100P | HMGB1 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
A2 | 1 | 0.74 | 0.51 | 0.41 | 0.21 | 0.059 | 0.94 | 0.159 | 0.39 | 0.027 (0.82) | 0.7 | 0.44 | 0.17 | 0.64 |
A4 | 1 | 0.14 | 0.44 | 0.19 | 0.14 | 0.92 | 0.44 | 0.46 | 0.98 | 0.17 | 0.53 | 0.57 | 0.91 | |
A6 | 1 | 0.25 | 0.4 | 0.17 | 0.075 | 0.92 | 0.24 | 0.43 | 0.63 | 0.68 | 0.97 | 0.46 | ||
A7 | 1 | 0.88 | 0.43 | 0.22 | 0.94 | 0.07 | 0.26 | 0.38 | 0.64 | 0.55 | 0.051 | |||
A8 | 1 | 0.01 (0.82) | 0.33 | 0.07 | 0.94 | 0.27 | 0.064 | 0.98 | 0.0015 (0.91) | 0.22 | ||||
A9 | 1 | 0.76 | 0.068 | 0.22 | 0.24 | 0.084 | 0.53 | 0.071 | 0.6 | |||||
A10 | 1 | 0.4 | 0.6 | 0.98 | 0.22 | 0.45 | 0.088 | 0.081 | ||||||
A11 | 1 | 0.71 | 0.4 | 0.19 | 0.98 | 0.04 (0.73) | 0.097 | |||||||
A12 | 1 | 0.55 | 0.7 | 0.21 | 0.72 | 0.22 | ||||||||
A13 | 1 | 0.94 | 0.69 | 0.2 | 0.89 | |||||||||
A14 | 1 | 0.29 | 0.088 | 0.07 | ||||||||||
A16 | 1 | 0.88 | 0.61 | |||||||||||
S100P | 1 | 0.047 (0.71) | ||||||||||||
HMGB1 | 1 |
Pairs | A2 | A4 | A6 | A7 | A8 | A9 | A10 | A11 | A12 | A13 | A14 | A16 | P | HMGB1 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
A2 | 1 | 0.61 | 0.47 | 0.035 (0.48) | 0.76 | 0.82 | 0.92 | 0.017 (0.54) | 0.24 | 0.052 | 0.028 (0.50) | 0.005 (0.61) | 4.2 × 10−6 (0.85) | 0.12 |
A4 | 1 | 0.17 | 0.29 | 0.008 (0.66) | 6.5 × 10−5 (0.78) | 0.0006 (0.78) | 0.049 (0.46) | 0.003 (0.64) | 0.14 | 0.014 (0.55) | 0.006 (0.60) | 0.66 | 0.027 (0.50) | |
A6 | 1 | 0.18 | 0.32 | 0.78 | 0.30 | 0.032 (0.49) | 0.09 | 0.38 | 0.049 (0.45) | 0.13 | 0.10 | 0.62 | ||
A7 | 1 | 0.088 | 0.55 | 0.58 | 0.074 | 0.34 | 0.27 | 0.047 (0.47) | 0.18 | 0.012 (0.56) | 0.57 | |||
A8 | 1 | 0.004 (0.62) | 0.047 (0.46) | 0.29 | 0.16 | 0.35 | 0.12 | 0.35 | 0.50 | 0.12 | ||||
A9 | 1 | 0.0006 (0.51) | 0.83 | 0.0001 (0.76) | 0.53 | 0.61 | 0.29 | 0.38 | 3.3 × 10−5 (0.80) | |||||
A10 | 1 | 0.11 | 0.025 (0.51) | 0.31 | 0.21 | 0.036 (0.48) | 0.92 | 0.0007 (0.70) | ||||||
A11 | 1 | 0.99 | 0.005 (0.67) | 0.003 (0.65) | 0.7 × 10−5 (0.78) | 0.005 (0.62) | 0.22 | |||||||
A12 | 1 | 0.51 | 0.87 | 0.48 | 0.068 | 0.004 (0.62) | ||||||||
A13 | 1 | 0.054 | 0.06 | 0.087 | 0.74 | |||||||||
A14 | 1 | 0.01 (0.57) | 0.002 (0.66) | 0.72 | ||||||||||
A16 | 1 | 0.016 (0.54) | 0.78 | |||||||||||
S100P | 1 | 0.021 (0.52) | ||||||||||||
HMG--B1 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mandarino, A.; Thiyagarajan, S.; Martins, A.C.F.; Gomes, R.d.S.; Vetter, S.W.; Leclerc, E. S100s and HMGB1 Crosstalk in Pancreatic Cancer Tumors. Biomolecules 2023, 13, 1175. https://doi.org/10.3390/biom13081175
Mandarino A, Thiyagarajan S, Martins ACF, Gomes RdS, Vetter SW, Leclerc E. S100s and HMGB1 Crosstalk in Pancreatic Cancer Tumors. Biomolecules. 2023; 13(8):1175. https://doi.org/10.3390/biom13081175
Chicago/Turabian StyleMandarino, Angelo, Swetha Thiyagarajan, Allana C. F. Martins, Roberto da Silva Gomes, Stefan W. Vetter, and Estelle Leclerc. 2023. "S100s and HMGB1 Crosstalk in Pancreatic Cancer Tumors" Biomolecules 13, no. 8: 1175. https://doi.org/10.3390/biom13081175