1. Introduction
Notch signalling has many fundamental and diverse roles during both development and adult tissue homeostasis [
1]. Its core pathway is initiated by ligand-induced proteolytic cleavage that removes most of the extracellular domain (ECD), followed by intramembrane processing that releases the intracellular domain (ICD) [
2]. The latter becomes a component in a transcription factor complex involving the transcription factor Suppressor of Hairless and coactivator protein Mastermind. In this active ICD-bound form, the complex binds to Su(H) DNA binding motifs and regulates the expression of target genes such as the E(spl) complex [
3,
4]. Despite the relative simplicity of the core pathway mechanism, Notch is involved in a wide variety of cell fate decisions and different tissue patterning contexts, such as lateral inhibition, boundary formation and asymmetric cell fate decisions. In order for Notch signalling to be deployed in this wide range of different contexts, a number of regulatory systems have evolved to tune the amplitude and duration of Notch activity, according to different physiological inputs and developmental patterning requirements. For example, carbohydrate modifications of the ECD determine its affinities for different ligands and ICD modifications, such as phosphorylation and ubiquitination, which are associated with proteosomal degradation, intracellular trafficking, lysosomal degradation and ligand-independent activation mechanisms [
5,
6,
7]. Suppressor of deltex (
Su(dx)) is a HECT domain E3 ubiquitin ligase of the Nedd4 family whose origin in evolution predates the origin of core Notch pathway components [
8]. In yeast, for example, the yeast homologues RSP5 and Pub1 are involved in environmental sensing mechanisms that regulate the trafficking and activity of nutrient transporters [
9,
10]. In humans, Nedd4-2 has been linked to the trafficking of a Na channel involved in salt balance and blood pressure regulation [
11].
Su(dx) was originally linked to Notch by the positional cloning of gene mutations that dominantly suppress the mutant phenotypes of another ubiquitin ligase regulator of Notch called Deltex [
12], which itself acts to promote ligand-independent signal activation [
13,
14]. Other Nedd4 family members have been linked to Notch regulation across a number of metazoan species [
15,
16,
17,
18].
In a wild-type setting, mutations of
Su(dx) alone cause wing vein gap phenotypes symptomatic of gain-of-function Notch activity [
12]. The mutant phenotype is temperature-sensitive, with increased Notch activity observed at high temperatures. It was found that
Su(dx) acts with Deltex in a robustness module that stabilised the Notch signalling across the physiological temperature range of the fly through a balance of temperature-dependent fluxes affecting the relative contributions of ligand-dependent and independent signals [
14]. By acting in a network of trafficking routes, both
Su(dx) and Dx can act positively or negatively on Notch, sometimes acting antagonistically to each other, and sometimes acting together in the same direction. For example, double homozygous alleles of
dx and
Su(dx) produce extra leg joints, an outcome of increased Notch activity, but the mutants mutually suppress each other’s phenotypes in wing development above 18 °C, and combine to produce Notch loss of function phenotypes below 18 °C [
14].
Su(dx) is more effective at down-regulating Notch at higher temperatures due to the temperature-dependent activation of its ubiquitin ligase function. Other developmental functions of
Su(dx) are revealed by the genetic interactions between
Su(dx) alleles and Notch pathway mutants. For example,
Su(dx) mutants suppress their wing notching phenotypes due to the loss of one copy of the
Notch gene, or the homozygous
nd1 allele of
Notch [
12]. Existing mutant alleles of
Su(dx) are either uncharacterised molecularly, carry a small in-frame deletion in the HECT domain (
Su(dx)sp), or are truncation mutants which leave open the possibility of the expression of a part of the protein [
8,
12]. To examine the full requirement for
Su(dx), it is necessary to generate a defined null allele in which the complete open reading frame is deleted. In this study, we generated the first defined null allele,
Su(dx)JD, using imprecise p-element excision [
19]. We show that, in the wing and leg tissues, the null phenotype is essentially similar to the phenotypes reported for existing
Su(dx) alleles, i.e., it demonstrates similar temperature-dependent outcomes and genetic interactions with
dx and
Notch alleles. We also identifynew phenotypes arising in adult female oogenesis. Interestingly, the observed phenotypes in the ovary differ markedly between
Su(dx)JD and the other
Su(dx) alleles tested. The former display phenotypes characteristic of a Notch signal gain of function while combinations of the other alleles displayed reduced stalk length, incomplete separation of successive egg chambers and compound egg chambers, characteristic of a Notch loss of function. The null allele further reveals a novel role for
Su(dx) in regulating the cell extensions of follicle progenitor cells that cross the germarium between successive germline cysts, and whose misregulation results in split cysts. We also attribute this phenotype to a Notch gain of function. This work thus identifies new roles for
Su(dx) in the adult homeostasis of the ovary and highlights how the complexity of genotype/phenotype links requires the consideration of a range of mutant alleles.
2. Materials and Methods
2.1. Drosophila melanogaster Strains
Su(dx)JD was generated from the imprecise excision [
19,
20] of P-element insertion line P
{GSV1}Su(dx)EP-735 (Bloomington Stock Center, Bloomington, IN, USA) by crossing w[*]; wg[Sp-1]/CyO; and ry[506] Sb[1] P{ry[+t7.2] = Delta2-3}99B/TM6B, Tb[+] (Bloomington, IN, USA) and screening the excision lines lacking a
w+ marker by polymerase chain reaction (PCR) and sequencing using the flanking primers TCGAATGATAGGCGAAATGAGC and ACGAAACAATACACGCGTCG. The additional
Drosophila mutant lines used were
Su(dx)sp,
Su(dx)56 [
8,
12], the
Notch null allele
N55e11 (Bloomington, IN, USA), the
deltex null allele
dx152 [
21] and a genomic rescue construct
Su(dx)GR [
14]. For the signalling assays a Notch reporter element (NRE)-driven expression of GFP was utilised. For the ovaries: w1118; P{NRE-EGFP.S}5A #30728, w1118; P{NRE-EGFP.S}1 (Bloomington, IN, USA), and w[1118]; P{w[+mC] = 10XStat92E-GFP}2. For wing discs the N
sf-GFP reporter, which drives a nuclear localised PEST, destabilised GFP under the control of the NRE [
22]. To express NRNAi we used y[1] v[1]; P{y[+t7.7] v[+t1.8] = TRiP.HMS00001}attP2 pVALIUM20 Notch (Bloomington, IN, USA). UAS-Notch ICD was a gift from Spyros Artavanis-Tsakonas (Harvard Medical School, Boston, MA, USA). The endogenously EYFP-tagged endosomal marker fly lines used were TI{TI}Rab4[EYFP], TI{TI}Rab5[EYFP] and TI{TI}Rab7[EYFP] (Bloomington, IN, USA). The wild type was
y1,
w1 (Bloomington, IN, USA).
2.2. Generation of Mitotic Clones
To enable mitotic clone generation, Su(dx)sp and Su(dx)JD alleles were recombined with frt40A (Bloomington, IN, USA). For positive marked clones, frt40, Su(dx) lines were crossed to hsflp1, uas cd8gfp:tubgal80, frt40A; actgal4 (Bloomington). For the follicle stem cell turnover assay, using negatively marked Su(dx)sp, Su(dx)JD and WT control clones, the following stocks were generated: hsflp1/+;Su(dx)frt40A/P{Ubi-GFP(S65T)nls}2L P{neoFRT}40A and hsflp1/+;frt40A/P{Ubi-GFP(S65T)nls}2L P{neoFRT}40A, using component stocks obtained from Bloomington. One-day-old adult flies were heat-shocked for 60 min at 40 °C and then reared for minimum of 1 week at 25 °C to ensure that any clones generated in the dividing follicle cells were cleared from the germarium and egg chambers and that the clones scored, up to stage 5 egg chambers inclusive, originated in the stem cells.
For the examination of the stem cell processes in positively marked clones, the following genotypes were generated, using components obtained from Bloomington stock centre. For WT clones: P{ry[+t7.2] = hsFLP}1, y[1] w[*] P{w[+mC] = UAS-mCD8::GFP.L}Ptp4E[LL4]/+; P{w[+mC] = tubP-GAL80}LL10, P{ry[+t7.2] = neoFRT}40A/frt40A; actgal4/+. For Su(dx)JD clones: P{ry[+t7.2] = hsFLP}1, y[1] w[*] P{w[+mC] = UAS-mCD8::GFP.L}Ptp4E[LL4]/+; P{w[+mC] = tubP-GAL80}LL10, P{ry[+t7.2] = neoFRT}40A/Su(dx)nullfrt40A; P{w[+mC] = tubP-GAL4}LL7/+. For N null clones: P{w[+mC] = tubP-GAL80}LL1 w[*] P{ry[+t7.2] = neoFRT}19A/N55e11 frt19A; P{w[+mC] = Act5C-GAL4}25FO1, P{w[+mC] = UAS-GFP.U}2/+; MKRS, Hsflp. For Notch ICD expression clones: hsflp1, tubgal80, frt19A/yw frt; CD8-GFP, 109-30 gal4; his 2av mRFP/UAS NICD. For Notch RNAi clones: P{w[+mC] = tubP-GAL80}LL1 w[*] P{ry[+t7.2] = neoFRT}19A/yw, frt19A; P{w[+mC] = Act5C-GAL4}25FO1, P{w[+mC] = UAS-GFP.U}2/+;MKRS, Hsflp. Clones were induced 1 day after adult female eclosion and dissected 7 days after heat shock to ensure all clones observed originated from a follicle stem cell.
2.3. Antibodies and Immunostaining
The primary antibodies used were Goat anti-GFP (Abcam, Cambridge, UK, used 1:250), mouse anti-Fasciclin III (Isotype IgG2A, Developmental Studies Hybridoma Bank, University of Iowa, USA used 1:40), mouse anti-Discs Large (Isotype IgG1, Developmental Studies Hybridoma Bank, University of Iowa, used 1:40) and Rabbit anti-
Su(dx) [
23] (used 1/500). The latter was first preabsorbed against crushed adult
Su(dx)JD tissue for 1 week at 4 °C, in 0.1% tween to remove background staining. Secondary antibodies were obtained from Jackson ImmunoResearch Laboratories, Inc. Cambridge, UK, and used 1:500. Ovaries were dissected in ice-cold PBS and then fixed in 1 mL of 4% formaldehyde for 20 min at room temperature. After fixation, ovarioles were washed for 3 × 5 min in 0.1% PBS-Tw20. Ovarioles were then incubated with the primary antibodies in PBS-Tw20 at the given dilution, overnight at 4 °C. Antibodies were removed and washed for 6 × 5 min in 0.1% PBS-Tw20 at RT. Ovarioles were then incubated with the appropriate secondary antibody in PBS-Tw for 2 to 4 h at 4 °C in the dark. Tissue preparations were again washed for 6 × 5 min in 0.1%PBS-Tw20 at RT. If Actin was to be visualized then, following secondary antibody staining, ovarioles were incubated with 0.5% Alexa 647-Phalloidin (Thermo Fisher, Waltham, MA, USA) in PBT-Tw for 1 h. Preparations were washed for 5 × 5 min in 0.1%PBS-Tw20 before mounting in 4′.6-dianidino-2-phenylindole (DAPI) Vectashield mounting medium (Vector Laboratories). Ovarioles were examined using a Zeiss Axioskop fluorescence microscope (Carl Zeiss, Oberkochen, Germany). Images were captured using a cooled Hamamatsu digital camera and processed on an Apple Macintosh G4-500 computer using Improvision Openlab II Deconvolution and Adobe Photoshop CS5.1 software Where images were deconvoluted, serial Z sections of 0.5 µm were taken through a sample. Each layer was deconvoluted using the 3 nearest neighbours above and below the section of interest.
For the scoring of signalling levels in FSCs using GFP reporter constructs, mean fluoresence intensity was calculated for a 25 pixel diameter region in a Z-section through the plane of the FSC. The background level, from a non-stained region in the same tissue, was subtracted and the result normalised to background-subtracted GFP levels of wild-type flies. For the scoring of signalling levels in wing imaginal discs, a similar procedure was used on separate regions encompassing the dorsal/ventral boundary.
2.4. Adult Wing/Leg Mounting
Adult wings were dissected using fine forceps and mounted on slides in Gary’s magic mounting media (Canada balsam thinned with methysalicitate, Sigma-Aldrich, St. Louis, MO, USA).
2.5. Whole Mount In Situ Hybridisation
Ovaries were dissected, including sheath removal, in PBS; fixed for 20 min in 4% formaldehyde; rinsed 3 × 5 min in 0.1% PBTw (tween 20); washed 2 × 5minin ethanol, in ethanol:xylene 1:1 for 60 min, in ethanol for 10 min; and then transferred to ice-cold methanol overnight at −20 °C. Ovaries were then washed 2 × 5 min and then 3 × 10 min in 0.1% PBTw, washed in 50% hybridization washing buffer (HWB; 50% formamide, 5 × SSC, 0.1% Tween-20, adjusted to pH4/5 with 1 M citric acid) and then hybridisation buffer (Hs: HWB with 0.1 mg/mL tRNA, 50 μg/mL heparin) for 10 min at RT. Ovarioles were prehybridized in HS for 1 hr at 70 °C. Ovaries were hybridized overnight at 70 °C with a digoxigenin-labelled (Boehringer Mannheim, Mannheim, Germany) 2b1a [
8] antisense probe and then washed for 2 × 20 min in HS at 70 °C, for 20 min in 50% HS in PBT at 70 °C and for 3 × 20 min in PBT at RT on a rotating wheel. Ovaries were then incubated with an alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche, Basel, Switzerland) in 0.1%PBTw (1:1000) at RT for 90 min, washed for 2 × 1 min and then 3 × 20 min with 0.1% PBTw, and then washed with NMTT 2 × 5 min each (NMTT; 0.1M NaCl, 50 mM MgCl
2, 0.1M Tris pH 9.5, 0.1% Tween-20). The antibody conjugate was detected using the substrate NBT/BCIP (Boehringer Mannheim, Mannhein, Germany), and the reaction stopped by a 3 × 20 min wash with 20mM EDTA, and ovaries were mounted in 90% glycerol.
2.6. Scoring of Ovariole Phenotypes
To assess egg chamber production, ovarioles were stained with DAPI and the numbers of egg chambers were scored between stage 2 (the earliest stage to exit the germarium) and stage 8. Stalk length was assessed as the mean numbers of cells present in the stalks, anterior and posterior to stage four egg chambers. To define the number of mature cysts present in the germarium, ovarioles were stained with anti-FasIII and the numbers of cysts surrounded by FasIII-positive cells were counted. Split cyst egg chambers were scored by counting the number of germ line nurses and oocytes per egg chamber. To score for delays in egg chamber separation, the stage of the most recently pinched off egg chamber to exit the posterior of the germarium was assessed according to published criteria [
24].
4. Discussion
Here we report the first defined null allele for
Su(dx). We found that
Su(dx)JD behaves similarly to other alleles during wing development, exhibiting temperature-dependent Notch gain of function phenotypes that suppress vein cell fates, acting as a dominant suppressor of
dx mutant wing phenotypes, and combining with a
dx null allele to introduce ectopic leg joints, as previously described for other
Su(dx) alleles [
14].
Su(dx)JD also acted as an enhancer of
dx mutant wing vein phenotypes when flies raised at 14 °C, a role reversal previously reported for other
Su(dx) mutant alleles at this low temperature of culture [
14]. We further report novel functions of
Su(dx) during oogenesis, as it regulates cyst packaging into egg chambers and cyst integrity. In this tissue, however, the null allele deviated in its phenotypes from those of other
Su(dx) alleles. While
Su(dx)JD exhibited the Notch gain of function outcomes of increased stalk lengths and split cysts, the
Su(dx)sp and
Su(dx)56 phenotypes reflected their reduced Notch function through short stalks and compound egg chambers. Direct examinations of the Notch signalling levels in vivo, using Notch-specific GFP reporter constructs, were in agreement with the loss or gain of Notch function phenotypic outcomes seen in both the wing and ovary.
Our observations likely reflect the complexity of the regulatory networks that tune Notch signalling levels up and down through ligand-dependent and independent means, and this context dependency appears likely to extend to human NOTCH regulation. The overall outcome of a particular mutation will therefore depend on the normal balance of these contributions, which differs in different developmental contexts.
Su(dx)sp carries a seven amino acid in-frame mutation in its catalytic HECT domain [
8]. Immunostaining showed this allele was expressed and hence it likely retains partial function. The
sp allele has been characterised as an antimorph as it can compete with WT
Su(dx) for interactions with Notch. It is probable, therefore, that in the ovary environment, the
Su(dx)sp protein is still active to sequester Notch from ligand-dependent signalling and this is not compensated for by any increase in ligand-independent activity. Indeed, combinations of
Su(dx)sp and
dx mutations did not restore Notch signal reporter expression, in contrast to the situation in the wing, where the same mutant combination restored WT wing development. In the latter case,
Su(dx)sp can cause increased Notch activity via a ligand-independent, Dx-dependent mechanism. In contrast, the null allele produces a gain of function in both wing and ovary environments. We found that, in wing development, a
dx mutation suppresses the gain of function phenotype of the
Su(dx)JD null allele, indicating increased activity through a Dx-dependent route. In the ovary, however, combining
Su(dx)JD and
dx mutants enhances the increased Notch signalling activity, suggesting that increased ligand-dependent signalling is the dominant contributor to the Notch gain of function phenotype of this combination in the ovary. All
Su(dx) allele phenotypes were rescued by the introduction of a genomic rescue construct and so the discrepancies between the different allele phenotypes in the ovary cannot be attributed to any second site mutations. A limitation of this study is that we do not understand at the molecular level why the
Su(dx)sp phenotypic outcomes are different in these different tissue contexts. Most likely, subtle differences in the trafficking pathways in which Notch is routed are responsible for these heterogenous outcomes and further detailed studies of Notch localisation are needed.
Our study further uncovered a new role for
Su(dx) in regulating Notch signalling levels in order to properly package germline cysts into the egg chambers. Cyst packaging is a precisely controlled process [
28,
32]. After four germ line cell divisions, as it reaches the region 2a/b border, the 16-cell cyst is comprised of 15 nurse cells and a single oocyte, interconnected through cytoplasmic bridges called ring canals. Anterior to region 2a, the cyst is enwrapped by somatic cells called escort cells. As the cyst moves posteriorly, these escort cells are displaced and the cyst becomes surrounded by FasIII-expressing follicle cells. The latter are derived from somatic stem cells located at the 2a/2b border, recognisable from their oval or triangular morphology and lack of FasIII expression [
28,
33,
34]. The number of stem cells present has been a matter of debate in the literature [
33,
35], but recent work indicates the number is most likely between 2 and 4 active stem cells located either side of the germarium, which is argued to be bilaterally symmetrical [
27]. FSC daughter cells can either produce a single cross-migrating cell that moves across the anterior side of the cyst and proliferates to contribute to follicle cells in the anterior half of the egg chamber, or a posterior migrating cell which moves posteriorly and begins enwrapping the posterior face [
28,
36]. Alternating between these two outcomes is thought to result in each egg chamber being enwrapped by the progeny of two bilaterally located stem cells. Notch signalling has previously been shown to be active in FSCs and acts to promote cross-migration [
28]. Using positively labelled clones, we observed that marked stem cells produce a long filamentous process that crosses over the width of the germarium, likely as a precursor to the production of a cross-migrating cell following FSC division. To gain insight into the origin of the split-cyst phenotype, we generated FSC mitotic clones homozygous for the
Su(dx)JD mutant. Germaria were observed with the disorganised extension of cellular processes, which varied in number and direction, arising from stem cells, stem cell progeny and cross-migrating cells. Cytoplasmic processes were observed that appeared to be in the process of invading between cysts. When we expressed the constitutive active Notch intracellular domain in FSC-derived mitotic clones, we also observed a splitting of cysts and similar misregulation of cyst enwrapment. Interestingly, we found that Notch RNAi expression and the stem cell clones of a Notch null mutant also generate split-cyst phenotypes. In this case, this likely results from a loss of cross-migrating cells and incomplete cytoplasmic extensions. Thus, the precise tuning of Notch activity is essential to properly maintain this critical step in egg chamber production.
Notch signalling has previously been shown to be necessary to regulate egg chamber separation subsequent to this initial enwrapment by follicle cells [
30,
37]. When egg chambers emerge from the posterior of the germaria they are each separated by around six linearly located stalk cells which adjoin the egg chambers through the polar cells that mark the posterior and anterior of each egg chamber. Notch promotes stalk formation and a loss of Notch signalling results in egg chambers that lack an intervening stalk and are separated only by an epithelial bilayer or are compound egg chambers in which multiple cysts are present. We observe similar phenotypes in the ovaries of
Su(dx)sp flies, consistent with their reduced Notch activity. The outcome of this allele results in decreased egg chamber production, reflected in their shorter ovarioles. We also observed a backup of 16-cell germline cysts in the germarium, arrested at the FasIII-enwrapped stage, consistent with an insufficient follicle cell supply. We investigated whether decreased follicle cell production might be reflected by decreased stem cell survival and found that
Su(dx)sp, but not
Su(dx)JD, stem cell mutant clones were lost at a higher frequency compared to wild-type clones. Notch signalling is not thought to be required for stem cell survival. Although previous work found that Mastermind, a key transcriptional coactivator in the Notch pathway, is required for stem cell survival, this was discovered to be due to a non-canonical function of Mastermind downstream of Hedgehog signalling [
29]. Previous work, using overexpressed WT and dominant negative
Su(dx), has shown that it can target Patched for lysosomal degradation [
38]. Since Patched is a negative regulator of Hedgehog, it is possible that
Su(dx)sp mutants act in the stem cells through Ptc accumulation to down-regulate Hedgehog. The overall phenotype of
Su(dx)sp in the ovary may therefore result from the summation of outcomes across these different pathways.
In conclusion, our results highlight the new roles of Su(dx) in oogenesis and illustrate its importance in the precise tuning of Notch activity in different developmental contexts. The core Notch pathway is essentially a simple mechanism, lacking amplification steps or kinase cascades. To be deployed in different developmental contexts Notch requires tunings in its amplitude, duration and spatial pattern in different ways. Su(dx) represents one of a multiplicity of regulatory processes that have been uncovered that provide the necessary nuances of Notch regulation that are needed for the proper functioning of such a pleitropic signalling mechanism within the many tissues and cell types in which it functions. Defining a null allele of Su(dx) is a step forward in uncovering the full functions of Su(dx) in development and tissue homeostasis, but our conclusions may yet be limited by genetic redundancy. It is important, therefore, to address how the functions of Su(dx) overlap with other Nedd4 family members in the fly genome to fully understand the complete physiological range of its activity.