Next Article in Journal
Mitofilin–mtDNA Axis Mediates Chronic Lead Exposure-Induced Synaptic Plasticity Impairment of Hippocampal and Cognitive Deficits
Previous Article in Journal
Modulation of the Neuro–Cancer Connection by Metabolites of Gut Microbiota
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan

1
Guangdong Provincial Key Laboratory of Medical Immunology and Molecular Diagnostics, Institute of Aging Research, Guangdong Medical University, Dongguan 523808, China
2
School of Medical Technology, Guangdong Medical University, Dongguan 523808, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Biomolecules 2025, 15(2), 271; https://doi.org/10.3390/biom15020271
Submission received: 16 November 2024 / Revised: 8 February 2025 / Accepted: 10 February 2025 / Published: 12 February 2025
(This article belongs to the Special Issue The Endoplasmic Reticulum Stress in Yeast and Fungal Cells)

Abstract

:
Yeast TIM8 was initially identified as a homolog of human TIMM8A/DDP1, which is associated with human deafness–dystonia syndrome. Tim8p is located in the mitochondrial intermembrane space and forms a hetero-oligomeric complex with Tim13p to facilitate protein transport through the TIM22 translocation system. Previous research has indicated that TIM8 is not essential for yeast survival but does affect the import of Tim23p in the absence of the Tim8-Tim13 complex. Previous research on TIM8 has focused mainly on its involvement in the mitochondrial protein transport pathway, and the precise biological function of TIM8 remains incompletely understood. In this study, we provide the first report that yeast TIM8 is associated with the endoplasmic reticulum (ER) stress response and chronological senescence. We found that deletion of TIM8 leads to both oxidative stress and ER stress in yeast cells while increasing resistance to the ER stress inducer tunicamycin (TM), which is accompanied by an enhanced basic unfolded protein response (UPR). More importantly, TIM8 deficiency can lead to a shortened chronological lifespan (CLS) but does not affect the replicative lifespan (RLS). Moreover, we found that improving the antioxidant capacity further increased TM resistance in the tim8Δ strain. Importantly, we provide evidence that the knockdown of TIMM8A in ARPE-19 human retinal pigment epithelium cells can also induce ER stress, suggesting the potential function of the TIM8 gene in ER stress is conserved from budding yeast to higher eukaryotes. In summary, these results suggest novel roles for TIM8 in maintaining ER homeostasis and CLS maintenance.

Graphical Abstract

1. Introduction

The yeast gene TIM8 encodes the mitochondrial intermembrane space protein Tim8, which is a component of the TIM22 complex. The TIM22 complex is a translocase on the mitochondrial inner membrane that mediates the import of target membrane proteins into the mitochondrial inner membrane [1].
The TIM22 translocation system includes five small Tim proteins, Tim8p, Tim9p, Tim10p, Tim12p, and Tim13p, and three membrane components, Tim18p, Tim22p, and Tim54p [1]. Tim8p binds to Tim13 to form a heterooligomeric complex and can be cross-linked to the mitochondrial inner membrane protein Tim23p [1,2]. Previous studies have reported that the Tim8-13 complex is not necessary for yeast survival but plays an important role in Tim23p import when the mitochondrial membrane potential is low [2]. TIM8 and TIM13 double mutants do not grow on yeast peptone dextrose (YPD) media at relatively low temperatures [1,3], and deletion of TIM8 is synthetically lethal when in combination with temperature-sensitive TIM10 mutation [4]. In Trypanosoma brucei, TbTim8/13, which is homologous to human Tim8 and Tim13, links to TbTim17 and is essential for optimal parasite proliferation [5].
TIM8 has a human homolog gene termed TIMM8A. Previous studies have shown that mutation of the TIMM8A gene causes a neurodegenerative disorder called Mohr–Tranebjaerg syndrome (MTS), and the loss of TIMM8A can lead to abnormal mitochondrial morphology, mitochondrial dysfunction, and oxidative stress in cells [6]. However, there are no reports on whether TIM8 or TIMM8A is involved in ER stress and the regulation of cellular senescence.
The ER is the main organelle involved in protein synthesis, folding, and processing in eukaryotic cells. Dysfunction of protein folding in the ER usually leads to the accumulation of misfolded and unfolded proteins within this organelle; this state is known as ER stress. ER stress can activate the UPR, which results in the upregulation of a cluster of genes involved in protein folding, quality control, and secretion to alleviate the accumulation of misfolded proteins in the ER [7,8]. Disturbances in protein homeostasis in the ER regularly accompany other types of cellular stress, such as oxidative stress, inflammation, and mitochondrial stress [9]. Moreover, studies have reported that ER stress is associated with cellular senescence and is involved in many age-associated neurodegenerative diseases [10,11].
In this study, we provide the first evidence that yeast TIM8 may be involved in the ER stress response. TIM8 deficiency in yeast leads to an enhancement in the basic UPR and increased resistance to the ER stress inducer TM, as well as a decreased CLS. Moreover, we show that the overexpression of SOD2, which is associated with decreased oxidative stress, in a TIM8-deficient strain could further improve yeast resistance to TM. More importantly, knockdown of the yeast TIM8 human homolog TIMM8A in ARPE-19 human retinal pigment epithelium (RPE) cells also induces ER stress, suggesting the potential ER stress response function of the TIM8 gene is conserved.

2. Materials and Methods

2.1. Strain Construction

All the Saccharomyces cerevisiae (S. cerevisiae) strains used in this study originated from the wild-type (WT) BY4742 strain and are listed in Table 1.
To construct the deletion strain tim8Δ, we generated a TIM8 gene-specific disruption cassette containing the selectable marker URA3 via polymerase chain reaction (PCR). The URA3 marker was fused to the TIM8 gene open reading frame (ORF) via homologous recombination [12]. The gene-specific disruption cassette was generated via PCR with the primers5′-AAGAGGTAAAAAGGAAAACAAATTTACAAACAACAAAGAAGATTGTACTGAGAGTGCAC-3′ and 5′-AAAGAGAATAATGACTCGGAGAGATAAATCGGTTTCATACTGTGCGGTATTTCACACCG-3′, and the purified PCR products were subsequently transformed into WT cells using lithium acetate (LiAc). The strain was subsequently grown in SD-URA media, and positive colonies were confirmed via PCR.
To construct the SOD2 overexpression strains, we used the pAUR123 vector containing the ADH1 promoter. The ORF of SOD2 was amplified from the genome of BY4742 using the primers 5′-TATGGTACCATGTTCGCGAAAACAGCAGC-3′ with KpnI restriction sites and 5′-TATGAGCTCTCAGATCTTGCCAGCATCGA-3′ with SacI restriction sites and then cloned and inserted into pAUR123 to create the plasmid pAUR123SOD2. The recombinant plasmid was then transformed into the deficient mutant to generate the yeast strain tim8ΔSOD2 with SOD2 overexpression. The transformants were selected on YPD media plates supplemented with 0.2 g/mL aureobasidin A (AbA), and positive clones were verified via PCR.
The method used to make the tim8ΔCTT1 OX and tim8ΔHAC1 OX yeast strains was the same as the method used to make the tim8ΔSOD2 yeast strain. The plasmid pAUR123CCT1 was constructed previously in our laboratory [13]. The CDS of the spliced HAC1 was amplified from the cDNA of a TM-treated WT yeast strain using the primers 5′-CGGGGTACCATGGAAATGACTGATTTTGAACT-3′ with KpnI restriction sites and 5′-CTAGTCTAGA TCATGAAGTGATGAAGAAATCA-3′ with XbaI restriction sites.

2.2. Spot Assay

Yeast strains were cultivated in YPD media and grown at 30 °C overnight. The second day, the strains were added to sterile water, and the absorbance of the suspension at 600 nm (OD600) was adjusted to 0.1, after which 5 µL of 5-fold serially diluted samples of the cell suspension were spotted onto YPD plates with or without TM. All the plates were incubated at 30 °C for two days, after which yeast growth was observed and photographed [14,15].

2.3. Growth Curve Assay

Growth curves were constructed from analysis with a Bioscreen C apparatus (Growth Curves, Helsinki, Finland). Briefly, a single isolated colony was inoculated into a cell culture tube filled with 3 mL of YPD medium and incubated overnight at 30 °C with continuous shaking at 150 rpm. The next day, the cultures were diluted with YPD medium to reach a final OD600 of 0.1, and the diluted yeast suspension was transferred to the wells of a Bioscreen plate. The inoculated plate was subsequently placed in the Bioscreen C instrument at 30 °C, and the OD600 was automatically measured every 2 h for more than 48 h [16,17]. Doubling time (Dt) and specific growth rate (µ) of the yeast cells were calculated as previously described [18]. Experiments were conducted at 30 °C, with three replicates per treatment.

2.4. Reactive Oxygen Species (ROS) Assay

Total intracellular ROS production was detected via dichlorodihydrofluorescein diacetate (DCFH-DA) staining. In brief, yeast cells were grown in YPD media with or without TM stress. Afterward, the cells were harvested, washed, resuspended in sterile phosphate-buffered saline (PBS) twice, and stained with 5 μM DCFH-DA at 30 °C in the dark for 1 h. The stained cells were detected via flow cytometry (BD FACSCanto II, USA) with excitation at 488 nm and emission at 525 nm [19,20]. For the detection of ROS in ARPE-19 cells, the cells were washed with PBS and incubated with 5 μM DCFH-DA at 37 °C for 30 min. Then, the cells were washed in PBS and trypsinized, and the fluorescence intensity in the yeast cells was measured via flow cytometry. The quantified data presented are from at least three independent experiments, and significant differences were determined via t tests. A p value less than 0.05 was considered to indicate statistical significance.

2.5. RLS Assay

This experiment was performed as previously described. Briefly, yeasts were aligned and cultured on YPD plates at 30 °C until buds were obtained. When the small buds completely grew, their mother cells were removed with a glass needle under an optical microscope and discarded, and the remaining daughter cells were named virgin mother cells. After virgin mother cell replication, the number of daughter cells was removed and recorded [21,22]. Statistical significance was calculated via the Wilcoxon rank sum test, and p < 0.05 was considered to indicate statistical significance.

2.6. CLS Assay

First, isolated yeast colonies were inoculated in 3 mL of synthetic complete liquid medium (SDC) and cultured overnight at 30 °C with shaking at 170 rpm. The next day, the cells were diluted to an OD600 of 0.1 in fresh SDC medium to a final volume of 15 mL, after which the cells were maintained at 30 °C with shaking for three days. After three days, the cultures were in the stationary phase, and proper dilutions of each sample were spotted onto YPD plates and incubated at 30 °C for 2 days, after which the colony-forming units (CFUs) were calculated. Spotting was repeated every three days until the end of the experiment, and the number of CFUs recorded on the first day was considered 100% survival [23,24].

2.7. Real-Time Polymerase Chain Reaction (RT-PCR)

Yeast strains were cultured in YPD medium to the exponential growth phase, and total RNA was collected for RT-PCR. Total RNA was extracted according to the RNA extraction kit standard protocol (Omega BioTek, USA). RT-PCR was performed with a LightCycler 480 instrument (Roche, USA) via the standard SYBR Green method. The number of transcripts for each target gene was normalized to that of the housekeeping gene PRP8 [25,26]. The genes and sequences of primers used are listed in Table 2 and Table 3. The assay was repeated at least three times. Student’s t test was used for analysis, and a p value less than 0.05 was considered to indicate statistical significance.

2.8. Yeast HAC1 mRNA Splicing Pattern Assay

Total RNA and cDNA were obtained as described from the RT-PCR assay, and the cDNA was used as a template for detecting HAC1 mRNA splicing via PCR. The primers with the HAC1 intron used for PCR were 5′-CCGTAGACAACAACAATTTG-3′ and 5′-CATGAAGTGATGAAGAAATC-3′. The PCR products were resolved via electrophoresis on a 1.5% agarose gel, and the sizes of the amplified products, 433 bp and 181 bp, were observed. The image was inverted for clarity. The results were analyzed using ImageJ V1.8.0 software (NIH, Bethesda, MD, USA) [27].

2.9. Mitochondrial Function Assay

2,3,5-Triphenyltetrazolium (TTC) was used to determine yeast mitochondrial function. Briefly, yeast cells were spread on YPD agar media and cultured for 48 h in a 30 °C incubator until colonies formed, after which the plates were completely overlaid with TTC agar (1.5% low-melting point agarose and 0.1% TTC). The numbers of red and white colonies were recorded and analyzed, and the results are given as the ratio of white colonies [28].

2.10. Cell Culture

ARPE19 human retinal epithelial cells were obtained from iCell Bioscience, Inc. (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle’s medium/nutrient mixture F-12 (DMEM/F12) (Gibco, USA) supplemented with 10% fetal calf serum in a 5% CO2/95% air (v/v) incubator at 37 °C.

2.11. Small Interfering RNA (siRNA) Transfection

TIMM8A knockdown was conducted via transfection of specific siRNAs using Lipofectamine RNAiMAX (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. siRNAs (genOFFTM st-h-TIMM8A_001 and genOFFTM st-h-TIMM8A_002) targeting human TIMM8A mRNA were designed and synthesized by Ribobio (Guangzhou, China). For each transfection, 50 nM siRNA was used.

2.12. Western Blot Analysis

Proteins from whole cells were extracted using RIPA lysis buffer. The total protein extracted was analyzed via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The membrane was blocked with 3% bovine serum albumin (BSA) in Tris-buffered saline containing Tween 20 (TBST; 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% Tween 20) before incubation with the primary antibody at 4 °C overnight followed by incubation with an alkaline phosphatase (AP)-labeled secondary antibody. The bands were visualized with nitro blue tetrazolium/4-bromo-5-chloro-indolyl phosphate (NBT/BCIP) reagent (Thermo Fisher Scientific, USA). The antibodies used were as follows: anti-GAPDH (1:1000, sc-166545, Santa Cruz Biotechnology, USA), anti-XBP1s (1:1000, 40435T, Cell Signaling Technology, USA), anti-GFRP78 (1:1000, 11587-1-AP, Proteintech, China), and anti-TIMM8A (1:1000, 1 11179-1-AP, Proteintech, China).

2.13. Measurement of the Intracellular Calcium Content

The intracellular calcium content was measured with Fluo-3 AM and flow cytometry [29,30]. In brief, the cells were incubated in HBSS containing 3 μM Fluo-3 for 30 min at 37 °C in the dark. The cells were then washed in PBS and trypsinized, and the fluorescence intensity was measured via flow cytometry with excitation at 506 nm and emission at 526 nm. The quantified data from at least three independent experiments are presented, and significant differences between the results were determined via t tests. A p value less than 0.05 was considered to indicate statistical significance.

3. Results

3.1. TIM8 Deficiency Increases Yeast Resistance to the ER Stress Inducer TM

To investigate the potential involvement of TIM8 in the yeast ER stress response, we first constructed a tim8Δ mutant strain derived from the WT BY4742 strain. Both the tim8Δ and WT strains were spotted onto YPD media with or without the ER stress inducer TM/DTT. The results revealed that the growth ability of tim8Δ cells was clearly suppressed compared with that of the WT cells under unstressed conditions, whereas surprisingly, the growth ability of tim8Δ cells clearly increased compared with that of the WT yeast cells in the presence of 1.5 μM TM (Figure 1A). This result was confirmed by the colony-forming unit assay (Figure 1B) and growth curve assay results (tim8Δ cells grow faster and enter exponential growth phase earlier than WT yeast cells under the TM stressed condition) (Figure 1C). Moreover, the doubling time assay (Figure 1D) and specific growth rate assay (Figure 1E) also showed that the growth ability of tim8Δ cells clearly increased compared with that of the WT yeast cells in the presence of TM. Interestingly, tim8Δ cells exhibited the same growth inhibition (compared with WT cells) in the presence of the other ER stress inducer, DTT.

3.2. TIM8 Deficiency Leads to Both Oxidative Stress and ER Stress in Yeast Cells

Previous studies have reported that the depletion of human TIMM8A (homolog of yeast TIM8) in HEK293 and SH-SY5Y cells results in cellular oxidative stress and sensitivity to oxidative stress-mediated apoptosis [6]. We thus wondered whether the deletion of TIM8 in yeast has the same effect. First, we found that the intracellular ROS level was increased in tim8Δ cells (Figure 2A). We further measured the mRNA expression levels of several oxidative stress-related genes, and the results revealed that the expression of most of the genes investigated was reduced in the tim8Δ strain (Figure 2B).
Furthermore, we examined the growth ability of tim8Δ and WT cells on plates containing different oxidants, such as tert-butyl hydroperoxide (TBHP), cumene hydroperoxide (CHP), and H2O2. The growth ability of the tim8Δ strain was enhanced in YPD medium supplemented with TBHP, whereas under CHP and H2O2 stress, the growth inhibition (compared with that of the WT strain) of the tim8Δ strain was the same as that under unstressed conditions (File S4).
Oxidative stress and ER stress are closely interconnected biological processes [31]. Therefore, we next analyzed the splicing pattern of HAC1 mRNA, a marker of ER stress in yeast cells [32]. Both RT-PCR and semiquantitative PCR revealed that spliced HAC1 mRNA levels increased in tim8Δ cells under unstressed conditions compared with those in WT yeast cells, suggesting that TIM8 deletion induced ER stress under normal growth conditions. In contrast, the spliced HAC1 mRNA levels were lower in tim8Δ cells than in WT yeast cells after treatment with TM (Figure 2C,D), indicating that the ER stress was not as severe in tim8Δ cells as in the WT yeast cells.
In addition, we detected the transcription patterns of the canonical UPR target genes in the tim8Δ strain in the presence and absence of TM stress. Compared with those of the WT strain, the transcription levels of LHS1, INO1, and PDI1 were increased under unstressed conditions, while the transcription levels of ERO1, EUG1, FKB2, and KAR2 were not different (Figure 2E). However, the expression of almost all UPR genes decreased in the tim8Δ strain, except for two, INO1 and PDI1, under TM-stressed conditions.
Moreover, we found that ROS production was lower in tim8Δ cells than in WT yeast cells under TM stress (Figure 2F), and interestingly, the expression levels of most of the investigated antioxidant genes were also lower in tim8Δ cells under TM stress (Figure 2G).

3.3. TIM8 Deficiency Leads to a Shortened CLS

Oxidative stress and ER stress are closely related to the aging process in yeast, so we examined the lifespan of the tim8Δ strain. Aging in yeast is assayed primarily by measuring RLS (defined as the number of total daughter cells produced by an individual mother cell) or CLS (defined as the length of time a population of yeast cells remains viable in the stationary phase) [33]. We found that the mean RLS of the TIM8 deletion strain was 24 generations, while the mean RLS of the WT strain was 23 generations, and the difference was not significant (Figure 3A). On the other hand, the CLS assay revealed that the maximum lifespan of the tim8Δ strain was less than 9 days, whereas the maximum lifespan of the WT strain was more than 30 days (Figure 3B).
We also quantified the CLS for both tim8Δ and WT strains in the presence of TM (Figure 3C). The results showed that, when stressed with TM, the CLS of the tim8Δ cells was increased (similar to the stressed WT strain cells) compared with that of the unstressed tim8Δ cells, while the CLS of the WT cells was decreased compared with that of the unstressed WT cells.

3.4. TIM8 Deficiency Impaired the Mitochondrial Respiration Capacity of Yeast

Previous studies have shown that the depletion of the homolog of yeast TIM8 in mammalian cells leads to mitochondrial dysfunction [6]. Thus, we also investigated yeast mitochondrial respiration capacity via TTC overlay, and the results revealed that the percentage of respiration-deficient petite tim8Δ cells increased compared with the WT, which suggested that tim8Δ cells had an impaired mitochondrial respiration capacity (Figure 4).

3.5. SOD2 Overexpression Enhances TM Resistance in the tim8Δ Strain

In the previous section, we showed that the expression level of the mitochondrial Mn superoxide dismutase-encoding gene SOD2 was decreased under both unstressed and TM-stressed conditions; most importantly, the expression level of the SOD2 gene was most significantly reduced under unstressed conditions (Figure 2B). Therefore, we overexpressed the SOD2 gene in the tim8Δ strain (Figure 5A) and found that the ROS levels were lower than those in the WT strain in both the presence and absence of TM stress (Figure 5B).
The spot assay and colony-forming unit assay revealed that SOD2 overexpression enhanced the growth ability of the tim8Δ strain on agar plates containing TM (the improvement was not obvious under normal conditions). We also overexpressed another antioxidant gene in tim8Δ cells, CTT1 (File S3), which encodes a peroxisomal catalase that can break down H2O2, and the effect was similar to that of SOD2 overexpression (Figure 5C,D).
RT-PCR revealed that the expression level of spliced HAC1 in tim8Δ SOD2OX cells was noticeably decreased upon TM treatment but was not significantly different from that of the WT strain under unstressed conditions (Figure 5E); moreover, the UPR gene expression profile was in accordance with the expression pattern of spliced HAC1 (Figure 5F).
The lifespan assay revealed that the CLS of the tim8ΔSOD2OX strain did not differ from that of the TIM8 deletion strain (Figure 5G). Additionally, there was no significant difference in the TTC assay results between the tim8ΔSOD2 OX and tim8Δ strains (Figure 5H).
Moreover, we overexpressed spliced HAC1 in tim8Δ to test whether upregulating the ER stress response could restore CLS in tim8Δ (File S3). The results showed that the tim8Δ HAC1OX cells exhibited a CLS similar to that of tim8Δ cells (Figure 5I). In addition, the TTC assay results also showed there was no difference between the tim8Δ HAC1 OX strain and the tim8Δ strains (Figure 5J).

3.6. Knockdown of TIMM8A Induces ER Stress in ARPE-19 Cells

We next knocked down the TIMM8A gene in ARPE-19 human RPE cells via RNA interference and found that the protein levels of GRP78 and spliced XBP1 (XBP1s), two ER stress markers, notably increased, suggesting that knockdown of TIMM8A, the homologous human gene of yeast TIM8, also induces ER stress. Moreover, we also found that the knockdown of TIMM8A in ARPE-19 cells can increase both the ROS and intracellular calcium levels (Figure 6).

4. Discussion

4.1. TIM8 Deficiency Induces ER Stress Response

The yeast gene TIM8 was initially identified as a homolog of human TIMM8A/DDP1, and mutation of the latter gene is associated with human deafness–dystonia syndrome [4,34]. Previous studies of TIM8 have mainly focused on its involvement in the TIM22 protein import pathway, which mediates the import of membrane proteins into the mitochondrial inner membrane [1], but the precise biological function of TIM8 remains largely unknown.
In this study, we first demonstrated that TIM8 deficiency could induce the ER stress response. We found that the growth ability of tim8Δ cells was clearly suppressed compared with that of WT cells under normal physiological conditions. Upon applying TM stress, the growth ability of tim8Δ cells clearly increased compared with that of the WT yeast cells (Figure 1A–E).
ER stress can activate the UPR, resulting in the upregulation of a cluster of genes involved in protein folding, quality control, and secretion to restore ER homeostasis [7,8]. Unlike the three UPR pathways that exist in mammalian cells, only one UPR pathway, which is mediated by IRE1, has been reported in budding yeast [35]. The accumulation of misfolded and unfolded proteins in the ER leads to activation of the ER stress sensor Ire1p, which excises the translation inhibitory intron of HAC1 mRNA. This induces synthesis of the transcription factor Hac1p and the subsequent Hac1p-mediated upregulation of a cluster of genes involved in protein folding, quality control, and secretion to ultimately reduce the accumulation of misfolded and unfolded proteins in the ER [36].
We showed that the levels of UPR activity marker, the spliced HAC1 mRNA, were increased in tim8Δ cells under unstressed conditions, and accordingly, three UPR target genes were notably upregulated in tim8Δ cells (Figure 2C–E). These results indicate that basic UPR activity and ER stress are increased in tim8Δ cells. It has been suggested that moderate ER stress is beneficial for cell growth but that persistent or chronic ER stress can trigger cell death [11,37]. We speculated that the increase in ER stress might explain the growth inhibition of tim8Δ cells under normal conditions. On the other hand, we found that the intracellular ROS level increased, and the expression levels of most of the investigated antioxidant genes were reduced in tim8Δ cells under normal conditions, suggesting the occurrence of oxidative stress (Figure 2A,B). This would be another reason for tim8Δ cell growth inhibition under unstressed conditions.
However, why does TIM8 deficiency induce ER stress? Research has suggested that there is crosstalk between factors involved in ER stress and oxidative stress. On the one hand, oxidative stress can disrupt redox homeostasis in the ER, leading to improper disulfide bond formation and the accumulation of misfolded proteins; on the other hand, misfolded proteins trigger the excessive accumulation of intracellular ROS [38,39,40]. Given these phenomena, we presume that increased oxidative stress might be the cause of the observed ER stress in tim8Δ cells. Notably, ER stress and oxidative stress can reciprocally induce each other and may be coregulated via a positive feedback loop. Given that both oxidative stress and ER stress were increased in tim8Δ cells under normal conditions, we cannot speculate which type of stress is the first stress to occur in these cells.
More importantly, we should note that the increased basal ER stress in tim8Δ mutants might result from primary stress (oxidative stress or other stresses) due to the absence of TIM8 rather than an exacerbated stress because of the downregulation of the ER stress response pathway.
The second question is why was the growth ability of tim8Δ cells clearly increased and better than that of WT cells under TM-stressed conditions? We evaluated the UPR activity in tim8Δ cells and WT cells under TM-stressed conditions and found that the spliced HAC1 mRNA levels were decreased in tim8Δ cells compared with those in WT yeast cells. Accordingly, the expression of almost all of the investigated UPR genes decreased in the tim8Δ strain (Figure 2C–E). Interestingly, the ROS level was also lower in tim8Δ cells than in WT yeast cells under TM stress (Figure 2F). Taken together, these observations implied that there was mild ER stress in tim8Δ cells compared with WT yeast cells in the presence of TM.
TM is a common compound that can induce ER stress by inhibiting the protein N-glycosylation pathway [41], which leads to the accumulation of unfolded or misfolded proteins in the ER and thereby causes ER stress. We also found the tim8Δ cells exhibited the same growth inhibition (compared with the WT cells) when another ER stress inducer, DTT, was applied, which disrupted the formation of disulfide bonds and led to the accumulation of unfolded proteins in the ER [42]. Thus, we speculate that the activity of the protein N-glycosylation pathway might be enhanced in tim8Δ cells.
Interestingly, two large-scale analyses to identify yeast mutants that are either sensitive or resistant to particular compounds have reported that TIM13 (another member of the Tim8-Tim13 complex) deficiency cells (tim13Δ) were resistant to 0.6 μM TM [43] and sensitive to the genotoxic reagent methyl methanesulfonate (MMS, could result in DNA damage and induce a ROS stress response in budding yeast) [44,45]. These reports suggested that TIM13 may also play a role in ER stress and oxidative stress.

4.2. tim8Δ Cells Exhibit a Shortened CLS

An increasing number of studies have revealed that both ER stress and oxidative stress are associated with the cellular senescence process [11,27,46]. According to the free radical theory, oxidative stress caused by excessive intracellular ROS is a major contributor to aging in yeast and mammalian cells [47]. For example, deletion of the PEP4 gene in yeast led to oxidative stress and increased sensitivity to hydrogen peroxide, as well as a shortened CLS [48]. With respect to ER stress, moderate ER stress triggers an adaptive UPR that is beneficial for cellular survival, whereas persistent or acute ER stress and the UPR accelerate the apoptotic process and lead to cell death. For example, GAS1-deficient yeast cells presented increased intracellular UPR activity and shortened RLS [15].
Interestingly, we found that the CLS of tim8Δ cells was significantly lower than that of WT strain cells, whereas the RLS of tim8Δ cells was similar to that of WT strain cells (Figure 3A,B).
Many previous studies have shown that both environmental and genetic factors can affect replicative aging and chronological aging and have suggested that some molecular factors are correlated and likely play a causal role in determining both CLS and RLS, whereas some causes of aging appear to be private for each type of yeast aging [48,49]. For example, deletion of yeast SIR2 could increase rDNA instability and dramatically shorten the RLS but does not affect the CLS in standard media [33].
We do not know why TIM8 deficiency affects only the CLS. It has been reported that mitochondrial function, more specifically respiration, severely affects the CLS of yeast cells [50,51]. Specifically, the CLS of budding yeast is very sensitive to medium acidification. Under standard glucose culture conditions (medium containing 2% glucose), cells initially ferment the glucose to ethanol. After glucose depletion, the ethanol is metabolized, leading to the production of acetic acid, which is toxic to yeast cells and induces chronological senescence. During this process, yeast cells with abnormal mitochondrial function may produce more metabolic acid and further reduce the CLS [52,53]. Based on these findings, the observed abnormal mitochondrial respiration capacity may be another explanation for the decreased CLS of tim8Δ cells.
Moreover, in the previous section, the growth assay suggested a protective effect of tim8Δ against TM. However, it is unclear whether the observed growth rate improvement was due to reduced cell death or faster division. Given this, we further assessed whether TIM8 deficiency also protected against TM in a CLS context. The results showed that, when stressed with TM, the CLS of the tim8Δ cells was increased (similar to the stressed WT strain cells) compared with that of the unstressed tim8Δ cells, while the CLS of the WT cells was decreased compared with that of the unstressed WT cells. These observations imply that TIM8 deficiency could also protect against TM in the stationary phase, although not as well as in the growth phase.

4.3. Improving the Antioxidant Capacity Further Enhances TM Resistance in the tim8Δ Strain

In the previous section, we showed that the expression levels of most of the investigated antioxidant genes decreased in tim8Δ cells under both unstressed and TM-stressed conditions and speculated that the increases in ROS levels and oxidative stress could be a possible reason for the observed ER stress in tim8Δ cells. Previous studies have reported that increasing the antioxidant capacity of cells can alleviate ER stress [54,55]. Therefore, we wondered whether improving the antioxidant capacity could relieve ER stress in tim8Δ cells.
Considering that the mitochondrial superoxide dismutase-encoding gene, SOD2, expression level was the most significantly reduced under unstressed conditions, we used the high copy number vector pAUR123, which has the ADH1 promoter, to overexpress SOD2 in tim8Δ cells. RT-qPCR confirmed SOD2 overexpression in these tim8Δ cells, and an ROS assay verified that the intracellular ROS level was indeed lower in tim8Δ SOD2OX cells (Figure 5B) than in tim8Δ cells under both unstressed and TM-stressed conditions, suggesting that oxidative stress was lower in tim8Δ cells.
The spot assay and colony-forming unit assay revealed that SOD2 overexpression obviously enhanced the growth ability of the tim8Δ strain on agar plates containing TM (the improvement was not obvious under normal conditions) (Figure 5C,D), and the UPR activity in tim8Δ SOD2 OX cells was lower than that in tim8Δ cells under the TM-stressed condition (Figure 5E).
We also overexpressed another antioxidant gene in tim8Δ cells, CTT1, which encodes a peroxisomal catalase that can break down H2O2 [56], and the effect was similar to that of SOD2 overexpression (Figure 5C,D). These observations suggested that improving the antioxidant capacity indeed further enhanced TM resistance in the tim8Δ strain, although it did not obviously enhance the growth ability of or reduce ER stress in tim8Δ cells under normal conditions.
Notably, although overexpression of SOD2 decreased the ROS levels in the tim8Δ strain under both unstressed and TM-stressed conditions and enhanced TM resistance, the shortened CLS and impaired mitochondrial respiration capacity of tim8Δ cells were not reversed by SOD2 overexpression (Figure 5G,H). We speculate that this might be due to severe oxidative stress and ER stress in tim8Δ cells, which cannot be reversed through improvements in antioxidant capacity caused by the overexpression of one or two antioxidant genes.
Moreover, since TIM8 deficiency could lead to ER stress in yeast cells under the unstressed condition, we also wondered whether further upregulating the ER stress response could restore CLS in tim8Δ cells. We overexpressed the spliced HAC1 in tim8Δ cells. The results showed that the tim8ΔHAC1OX cells exhibited a CLS similar to that of tim8Δ cells. In addition, the TTC assay results also showed there was no difference between the tim8ΔHAC1 OX strain and the tim8Δ strains. We speculated these observations might be due to the existence of basic UPR activity in tim8Δ cells, and a more enhanced ER stress response will not further enhance the CLS of tim8Δ cells.

4.4. Knockdown of TIMM8A Induces ER Stress

Next, we asked whether the TIM8 gene function is conserved among its homologs in mammalian cells. Unlike budding yeast, the UPR is initiated in mammals by three distinct classes of ER transmembrane proteins: IRE1, PERK, and ATF6 [8,57].
We used the human RPE cell line ARPE-19 as a model to test our hypothesis. RPE cells are a good model for exploring oxidative stress and ER stress, the latter of which is an important feature of age-related macular degeneration (AMD), the most common cause of irreversible vision loss, especially in elderly individuals [58].
We used RNA interference to silence the TIMM8A gene and found that the protein levels of GRP78 and XBP1s, two widely used markers of ER stress in the literature [59,60], clearly increased. High GRP78 protein levels are dependent on the activation of the IRE1, PERK, and ATF6 UPR pathways. The XBP1s protein (homologous to yeast HAC1) is specifically induced by activated IRE-1 under ER stress and upregulates chaperones involved in the restoration of protein folding or the degradation of unfolded proteins in the ER.
Moreover, we found that the intracellular ROS levels were increased in TIMM8A-knockdown cells, similar to budding yeast. Intracellular Ca2+ plays a crucial role in stress responses, and the ER is the main organelle that stores Ca2+. Abnormal intracellular Ca2+ levels are associated with ER stress [61], and disrupted ER Ca2+ homeostasis causes the accumulation of misfolded proteins in the ER [62,63]. Therefore, we detected the intracellular Ca2+ level and found that it increased in TIMM8A-knockdown cells.
As mentioned above, these observations indicate that TIMM8A knockdown could induce ER stress similar to that induced by the deletion of TIM8 in yeast cells, suggesting that the function of the TIM8 gene is conserved in the ER stress response.

5. Conclusions

In summary, the results of the present study revealed that yeast TIM8 deficiency could induce the intracellular ER stress response and chronological senescence, which were accompanied by an increase in the basic UPR. Additionally, we provide evidence that TIMM8A knockdown in human RPE cells can also induce ER stress, highlighting that the potential function of the TIM8 gene in ER stress is conserved from budding yeast to higher eukaryotes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom15020271/s1, File S1: Raw data of GEL images (and repeats) used in the manuscript. File S2: Raw data of Western blot images (and repeats) used in the manuscript. File S3: RT-qPCR results of the CTT1 expression levels (in tim8ΔCTT1OX cells) and HAC1 expression levels (in tim8ΔHAC1OX cells).File S4: Spot assay results. Original images of Figure 2D and Figure 6A can be found in Supplementary Materials.

Author Contributions

Methodology, D.T. and W.Z.; formal analysis, D.T. and W.G.; visualization, W.G.; investigation, validation, D.T., W.G., X.Y. and Z.L.; resources, W.Z.; writing—original draft preparation D.T.; writing—review and editing, W.Z.; project administration, funding acquisition, supervision, X.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the China National Natural Science Foundation (Grant Nos. 31701050, 31670897, 81971329), Natural Science Foundation of Guangdong Province (2024A1515010605, 2024A1515012922), and Discipline Construction Project of Guangdong Medical University (4SG24007G). Funds for PHD researchers of Guangdong Medical University in 2023 (GDMUB2023005).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data used to support the findings of this study are included within the article.

Acknowledgments

The authors are grateful to Matt Kaeberlein and Brian K. Kennedy for their technical assistance.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hasson, S.A.; Damoiseaux, R.; Glavin, J.D.; Dabir, D.V.; Walker, S.S.; Koehler, C.M. Substrate specificity of the TIM22 mitochondrial import pathway revealed with small molecule inhibitor of protein translocation. Proc. Natl. Acad. Sci. USA 2010, 107, 9578–9583. [Google Scholar] [CrossRef] [PubMed]
  2. Hofmann, S.; Rothbauer, U.; Muhlenbein, N.; Neupert, W.; Gerbitz, K.D.; Brunner, M.; Bauer, M.F. The C66W mutation in the deafness dystonia peptide 1 (DDP1) affects the formation of functional DDP1.TIM13 complexes in the mitochondrial intermembrane space. J. Biol. Chem. 2002, 277, 23287–23293. [Google Scholar] [CrossRef] [PubMed]
  3. Paschen, S.A.; Rothbauer, U.; Kaldi, K.; Bauer, M.F.; Neupert, W.; Brunner, M. The role of the TIM8-13 complex in the import of Tim23 into mitochondria. EMBO J. 2000, 19, 6392–6400. [Google Scholar] [CrossRef] [PubMed]
  4. Koehler, C.M.; Leuenberger, D.; Merchant, S.; Renold, A.; Junne, T.; Schatz, G. Human deafness dystonia syndrome is a mitochondrial disease. Proc. Natl. Acad. Sci. USA 1999, 96, 2141–2146. [Google Scholar] [CrossRef]
  5. Smith, J.T., Jr.; Singha, U.K.; Misra, S.; Chaudhuri, M. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei. mSphere 2018, 3, e00204-18. [Google Scholar] [CrossRef]
  6. Kang, Y.; Anderson, A.J.; Jackson, T.D.; Palmer, C.S.; De Souza, D.P.; Fujihara, K.M.; Stait, T.; Frazier, A.E.; Clemons, N.J.; Tull, D.; et al. Function of hTim8a in complex IV assembly in neuronal cells provides insight into pathomechanism underlying Mohr-Tranebjaerg syndrome. Elife 2019, 8, e48828. [Google Scholar] [CrossRef]
  7. Hetz, C.; Papa, F.R. The Unfolded Protein Response and Cell Fate Control. Mol. Cell 2018, 69, 169–181. [Google Scholar] [CrossRef]
  8. Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef]
  9. Lee, J.H.; Lee, J. Endoplasmic Reticulum (ER) Stress and Its Role in Pancreatic beta-Cell Dysfunction and Senescence in Type 2 Diabetes. Int. J. Mol. Sci. 2022, 23, 4843. [Google Scholar] [CrossRef]
  10. Brown, M.K.; Naidoo, N. The endoplasmic reticulum stress response in aging and age-related diseases. Front. Physiol. 2012, 3, 263. [Google Scholar] [CrossRef]
  11. Hemagirri, M.; Chen, Y.; Gopinath, S.C.B.; Sahreen, S.; Adnan, M.; Sasidharan, S. Crosstalk between protein misfolding and endoplasmic reticulum stress during ageing and their role in age-related disorders. Biochimie 2024, 221, 159–181. [Google Scholar] [CrossRef] [PubMed]
  12. Baudin, A.; Ozier-Kalogeropoulos, O.; Denouel, A.; Lacroute, F.; Cullin, C. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 1993, 21, 3329–3330. [Google Scholar] [CrossRef] [PubMed]
  13. Zhao, W.; Zheng, H.Z.; Zhou, T.; Hong, X.S.; Cui, H.J.; Jiang, Z.W.; Chen, H.J.; Zhou, Z.J.; Liu, X.G. CTT1 overexpression increases the replicative lifespan of MMS-sensitive Saccharomyces cerevisiae deficient in KSP1. Mech. Ageing Dev. 2017, 164, 27. [Google Scholar] [CrossRef] [PubMed]
  14. Tesniere, C.; Pradal, M.; Legras, J.L. Sterol uptake analysis in Saccharomyces and non-Saccharomyces wine yeast species. FEMS Yeast Res. 2021, 21, foab020. [Google Scholar] [CrossRef]
  15. Cui, H.J.; Cui, X.G.; Jing, X.; Yuan, Y.; Chen, Y.Q.; Sun, Y.X.; Zhao, W.; Liu, X.G. GAS1 Deficient Enhances UPR Activity in Saccharomyces cerevisiae. Biomed. Res. Int. 2019, 2019, 1238581. [Google Scholar] [CrossRef]
  16. Olsen, B.; Murakami, C.J.; Kaeberlein, M. YODA: Software to facilitate high-throughput analysis of chronological life span, growth rate, and survival in budding yeast. BMC Bioinformatics 2010, 11. [Google Scholar] [CrossRef]
  17. Arroyo Lopez, F.N.; Quintana, M.C.; Fernandez, A.G. Modelling of the growth-no growth interface of Issatchenkia occidentalis, an olive spoiling yeast, as a function of the culture media, NaCl, citric and sorbic acid concentrations: Study of its inactivation in the no growth region. Int. J. Food Microbiol. 2007, 117, 150–159. [Google Scholar] [CrossRef]
  18. Olivares-Marin, I.K.; González-Hernández, J.C.; Regalado-Gonzalez, C.; Madrigal-Perez, L.A. Saccharomyces cerevisiae exponential growth kinetics in batch culture to analyze respiratory and fermentative metabolism. J. Vis. Exp. 2018, 139, 58192. [Google Scholar] [CrossRef]
  19. Wu, Y.; Wu, M.; Wang, Y.; Chen, Y.; Gao, J.; Ying, C. ERG11 couples oxidative stress adaptation, hyphal elongation and virulence in Candida albicans. FEMS Yeast Res. 2018, 18, foy057. [Google Scholar] [CrossRef]
  20. Lin, Y.; Kotakeyama, Y.; Li, J.; Pan, Y.; Matsuura, A.; Ohya, Y.; Yoshida, M.; Xiang, L.; Qi, J. Cucurbitacin B Exerts Antiaging Effects in Yeast by Regulating Autophagy and Oxidative Stress. Oxid. Med. Cell Longev. 2019, 2019, 4517091. [Google Scholar] [CrossRef]
  21. Garcia, E.J.; de Jonge, J.J.; Liao, P.C.; Stivison, E.; Sing, C.N.; Higuchi-Sanabria, R.; Boldogh, I.R.; Pon, L.A. Reciprocal interactions between mtDNA and lifespan control in budding yeast. Mol. Biol. Cell 2019, 30, 2943–2952. [Google Scholar] [CrossRef] [PubMed]
  22. Fukuda, A.P.M.; Camandona, V.L.; Francisco, K.J.M.; Rios-Anjos, R.M.; Lucio do Lago, C.; Ferreira-Junior, J.R. Simulated microgravity accelerates aging in Saccharomyces cerevisiae. Life Sci. Space Res. 2021, 28, 32–40. [Google Scholar] [CrossRef] [PubMed]
  23. Aluru, M.; McKinney, T.; Venero, A.L.; Choudhury, S.; Torres, M. Mitogen-activated protein kinases, Fus3 and Kss1, regulate chronological lifespan in yeast. Aging 2017, 9, 2587–2609. [Google Scholar] [CrossRef] [PubMed]
  24. Lim, S.; Ahn, H.; Duan, R.; Liu, Y.; Ryu, H.Y.; Ahn, S.H. The Spt7 subunit of the SAGA complex is required for the regulation of lifespan in both dividing and nondividing yeast cells. Mech. Ageing Dev. 2021, 196, 111480. [Google Scholar] [CrossRef]
  25. Bui, L.N.; Iosue, C.L.; Wykoff, D.D. Tup1 Paralog CgTUP11 Is a Stronger Repressor of Transcription than CgTUP1 in Candida glabrata. mSphere 2022, 7, e0076521. [Google Scholar] [CrossRef]
  26. Zhan, C.; Yang, Y.; Zhang, Z.; Li, X.; Liu, X.; Bai, Z. Transcription factor Mxr1 promotes the expression of Aox1 by repressing glycerol transporter 1 in Pichia pastoris. FEMS Yeast Res. 2017, 17, fox015. [Google Scholar] [CrossRef]
  27. Labunskyy, V.M.; Gerashchenko, M.V.; Delaney, J.R.; Kaya, A.; Kennedy, B.K.; Kaeberlein, M.; Gladyshev, V.N. Lifespan extension conferred by endoplasmic reticulum secretory pathway deficiency requires induction of the unfolded protein response. PLoS Genet. 2014, 10, e1004019. [Google Scholar] [CrossRef]
  28. Cocheme, H.M.; Murphy, M.P. Complex I is the major site of mitochondrial superoxide production by paraquat. J. Biol. Chem. 2008, 283, 1786–1798. [Google Scholar] [CrossRef]
  29. Yang, Y.Q.; Sun, R.F.; Ge, P.; Li, W.X.; Zhang, X.; Zhang, J.; Ye, L.; Zhang, N.; Wang, S.Y.; Lv, M.Q.; et al. GRPR down-regulation inhibits spermatogenesis through Ca2+ mediated by PLCbeta/IP3R signaling pathway in long-term formaldehyde-exposed rats. Food Chem. Toxicol. 2023, 179, 113998. [Google Scholar] [CrossRef]
  30. Selvaraj, B.; Le, T.T.; Kim, D.W.; Jung, B.H.; Yoo, K.Y.; Ahn, H.R.; Thuong, P.T.; Tran, T.T.T.; Pae, A.N.; Jung, S.H.; et al. Neuroprotective Effects of Ethanol Extract of Polyscias fruticosa (EEPF) against Glutamate-Mediated Neuronal Toxicity in HT22 Cells. Int. J. Mol. Sci. 2023, 24, 3969. [Google Scholar] [CrossRef]
  31. Zhang, Z.; Zhang, L.; Zhou, L.; Lei, Y.; Zhang, Y.; Huang, C. Redox signaling and unfolded protein response coordinate cell fate decisions under ER stress. Redox Biol. 2019, 25, 101047. [Google Scholar] [CrossRef] [PubMed]
  32. Kawahara, T.; Yanagi, H.; Yura, T.; Mori, K. Endoplasmic reticulum stress-induced mRNA splicing permits synthesis of transcription factor Hac1p/Ern4p that activates the unfolded protein response. Mol. Biol. Cell 1997, 8, 1845–1862. [Google Scholar] [CrossRef] [PubMed]
  33. Delaney, J.R.; Murakami, C.; Chou, A.; Carr, D.; Schleit, J.; Sutphin, G.L.; An, E.H.; Castanza, A.S.; Fletcher, M.; Goswami, S.; et al. Dietary restriction and mitochondrial function link replicative and chronological aging in Saccharomyces cerevisiae. Exp. Gerontol. 2013, 48, 1006–1013. [Google Scholar] [CrossRef] [PubMed]
  34. Jin, H.; May, M.; Tranebjaerg, L.; Kendall, E.; Fontan, G.; Jackson, J.; Subramony, S.H.; Arena, F.; Lubs, H.; Smith, S.; et al. A novel X-linked gene, DDP, shows mutations in families with deafness (DFN-1), dystonia, mental deficiency and blindness. Nat. Genet. 1996, 14, 177–180. [Google Scholar] [CrossRef]
  35. Tam, A.B.; Koong, A.C.; Niwa, M. Ire1 has distinct catalytic mechanisms for XBP1/HAC1 splicing and RIDD. Cell Rep. 2014, 9, 850–858. [Google Scholar] [CrossRef]
  36. Wu, H.; Ng, B.S.; Thibault, G. Endoplasmic reticulum stress response in yeast and humans. Biosci. Rep. 2014, 34, e00118. [Google Scholar] [CrossRef]
  37. Salminen, A.; Kaarniranta, K. ER stress and hormetic regulation of the aging process. Ageing Res. Rev. 2010, 9, 211–217. [Google Scholar] [CrossRef]
  38. Bhandary, B.; Marahatta, A.; Kim, H.R.; Chae, H.J. An involvement of oxidative stress in endoplasmic reticulum stress and its associated diseases. Int. J. Mol. Sci. 2012, 14, 434–456. [Google Scholar] [CrossRef]
  39. Wang, J.; Yang, X.; Zhang, J. Bridges between mitochondrial oxidative stress, ER stress and mTOR signaling in pancreatic beta cells. Cell Signal 2016, 28, 1099–1104. [Google Scholar] [CrossRef]
  40. Roohi, T.F.; Faizan, S.; Parray, Z.A.; Baig, M.; Mehdi, S.; Kinattingal, N.; Krishna, K.L. Beyond Glucose: The Dual Assault of Oxidative and ER Stress in Diabetic Disorders. High. Blood Press. Cardiovasc. Prev. 2023, 30, 513–531. [Google Scholar] [CrossRef]
  41. Mizuno, T.; Nakamura, M.; Irie, K. Induction of Ptp2 and Cmp2 protein phosphatases is crucial for the adaptive response to ER stress in Saccharomyces cerevisiae. Sci. Rep. 2018, 8, 13078. [Google Scholar] [CrossRef] [PubMed]
  42. Osman, A.; El-Gamal, H.; Pasha, M.; Zeidan, A.; Korashy, H.M.; Abdelsalam, S.S.; Hasan, M.; Benameur, T.; Agouni, A. Endoplasmic Reticulum (ER) Stress-Generated Extracellular Vesicles (Microparticles) Self-Perpetuate ER Stress and Mediate Endothelial Cell Dysfunction Independently of Cell Survival. Front. Cardiovasc. Med. 2020, 7, 584791. [Google Scholar] [CrossRef] [PubMed]
  43. Kapitzky, L.; Beltrao, P.; Berens, T.J.; Gassner, N.; Zhou, C.; Wüster, A.; Wu, J.; Babu, M.M.; Elledge, S.J.; Toczyski, D. Cross-species chemogenomic profiling reveals evolutionarily conserved drug mode of action. Mol. Syst. Biol. 2010, 6, 451. [Google Scholar] [CrossRef] [PubMed]
  44. Hanway, D.; Chin, J.K.; Xia, G.; Oshiro, G.; Winzeler, E.A.; Romesberg, F.E. Previously uncharacterized genes in the UV-and MMS-induced DNA damage response in yeast. Proc. Natl. Acad. Sci. USA 2002, 99, 10605–10610. [Google Scholar] [CrossRef] [PubMed]
  45. Rowe, L.A.; Degtyareva, N.; Doetsch, P.W. DNA damage-induced reactive oxygen species (ROS) stress response in Saccharomyces cerevisiae. Free Radic. Biol. Med. 2008, 45, 1167–1177. [Google Scholar] [CrossRef]
  46. Davalli, P.; Mitic, T.; Caporali, A.; Lauriola, A.; D’Arca, D. ROS, Cell Senescence, and Novel Molecular Mechanisms in Aging and Age-Related Diseases. Oxid. Med. Cell Longev. 2016, 2016, 3565127. [Google Scholar] [CrossRef]
  47. Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef]
  48. Alugoju, P.; Janardhanshetty, S.S.; Subaramanian, S.; Periyasamy, L.; Dyavaiah, M. Quercetin Protects Yeast Saccharomyces cerevisiae pep4 Mutant from Oxidative and Apoptotic Stress and Extends Chronological Lifespan. Curr. Microbiol. 2018, 75, 519–530. [Google Scholar] [CrossRef]
  49. Polymenis, M.; Kennedy, B.K. Chronological and replicative lifespan in yeast: Do they meet in the middle? Cell Cycle 2012, 11, 3531–3532. [Google Scholar] [CrossRef]
  50. Aerts, A.M.; Zabrocki, P.; Govaert, G.; Mathys, J.; Carmona-Gutierrez, D.; Madeo, F.; Winderickx, J.; Cammue, B.P.A.; Thevissen, K. Mitochondrial dysfunction leads to reduced chronological lifespan and increased apoptosis in yeast. FEBS Lett. 2009, 583, 113–117. [Google Scholar] [CrossRef]
  51. Ocampo, A.; Liu, J.; Schroeder, E.A.; Shadel, G.S.; Barrientos, A. Mitochondrial Respiratory Thresholds Regulate Yeast Chronological Life Span and its Extension by Caloric Restriction. Cell Metab. 2012, 16, 55–67. [Google Scholar] [CrossRef] [PubMed]
  52. Burtner, C.R.; Murakami, C.J.; Kennedy, B.K.; Kaeberlein, M. A molecular mechanism of chronological aging in yeast. Cell Cycle 2009, 8, 1256–1270. [Google Scholar] [CrossRef] [PubMed]
  53. Kaeberlein, M. Lessons on longevity from budding yeast. Nature 2013, 464, 513–519. [Google Scholar] [CrossRef] [PubMed]
  54. Gast, V.; Campbell, K.; Picazo, C.; Engqvist, M.; Siewers, V.; Molin, M. The Yeast eIF2 Kinase Gcn2 Facilitates H2O2-Mediated Feedback Inhibition of Both Protein Synthesis and Endoplasmic Reticulum Oxidative Folding during Recombinant Protein Production. Appl. Environ. Microbiol. 2021, 87, e0030121. [Google Scholar] [CrossRef]
  55. An, M.Y.; Lee, S.R.; Hwang, H.J.; Yoon, J.G.; Lee, H.J.; Cho, J.A. Antioxidant and Anti-Inflammatory Effects of Korean Black Ginseng Extract through ER Stress Pathway. Antioxidants 2021, 10, 62. [Google Scholar] [CrossRef]
  56. Franca, M.B.; Panek, A.D.; Eleutherio, E.C. The role of cytoplasmic catalase in dehydration tolerance of Saccharomyces cerevisiae. Cell Stress. Chaperones 2005, 10, 167–170. [Google Scholar] [CrossRef]
  57. Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef]
  58. Afsar, E.; Kirimlioglu, E.; Ceker, T.; Yilmaz, C.; Demir, N.; Aslan, M. Effect of ER stress on sphingolipid levels and apoptotic pathways in retinal pigment epithelial cells. Redox Biol. 2020, 30, 101430. [Google Scholar] [CrossRef]
  59. Ogata, S.; Kameda, K.; Kono, T.; Ozeki, Y.; Hashimoto, H.; Tominaga, S.; Nakanishi, K. Expressions of ATF6, XBP1, and GRP78 in normal tissue, atypical adenomatous hyperplasia, and adenocarcinoma of the lung. Hum. Pathol. 2019, 83, 22–28. [Google Scholar] [CrossRef]
  60. Aghaei, M.; Nasimian, A.; Rahmati, M.; Kawalec, P.; Machaj, F.; Rosik, J.; Bhushan, B.; Bathaie, S.Z.; Azarpira, N.; Los, M.J.; et al. The Role of BiP and the IRE1alpha-XBP1 Axis in Rhabdomyosarcoma Pathology. Cancers 2021, 13, 4927. [Google Scholar] [CrossRef]
  61. Makio, T.; Chen, J.; Simmen, T. ER stress as a sentinel mechanism for ER Ca2+ homeostasis. Cell Calcium 2024, 124, 102961. [Google Scholar] [CrossRef] [PubMed]
  62. Krebs, J.; Agellon, L.B.; Michalak, M. Ca2+ homeostasis and endoplasmic reticulum (ER) stress: An integrated view of calcium signaling. Biochem. Biophys. Res. Commun. 2015, 460, 114–121. [Google Scholar] [CrossRef] [PubMed]
  63. Groenendyk, J.; Agellon, L.B.; Michalak, M. Calcium signaling and endoplasmic reticulum stress. Int. Rev. Cell Mol. Biol. 2021, 363, 1–20. [Google Scholar] [CrossRef] [PubMed]
Figure 1. tim8Δ cells displayed increased resistance to TM. (A) The WT and tim8Δ strains were serially diluted and spotted on YPD plates containing 1.5 μM TM or 4 mM DTT. The plates were incubated at 30 °C until colonies formed, after which photographs were taken. (B) Colony-forming unit assays. (C) Growth curves of the WT and tim8Δ strains with or without TM/DTT were constructed after automatic measurements were taken every 2 h for more than 48 h. (D) Doubling time (Dt) and (E) specific growth rate (µ) assays of the yeast cells, data are presented as the mean ± standard deviation, statistical analyses were performed using a two-way ANOVA test. * indicates p < 0.05; ** indicates p < 0.01.
Figure 1. tim8Δ cells displayed increased resistance to TM. (A) The WT and tim8Δ strains were serially diluted and spotted on YPD plates containing 1.5 μM TM or 4 mM DTT. The plates were incubated at 30 °C until colonies formed, after which photographs were taken. (B) Colony-forming unit assays. (C) Growth curves of the WT and tim8Δ strains with or without TM/DTT were constructed after automatic measurements were taken every 2 h for more than 48 h. (D) Doubling time (Dt) and (E) specific growth rate (µ) assays of the yeast cells, data are presented as the mean ± standard deviation, statistical analyses were performed using a two-way ANOVA test. * indicates p < 0.05; ** indicates p < 0.01.
Biomolecules 15 00271 g001
Figure 2. TIM8 deficiency leads to an imbalance in the antioxidant system in yeast. (A) The relative ROS levels in tim8Δ cells were significantly increased under normal conditions. ** indicates p < 0.01, the control’s error was propagated into the normalized values. (B) mRNA expression levels of oxidative stress-related genes in the WT and TIM8-deficient strains under unstressed conditions measured via RT-PCR. The number of transcripts was normalized to that of PRP8. * indicates p < 0.05; ** indicates p < 0.01, the control’s error was propagated into the normalized values. (C) The expression levels of spliced HAC1 mRNA (HAC1s) were detected by RT–PCR. The number of transcripts was normalized to that of the housekeeping gene PRP8. * indicates p < 0.05, the control’s error was propagated into the normalized values. (D) HAC1 mRNA splicing pattern in TIM8-deficient and WT strains detected via agarose gel electrophoresis. HAC1s, spliced HAC1 mRNA. HAC1u, unspliced HAC1 mRNA. PRP8 was used as the control. The image was inverted for clarity. The intensity of each band was quantified densitometrically using ImageJ software V1.8.0. (E) The mRNA levels of UPR genes in the WT strains and TIM8-deficient strains measured via RT-PCR under stressed (1.5 μM TM) and unstressed conditions, and the expression was normalized to that of the housekeeping gene PRP8. All data represent the mean ± S.D. of three biological replicates, with * (p < 0.05) indicating unstressed tim8Δ vs. unstressed WT, and Δ (p < 0.05) indicating TM-stressed tim8Δ vs. TM-stressed WT, the control’s error was propagated into the normalized values. (F) The relative ROS levels in tim8Δ cells significantly decreased under 1.5 μM TM stress, and the control’s error was propagated into the normalized values. * indicates p < 0.05. (G) mRNA expression levels of oxidative stress-related genes in the WT and tim8Δ strains under 1.5 mM TM stress. * indicates p < 0.05; ** indicates p < 0.01, the control’s error was propagated into the normalized values. Original images of (D) can be found in Supplementary Materials (File S1).
Figure 2. TIM8 deficiency leads to an imbalance in the antioxidant system in yeast. (A) The relative ROS levels in tim8Δ cells were significantly increased under normal conditions. ** indicates p < 0.01, the control’s error was propagated into the normalized values. (B) mRNA expression levels of oxidative stress-related genes in the WT and TIM8-deficient strains under unstressed conditions measured via RT-PCR. The number of transcripts was normalized to that of PRP8. * indicates p < 0.05; ** indicates p < 0.01, the control’s error was propagated into the normalized values. (C) The expression levels of spliced HAC1 mRNA (HAC1s) were detected by RT–PCR. The number of transcripts was normalized to that of the housekeeping gene PRP8. * indicates p < 0.05, the control’s error was propagated into the normalized values. (D) HAC1 mRNA splicing pattern in TIM8-deficient and WT strains detected via agarose gel electrophoresis. HAC1s, spliced HAC1 mRNA. HAC1u, unspliced HAC1 mRNA. PRP8 was used as the control. The image was inverted for clarity. The intensity of each band was quantified densitometrically using ImageJ software V1.8.0. (E) The mRNA levels of UPR genes in the WT strains and TIM8-deficient strains measured via RT-PCR under stressed (1.5 μM TM) and unstressed conditions, and the expression was normalized to that of the housekeeping gene PRP8. All data represent the mean ± S.D. of three biological replicates, with * (p < 0.05) indicating unstressed tim8Δ vs. unstressed WT, and Δ (p < 0.05) indicating TM-stressed tim8Δ vs. TM-stressed WT, the control’s error was propagated into the normalized values. (F) The relative ROS levels in tim8Δ cells significantly decreased under 1.5 μM TM stress, and the control’s error was propagated into the normalized values. * indicates p < 0.05. (G) mRNA expression levels of oxidative stress-related genes in the WT and tim8Δ strains under 1.5 mM TM stress. * indicates p < 0.05; ** indicates p < 0.01, the control’s error was propagated into the normalized values. Original images of (D) can be found in Supplementary Materials (File S1).
Biomolecules 15 00271 g002
Figure 3. The RLS and CLS of tim8Δ cells. (A) The RLS of the WT and tim8Δ strains (the mean lifespans are shown in parentheses; N indicates the total number of mother cells). TIM8 deletion did not result in significant differences in the RLS. The experiments were performed in duplicate, and the differences were analyzed for statistical significance via the Wilcoxon rank sum test. (B) The CLS of the WT and tim8Δ strains was determined in synthetic complete liquid medium under the unstressed condition. (C) The CLS of the WT and tim8Δ strains under the TM-stressed condition.
Figure 3. The RLS and CLS of tim8Δ cells. (A) The RLS of the WT and tim8Δ strains (the mean lifespans are shown in parentheses; N indicates the total number of mother cells). TIM8 deletion did not result in significant differences in the RLS. The experiments were performed in duplicate, and the differences were analyzed for statistical significance via the Wilcoxon rank sum test. (B) The CLS of the WT and tim8Δ strains was determined in synthetic complete liquid medium under the unstressed condition. (C) The CLS of the WT and tim8Δ strains under the TM-stressed condition.
Biomolecules 15 00271 g003
Figure 4. The mitochondrial respiration capacity decreased in tim8Δ cells. Compared with WT cells, tim8Δ cells formed more petite colonies. Statistical significance was analyzed by χ2-test, and a p value less than 0.05 was considered to indicate statistical significance. ** p < 0.01.
Figure 4. The mitochondrial respiration capacity decreased in tim8Δ cells. Compared with WT cells, tim8Δ cells formed more petite colonies. Statistical significance was analyzed by χ2-test, and a p value less than 0.05 was considered to indicate statistical significance. ** p < 0.01.
Biomolecules 15 00271 g004
Figure 5. SOD2 overexpression enhances TM resistance in the tim8Δ strain. (A) The SOD2 gene was highly expressed in the overexpression strains. Statistical significance was analyzed by Student’s t test, and a p value less than 0.05 was considered to indicate statistical significance, **** p <0.0001 the control’s error was propagated into the normalized values. (B) Overexpression of SOD2 reduced ROS with or without TM stress. Statistical significance was analyzed by Student’s t test, and a p value less than 0.05 was considered to indicate statistical significance. * p < 0.05, ** p <0.01, the control’s error was propagated into the normalized values. (C) The WT, tim8Δ, tim8Δ SOD2OX, and tim8Δ CCT1OX strains were grown on YPD plates with or without 1.5 μM TM. (D) Colony-forming unit assays. (E) mRNA expression levels of spliced HAC1. Statistical significance was analyzed by Student’s t test, and a p value less than 0.05 was considered to indicate statistical significance. * p < 0.05, the control’s error was propagated into the normalized values. (F) mRNA levels of UPR genes in the WT, tim8Δ, and tim8Δ SOD2 OX strains were measured via RT-PCR under stressed (1.5 μM TM) and unstressed conditions. The results were analyzed by Student’s t test. All data represent the mean ± S.D. of three biological replicates, with * (p < 0.05) indicating unstressed tim8Δ vs. unstressed WT, and Δ (p < 0.05) indicating TM-stressed tim8Δ vs. TM-stressed WT, the control’s error was propagated into the normalized values. (G) CLS of the WT, tim8Δ, and tim8Δ SOD2 OX strains. (H) Overexpression of SOD2 was unable to restore respiration capacity in the tim8Δ strain. The results were analyzed by χ2-test, and a p value less than 0.05 was considered to indicate statistical significance. ** p < 0.01. (I) CLS of the tim8Δ and tim8Δ HAC1 OX strains. (J) Overexpression of HAC1 was unable to restore respiration capacity in the tim8Δ strain. Statistical significance was analyzed by χ2-test, and a p value less than 0.05 was considered to indicate statistical significance. ** p < 0.01.
Figure 5. SOD2 overexpression enhances TM resistance in the tim8Δ strain. (A) The SOD2 gene was highly expressed in the overexpression strains. Statistical significance was analyzed by Student’s t test, and a p value less than 0.05 was considered to indicate statistical significance, **** p <0.0001 the control’s error was propagated into the normalized values. (B) Overexpression of SOD2 reduced ROS with or without TM stress. Statistical significance was analyzed by Student’s t test, and a p value less than 0.05 was considered to indicate statistical significance. * p < 0.05, ** p <0.01, the control’s error was propagated into the normalized values. (C) The WT, tim8Δ, tim8Δ SOD2OX, and tim8Δ CCT1OX strains were grown on YPD plates with or without 1.5 μM TM. (D) Colony-forming unit assays. (E) mRNA expression levels of spliced HAC1. Statistical significance was analyzed by Student’s t test, and a p value less than 0.05 was considered to indicate statistical significance. * p < 0.05, the control’s error was propagated into the normalized values. (F) mRNA levels of UPR genes in the WT, tim8Δ, and tim8Δ SOD2 OX strains were measured via RT-PCR under stressed (1.5 μM TM) and unstressed conditions. The results were analyzed by Student’s t test. All data represent the mean ± S.D. of three biological replicates, with * (p < 0.05) indicating unstressed tim8Δ vs. unstressed WT, and Δ (p < 0.05) indicating TM-stressed tim8Δ vs. TM-stressed WT, the control’s error was propagated into the normalized values. (G) CLS of the WT, tim8Δ, and tim8Δ SOD2 OX strains. (H) Overexpression of SOD2 was unable to restore respiration capacity in the tim8Δ strain. The results were analyzed by χ2-test, and a p value less than 0.05 was considered to indicate statistical significance. ** p < 0.01. (I) CLS of the tim8Δ and tim8Δ HAC1 OX strains. (J) Overexpression of HAC1 was unable to restore respiration capacity in the tim8Δ strain. Statistical significance was analyzed by χ2-test, and a p value less than 0.05 was considered to indicate statistical significance. ** p < 0.01.
Biomolecules 15 00271 g005
Figure 6. Knockdown of TIMM8A induces ER stress in ARPE-19 cells. (A) siRNA was transfected into ARPE-19 cells to silence TIMM8A gene expression. The cell lysates were analyzed via Western blotting with antibodies specific for GRP7, XBP1s, and TIMM8A. The changes in protein expression were normalized to that of GAPDH. (B) Quantification of the relative TIMM8A, GRP78, and XBP1s protein levels. Statistical significance was analyzed by Student’s t test, and the control’s error was propagated into the normalized values. ** p <0.01, the control’s error was propagated into the normalized values. (C) Relative ROS and intracellular calcium levels in siRNA-transfected ARPE-19 cells. Statistical significance was analyzed by Student’s t test, and the control’s error was propagated into the normalized values. * p < 0.05, ** p <0.01, the control’s error was propagated into the normalized values. Original images of (A) can be found in Supplementary Materials (File S2).
Figure 6. Knockdown of TIMM8A induces ER stress in ARPE-19 cells. (A) siRNA was transfected into ARPE-19 cells to silence TIMM8A gene expression. The cell lysates were analyzed via Western blotting with antibodies specific for GRP7, XBP1s, and TIMM8A. The changes in protein expression were normalized to that of GAPDH. (B) Quantification of the relative TIMM8A, GRP78, and XBP1s protein levels. Statistical significance was analyzed by Student’s t test, and the control’s error was propagated into the normalized values. ** p <0.01, the control’s error was propagated into the normalized values. (C) Relative ROS and intracellular calcium levels in siRNA-transfected ARPE-19 cells. Statistical significance was analyzed by Student’s t test, and the control’s error was propagated into the normalized values. * p < 0.05, ** p <0.01, the control’s error was propagated into the normalized values. Original images of (A) can be found in Supplementary Materials (File S2).
Biomolecules 15 00271 g006
Table 1. The S. cerevisiae strains used in this study.
Table 1. The S. cerevisiae strains used in this study.
Strain NameGenotypeCommentsSource
BY4742MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0WTGift from Matt Kaeberlein
tim8Δ
tim8Δ SOD2 OX
BY4742 tim8::URA3
BY4742 tim8::URA3SOD2OX
Deletion of TIM8 in BY4742
pAUR123SOD2 was transformed into tim8Δ
This study
This study
tim8ΔCTT1 OX
tim8ΔHAC1 OX
BY4742 tim8::URA3 CTT1 OX
BY4742 tim8::URA3HAC1OX
pAUR123 CTT1 was transformed into tim8Δ
pAUR123 HAC1 was transformed into tim8Δ
This study
This study
Table 2. The real-time PCR primers used for oxidative stress response assay.
Table 2. The real-time PCR primers used for oxidative stress response assay.
GenePrimersSequence
PRP8ForwardTCATGGCTGCGTCTGAAGTA
ReverseGGCACCGTTATTAGCAGCAT
SOD1ForwardAATCCGAGCCAACCACTGTC
ReverseCGACGCTTCTGCCTACAACG
SOD2ForwardGCATTACACCAAGCACCAT
ReverseCTCGTCCAGACTGCCAAAC
CTA1ForwardCCAACAGGACAGACCCATTC
ReverseTTACCCAAAACGCGGTAGAG
CTT1ForwardGATTCCGTTCTACAAGCCAGAC
ReverseGGAGTATGGACATCCCAAGTTTC
GPX1ForwardATCCATTCCCCTTCAACTCC
ReverseTCCAGACTTCCCGCTTAC
GPX2ForwardAAAAGCCAAAAAGCAGGTTTACT
ReverseCCAAGGACGATGGTTTTGTT
GPX3ForwardTAAAGGGAAAAGTGGTGC
ReverseTTCATAATGGGGAAAGTCA
TRX2ForwardAAAGTTTGCAGAACAATATTCTGACG
ReverseTTGGCACCGACGACTCTGGTAACC
MXR1ForwardACAGATTTTGCGGAGGTTTTAC
ReverseCCATTTTGGTTGCCATTCTT
TSA1ForwardTCTTTTCGCCTCCACTGACT
ReverseCGATGATGAACAAACCTCTCAA
GLR1ForwardCGAACACCAAGCATTACGATTA
ReverseGTAGCGAGGTCAGAAGCATACC
GSH1ForwardGACACCGATGTGGAAACTGA
ReverseCCCTTTTTGGCATAGGATTG
GSH2ForwardCACAGAGCAGGAAATAGCG
ReverseTTGGAGCCAGATAATTGAGT
YAP1ForwardATGATGTCGTTCCATCTAAGGAAGG
ReverseCAACCCCTCTTTCTGAACATTTTGC
SKN7ForwardCCCGAGGAAAGACAGAGATGTA
ReverseCAAAAGAGACCCAGAAGGATTG
Table 3. The real-time PCR primers used for UPR assay.
Table 3. The real-time PCR primers used for UPR assay.
GenePrimersSequence
HACIsForwardGCGTAATCCAGAAGCGCAGT
ReverseGTGATGAAGAAATCATTCAATTCAAATG
EUG1ForwardTATCAATCCACTTGCCAAACACTAC
ReverseACCACTGAGTTAGAGCAACGGAA
ERO1ForwardATGGTGGTAAGCAAGCTGGTC
ReverseACCGATAGAGGCATGGAAACC
LHS1ForwardCCAGGTGAACAGCAGCATTATAT
ReverseCTATTGTAACGGGCTGAGTAGTGTC
KAR2ForwardATACGAGGGTGAAAGAGCCATG
ReverseTCGGATTTACCAGTTCCCTTATCT
FKB2ForwardAATCGGGAACTGTATTTGACTCAA
ReverseTTGGAATTTGCAGCTTTCTTTT
INO1ForwardTGTTCTGTTGTCGGGTTCCTAAT
ReverseCCTTGTACGTGCACTTGTCGGT
PDI1ForwardCATTCCAGGGTTCCCAAGC
ReverseCGGATTGGACGATAACTGGAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tang, D.; Guan, W.; Yang, X.; Li, Z.; Zhao, W.; Liu, X. TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan. Biomolecules 2025, 15, 271. https://doi.org/10.3390/biom15020271

AMA Style

Tang D, Guan W, Yang X, Li Z, Zhao W, Liu X. TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan. Biomolecules. 2025; 15(2):271. https://doi.org/10.3390/biom15020271

Chicago/Turabian Style

Tang, Dong, Wenbin Guan, Xiaodi Yang, Zhongqin Li, Wei Zhao, and Xinguang Liu. 2025. "TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan" Biomolecules 15, no. 2: 271. https://doi.org/10.3390/biom15020271

APA Style

Tang, D., Guan, W., Yang, X., Li, Z., Zhao, W., & Liu, X. (2025). TIM8 Deficiency in Yeast Induces Endoplasmic Reticulum Stress and Shortens the Chronological Lifespan. Biomolecules, 15(2), 271. https://doi.org/10.3390/biom15020271

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop