Development of SNP Markers for White Immature Fruit Skin Color in Cucumber (Cucumis sativus L.) Using QTL-seq and Marker Analyses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Genomic DNA Extraction and Pooling
2.2. Whole-Genome Resequencing
2.3. QTL-seq Analysis
2.4. Annotation of Variants and Identification of Variants Causing Protein Sequence Change
2.5. Development of Molecular Markers
3. Results
3.1. Inheritance of Immature Fruit Skin Color
3.2. Whole-Genome Re-Sequencing and QTL-seq Analysis
3.3. Identification of SNPs and Candidate Genes via in Silico Analysis
3.4. Validation of Candidate Genes for Immature Fruit Skin Phenotype
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Che, G.; Zhang, X. Molecular basis of cucumber fruit domestication. Curr. Opin. Plant Biol. 2019, 47, 38–46. [Google Scholar] [CrossRef]
- Liu, H.; Meng, H.; Pan, Y.; Liang, X.; Jiao, J.; Li, Y.; Chen, S.; Cheng, Z. Fine genetic mapping of the white immature fruit color gene w to a 33.0-kb region in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2015, 128, 2375–2385. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Wang, S.; Hu, B.; Chen, H.; Zhang, Z.; Huang, S. An ACCUMULATION AND REPLICATION OF CHLOROPLASTS 5 gene mutation confers light green peel in cucumber. J. Integr. Plant Biol. 2015, 57, 936–942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sui, X.; Shan, N.; Hu, L.; Zhang, C.; Yu, C.; Ren, H.; Turgeon, R.; Zhang, Z. The complex character of photosynthesis in cucumber fruit. J. Exp. Bot. 2017, 68, 1625–1637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, M.; Chen, L.; Liang, Z.; He, X.; Liu, W.; Jiang, B.; Yan, J.; Sun, P.; Cao, Z.; Peng, Q.; et al. Metabolome and transcriptome analyses reveal chlorophyll and anthocyanin metabolism pathway associated with cucumber fruit skin color. BMC Plant Biol. 2020, 20, 386. [Google Scholar] [CrossRef]
- Yang, L.; Koo, D.-H.; Li, Y.; Zhang, X.; Luan, F.; Havey, M.J.; Jiang, J.; Weng, Y. Chromosome rearrangements during domestication of cucumber as revealed by high-density genetic mapping and draft genome assembly. Plant J. 2012, 71, 895–906. [Google Scholar] [CrossRef]
- Huang, S.; Li, R.; Zhang, Z.; Li, L.; Gu, X.; Fan, W.; Lucas, W.J.; Wang, X.; Xie, B.; Ni, P.; et al. The genome of the cucumber, Cucumis sativus L. Nat. Genet. 2009, 41, 1275–1281. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Li, H.; Huang, W.; Xu, Y.; Zhou, Q.; Wang, S.; Ruan, J.; Huang, S.; Zhang, Z. A chromosome-scale genome assembly of cucumber (Cucumis sativus L.). GigaScience 2019, 8, guz072. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Wen, C.; Weng, Y. Fine mapping of the pleiotropic locus B for black spine and orange mature fruit color in cucumber identifies a 50 kb region containing a R2R3-MYB transcription factor. Theor. Appl. Genet. 2013, 126, 2187–2196. [Google Scholar] [CrossRef]
- Yang, X.; Zhang, W.; Li, Y.; He, H.; Bie, B.; Ren, G.; Zhao, J.; Wang, Y.; Nie, J.; Pan, J.; et al. High-resolution mapping of the dull fruit skin gene D in cucumber (Cucumis sativus L.). Mol. Breed. 2014, 33, 15–22. [Google Scholar] [CrossRef]
- Fanourakis, N.; Simon, P. Analysis of genetic linkage in the cucumber. J. Hered. 1987, 78, 238–242. [Google Scholar] [CrossRef]
- Zhang, W.; He, H.; Guan, Y.; Du, H.; Yuan, L.; Li, Z.; Yao, D.; Pan, J.; Cai, R. Identification and mapping of molecular markers linked to the tuberculate fruit gene in the cucumber (Cucumis sativus L.). TAG. Theor. Appl. Genetics. Theor. Und. Angew. Genet. 2009, 120, 645–654. [Google Scholar] [CrossRef] [PubMed]
- Lun, Y.; Wang, X.; Zhang, C.; Yang, L.; Gao, D.; Chen, H.; Huang, S. A CsYcf54 variant conferring light green coloration in cucumber. Euphytica 2016, 208, 509–517. [Google Scholar] [CrossRef]
- Yang, X.; Li, Y.; Zhang, W.; He, H.; Pan, J.; Cai, R. Fine mapping of the uniform immature fruit color gene u in cucumber (Cucumis sativus L.). Euphytica 2014, 196, 341–348. [Google Scholar] [CrossRef]
- Liu, H.; Jiao, J.; Liang, X.; Liu, J.; Meng, H.; Chen, S.; Li, Y.; Cheng, Z. Map-based cloning, identification and characterization of the w gene controlling white immature fruit color in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2016, 129, 1247–1256. [Google Scholar] [CrossRef]
- Tang, H.-Y.; Dong, X.; Wang, J.-K.; Xia, J.-H.; Xie, F.; Zhang, Y.; Yao, X.; Xu, Y.-J.; Wang, Z.-J. Fine Mapping and Candidate Gene Prediction for White Immature Fruit Skin in Cucumber (Cucumis sativus L.). Int. J. Mol. Sci. 2018, 19, 1493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doyle, J.J. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Takagi, H.; Abe, A.; Yoshida, K.; Kosugi, S.; Natsume, S.; Mitsuoka, C.; Uemura, A.; Utsushi, H.; Tamiru, M.; Takuno, S.; et al. QTL-seq: Rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. Plant J. 2013, 74, 174–183. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beale, S.I. Green genes gleaned. Trends Plant Sci. 2005, 10, 309–312. [Google Scholar] [CrossRef] [PubMed]
- Kishor, D.S.; Seo, J.; Chin, J.H.; Koh, H.-J. Evaluation of Whole-Genome Sequence, Genetic Diversity, and Agronomic Traits of Basmati Rice (Oryza sativa L.). Front. Genet. 2020, 11, 86. [Google Scholar] [CrossRef] [Green Version]
- Kishor, D.S.; Noh, Y.; Song, W.-H.; Lee, G.P.; Park, Y.; Jung, J.-K.; Shim, E.-J.; Sim, S.-C.; Chung, S.-M. SNP marker assay and candidate gene identification for sex expression via genotyping-by-sequencing-based genome-wide associations (GWAS) analyses in Oriental melon (Cucumis melo L.var.makuwa). Sci. Hortic. 2021, 276, 109711. [Google Scholar] [CrossRef]
- Kishor, D.S.; Chung, S.-M. Development of SNP markers and validation assays in commercial Korean melon cultivars, using Genotyping-by-sequencing and Fluidigm analyses. Sci. Hortic. 2019, 263, 109113. [Google Scholar] [CrossRef]
- Varshney, R.K.; Nayak, S.N.; May, G.D.; Jackson, S.A. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol. 2009, 27, 522–530. [Google Scholar] [CrossRef] [Green Version]
- Abe, A.; Kosugi, S.; Yoshida, K.; Natsume, S.; Takagi, H.; Kanzaki, H.; Matsumura, H.; Yoshida, K.; Mitsuoka, C.; Tamiru, M.; et al. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 2012, 30, 174–178. [Google Scholar] [CrossRef] [Green Version]
- Arikit, S.; Wanchana, S.; Khanthong, S.; Saensuk, C.; Thianthavon, T.; Vanavichit, A.; Toojinda, T. QTL-seq identifies cooked grain elongation QTLs near soluble starch synthase and starch branching enzymes in rice (Oryza sativa L.). Sci. Rep. 2019, 9, 8328. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Lei, L.; Li, P.; Wang, J.; Wang, C.; Yang, F.; Chen, J.; Liu, H.; Zheng, H.; Xin, W.; et al. Identification of Candidate Genes Conferring Cold Tolerance to Rice (Oryza sativa L.) at the Bud-Bursting Stage Using Bulk Segregant Analysis Sequencing and Linkage Mapping. Front. Plant Sci. 2021, 12, 402. [Google Scholar] [CrossRef]
- Ramos, A.; Fu, Y.; Michael, V.; Meru, G. QTL-seq for identification of loci associated with resistance to Phytophthora crown rot in squash. Sci. Rep. 2020, 10, 5326. [Google Scholar] [CrossRef]
- Zhang, C.; Badri Anarjan, M.; Win, K.T.; Begum, S.; Lee, S. QTL-seq analysis of powdery mildew resistance in a Korean cucumber inbred line. Theor. Appl. Genet. 2021, 134, 435–451. [Google Scholar] [CrossRef] [PubMed]
- Win, K.T.; Zhang, C.; Silva, R.R.; Lee, J.H.; Kim, Y.-C.; Lee, S. Identification of quantitative trait loci governing subgynoecy in cucumber. Theor. Appl. Genet. 2019, 132, 1505–1521. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Bo, K.; Gu, X.; Pan, J.; Li, Y.; Chen, J.; Wen, C.; Ren, Z.; Ren, H.; Chen, X.; et al. Molecularly tagged genes and quantitative trait loci in cucumber with recommendations for QTL nomenclature. Hortic. Res. 2020, 7, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albrecht, V.; Šimková, K.; Carrie, C.; Delannoy, E.; Giraud, E.; Whelan, J.; Small, I.D.; Apel, K.; Badger, M.R.; Pogson, B.J. The Cytoskeleton and the Peroxisomal-Targeted SNOWY COTYLEDON3 Protein Are Required for Chloroplast Development in Arabidopsis. Plant Cell 2010, 22, 3423–3438. [Google Scholar] [CrossRef] [Green Version]
Name | Population | Plant Number | Immature Fruit Skin Color Phenotype | ||||
---|---|---|---|---|---|---|---|
White | Light-Green | Expected | χ2 | p Value † | |||
PI525075 | P1 | 10 | 10 | 0 | - | - | - |
MEJ | P2 | 10 | 0 | 10 | - | - | - |
MEJ/PI525075 | F1 | 10 | 0 | 10 | - | - | - |
MEJ/PI525075 | F2 | 136 | 30 | 106 | 3:1 | 0.62 | 0.42 |
Samples | Raw Data | Trimmed Data | Coverage (X) | |||
---|---|---|---|---|---|---|
Reads | Read Length (bp) | Reads | Read Length (bp) | % | ||
PI525075 | 192,314,600 | 29,039,504,600 | 157,678,304 | 22,512,072,535 | 77.52 | 64.32 |
MEJ | 191,719,994 | 28,949,719,094 | 187,218,180 | 27,266,475,876 | 94.19 | 77.90 |
White-pool | 204,951,660 | 30,947,700,660 | 175,957,140 | 25,010,424,993 | 80.82 | 71.46 |
Light-green-pool | 228,647,910 | 34,525,834,410 | 197,713,150 | 28,154,853,131 | 81.55 | 80.44 |
Chromosome Number | No. of SNPs | |
---|---|---|
White-Pool | Light-Green-Pool | |
1 | 11,896 | 8263 |
2 | 21,047 | 20,044 |
3 | 46,480 | 16,303 |
4 | 17,843 | 25,400 |
5 | 27,535 | 15,122 |
6 | 18,782 | 21,018 |
7 | 16,809 | 14,749 |
Total | 160,392 | 120,899 |
Chr. | Physical Position (Mb) | Size (bp) | SNPs | Genes |
---|---|---|---|---|
3 | 34.1–41.67 | 7,579,492 | 11,435 | 556 |
5 | 12.2–12.7 | 500,000 | 743 | 33 |
Position | Ref | Alt | Effect | AA | Type | Gene ID | Description |
---|---|---|---|---|---|---|---|
34626707 | TAAAAAAAAAAA | TAAAAAAAAAA | Deletion | ATG | InDel | Chr3CG43770 | LSi6 [Cucumis sativus var. sativus], aquaporin NIP |
40443941 | T | C | Non_synonymous | I3V | SNP | Chr3CG51850 | Thioredoxin-related transmembrane protein 2 isoform X1 [Cucumis sativus] |
40660199 | T | G | Non_synonymous | L457R | SNP | Chr3CG52290 | Inactive poly [ADP-ribose] polymerase RCD1 [Cucumis sativus] |
41075124 | G | T | Non_synonymous | V250L | SNP | Chr3CG52880 | β-amyrin 11-oxidase [Cucumis sativus], AIT72036.1 cytochrome P450 [Cucumis sativus] |
41075140 | T | G | Non_synonymous | I255R | SNP | Chr3CG52880 | β-amyrin 11-oxidase [Cucumis sativus], AIT72036.1 cytochrome P450 [Cucumis sativus] |
41102542 | CTTTTTTTTTTTTT | CTTTTTTTTTTTTTT | Insertion | S123F | InDel | Chr3CG52910 | Hypothetical protein Csa_013022 [Cucumis sativus], PHT; solute carrier family 15 (peptide/histidine transporter) |
41106529 | G | A | Non_synonymous | P338L | SNP | Chr3CG52930 | Pyruvate kinase isozyme G, chloroplastic isoform X1 [Benincasa hispida], pyk; pyruvate kinase [EC:2.7.1.40] |
41641571 | G | A | Non_synonymous | A171T | SNP | Chr3CG53640 | QWRF motif-containing protein 7 [Cucumis sativus] |
Marker Name | Chr | Position | Gene ID | Marker Type | Forward/Reverse Sequence (5′–3′) | Restriction Site | Restriction Enzyme | Amplicon Size (Light-Green vs. White) |
---|---|---|---|---|---|---|---|---|
M1 | 3 | 40443941 | Chr3CG51850 | CAPS | TTCTCTAATGACGATGACGTTG/ATCCGGAATTTCTTTCTTCTTC | ACGT | HpyCH4IV | 691 vs. (264, 427) |
M2 | 3 | 40660199 | Chr3CG52290 | CAPS | TCTGTGAACTTTGACAGTGGAG/TAGATCTCCACAAGTCTCCCAT | ACGT | HpyCH4IV | 360 vs. (226, 134) |
M3 | 3 | 40443941 | Chr3CG51850 | dCAPS | TTTCCGGGATGAATTCCCGGATCGA/ATCCGGAATTTCTTTCTTCTTC | ATCGAT | ClaI | 238 vs. 263 |
M4 | 3 | 40660199 | Chr3CG52290 | dCAPS | AAGATACCATCAAGTCCTCTTAAGC/GCAATTTATCTGCAACTGGTCT | AAGCTT | HindIII | 272 vs. 297 |
M5 | 3 | 41075124 | Chr3CG52880 | dCAPS | GAAGATAGAGAATACAATTCAAGCT/TATGTAGAAGAGCCCAACAAGC | AAGCTT | HindIII | 197 vs. 172 |
M6 | 3 | 41075140 | Chr3CG52880 | dCAPS | TGTTTTATCATTTTCAAATCTACGT/GCCTATTAAATTGGTGGATGAA | TACGTA | SnaBI | 338 vs. 363 |
M7 | 3 | 41106529 | Chr3CG52930 | dCAPS | AACCTTGTGGACACTCGATGGACTT/ATGCGTGTTCCTCTAGTTTGTT | CTNAG | DdeI | 327 vs. 302 |
M8 | 3 | 41641571 | Chr3CG53640 | dCAPS | ATGGAAGTCTCTGCTCTAACCTAAG/AAACTAGGCAGTCAACGAGGT | CCTNAGC | Bpu10I | 113 vs. 138 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kishor, D.S.; Alavilli, H.; Lee, S.-C.; Kim, J.-G.; Song, K. Development of SNP Markers for White Immature Fruit Skin Color in Cucumber (Cucumis sativus L.) Using QTL-seq and Marker Analyses. Plants 2021, 10, 2341. https://doi.org/10.3390/plants10112341
Kishor DS, Alavilli H, Lee S-C, Kim J-G, Song K. Development of SNP Markers for White Immature Fruit Skin Color in Cucumber (Cucumis sativus L.) Using QTL-seq and Marker Analyses. Plants. 2021; 10(11):2341. https://doi.org/10.3390/plants10112341
Chicago/Turabian StyleKishor, D. S., Hemasundar Alavilli, Sang-Choon Lee, Jeong-Gu Kim, and Kihwan Song. 2021. "Development of SNP Markers for White Immature Fruit Skin Color in Cucumber (Cucumis sativus L.) Using QTL-seq and Marker Analyses" Plants 10, no. 11: 2341. https://doi.org/10.3390/plants10112341