Silverleaf (Chondrostereum purpureum) Effects on Japanese Plum (Prunus salicina)
Abstract
:1. Introduction
2. Results
2.1. Chondrostereum purpureum Isolates
2.2. Pathogenicity Tests
2.3. Silverleaf Effects on Plum
2.3.1. Water Potential
2.3.2. Yield Assessment
2.3.3. Fruit Quality
3. Discussion
4. Materials and Methods
4.1. Collection of Samples
4.2. Isolation and Purification
4.3. Identification and Characterization
4.4. Pathogenicity
4.5. Silverleaf Effects on Plum
4.5.1. Water Potential
4.5.2. Yield Assessment
4.5.3. Fruit Quality
5. Experimental Design and Statistical Analyses
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Odepa, Estudios y Políticas Agrarias. Ministerio de Agricultura. Evolución de la Fruticultura Chilena en los Últimos 20 Años. Oficina de estudios y políticas Agrarias. 2021. Available online: https://www.odepa.gob.cl/rubros/frutas-frescas (accessed on 27 April 2021).
- Gramaje, D.; Baumgartner, K.; Halleen, F.; Mostert, L.; Sosnowski, M.R.; Úrbez-Torres, J.R.; Armengol, J. Fungal trunk diseases: A problem beyond grapevines? Plant Pathol. 2016, 65, 355–356. [Google Scholar] [CrossRef]
- Grinbergs, D.; Chilian, J.; Carrasco-Fernandez, J.; France, A.; Moya-Elizondo, E.; Gerding, M. A PCR-based method for the rapid detection of Chondrostereum purpureum in apple. Plant Dis. 2020, 104, 702–707. [Google Scholar] [CrossRef]
- France, A.; Grinbergs, D.; Carrasco, J. First detection of Silverleaf (Chondrostereum purpureum) on rabbiteye blueberry (Vaccinium ashei) and disease damages. Acta Hortic. 2017, 1180, 277. [Google Scholar] [CrossRef]
- Gramaje, D.; Agustí-Brisach, C.; Pérez-Sierra, A.; Moralejo, E.; Olmo, D.; Mostert, L.; Damm, U.; Armengol, J. Fungal trunk pathogens associated with wood decay of almond trees on Mallorca (Spain). Persoonia 2012, 28, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Cha, J.; Lee, S.; Chun, K.; Lee, S.; Ohga, S. Armillaria root rot caused by Armillaria Tabescens on Prunus Salicina in a Korean garden. J. Fac. Agric. Kyushu Univ. 2009, 54, 1273–1277. [Google Scholar]
- Ko, Y.; Yao, K.; Chen, C.; Liu, C.; Maruthasalam, S.; Lin, C. First report of gummosis disease of plum (Prunus salicina) caused by a Botryosphaeria sp. in Taiwan. Plant Dis. 2008, 92, 483. [Google Scholar] [CrossRef] [PubMed]
- Mojeremane, K.; Lebenya, P.; du Plessis, I.; van der Rijst, M.; Mostert, L.; Armengol, J.; Halleen, F. Cross pathogenicity of Neofusicoccum australe and Neofusicoccum stellenboschiana on grapevine and selected fruit and ornamental trees. Phytopathol. Mediterr. 2020, 59, 581–593. [Google Scholar] [CrossRef]
- Damm, U.; Crous, P.; Fourie, P. Afissitunicate ascus mechanism in the Calosphaeriaceae, and novel species of Jattaea and Calosphaeria on Prunus wood. Persoonia 2008, 20, 39–52. [Google Scholar] [CrossRef]
- Damm, U.; Crous, P.; Fourie, P. Botryosphaeriaceae as potential pathogens of Prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov. Mycologia 2007, 99, 664–680. [Google Scholar] [CrossRef]
- Li, Q.; Tang, L.; Sun, W.; Huang, S.; Guo, T.; Mo, J.; Fan, M.; Zhang, A.; Hsiang, T. First report of stem canker and dieback caused by Neofusicoccum parvum on plum in Guangxi, Southern China. Plant Dis. 2019, 103, 2952. [Google Scholar] [CrossRef]
- Damm, U.; Mostert, L.; Crous, P.; Fourie, P. Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia 2008, 20, 87–102. [Google Scholar] [CrossRef] [Green Version]
- Ramsfield, R.D. Risk assessment of inundative biological control with Chondrostereum purpureum in New Zealand. N. Z. J. For. Sci. 2006, 36, 11–20. [Google Scholar]
- Becker, E.; Ball, L.; Hintz, W. PCR Based genetic markers for detection and infection frequency analysis of the biocontrol fungus Chondrostereum purpureum on Stika Alder and Trembling Aspen. Biol. Control. 1999, 15, 71–80. [Google Scholar] [CrossRef]
- Becker, E.; Shamoun, S.; Hinz, W. Efficacy and environmental fate of Chondrostereum purpureum used as a biological control for red alder (Alnus rubra). Biol. Control. 2005, 33, 269–277. [Google Scholar] [CrossRef]
- Shamoun, S. Application of biological control to vegetation management in forestry. In Proceedings of the X International Symposium on Biological Control of Weeds, Bozeman, MT, USA, 4–14 July 1999; pp. 87–96. [Google Scholar]
- Hamberg, L.; Saksa, T.; Hantula, J. Role of Chondrostereum purpureum in biocontrol of trees. Appl. Microbiol. Biotechnol. 2021, 105, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Bus, V.; Spiers, A.; Brewster, D.; Hofstee, M. Preliminary screening of apple germplasm for resistance to Silverleaf infection. N. Z. J. Crop Hortic. Sci. 1996, 24, 1–6. [Google Scholar] [CrossRef]
- Setliff, E.C. The wound pathogen Chondrostereum purpureum, its history and incidence on trees in North America. Austral. J. Bot. 2002, 50, 645–651. [Google Scholar] [CrossRef]
- Willoughby, I.H.; Seier, M.K.; Stokes, V.J.; Thomas, S.E.; Varia, S. Synthetic herbicides were more effective than a bioherbicide based on Chondrostereum purpureum in reducing resprouting of Rhododendron ponticum, a host of Phytophthora ramorum in the UK. Forestry 2015, 88, 336–344. [Google Scholar] [CrossRef] [Green Version]
- Hamberg, L.; Hantula, J. The efficacy of six elite isolates of the fungus Chondrostereum purpureum against the sprouting of European aspen. J. Environ. Manag. 2016, 171, 217–224. [Google Scholar] [CrossRef]
- Merlet, L.; Wiseman, M.; Serdani, M.; Putnam, M.L. First report of Silver Leaf caused by Chondrostereum purpureum on Vaccinium corymbosum in Oregon. Plant Dis. 2018, 102, 2041. [Google Scholar] [CrossRef]
- Grinbergs, D.; Chilian, J.; Lisboa, K.; France, A. First report of Silverleaf disease caused by Chondrostereum purpureum on murta (Ugni molinae Turcz.) in Chile. Plant Dis. 2019, 103, 2140. [Google Scholar] [CrossRef]
- Spiers, A.G.; Hopcroft, D.H. Factors affecting Chondrostereum purpureum infection of Salix. Eur. J. For. Pathol. 1988, 18, 257–278. [Google Scholar] [CrossRef]
- Spiers, A.G.; Brewster, D. Evaluation of chemical and biological treatments for control of Chondrostereum purpureum infection of pruning wounds in willows, apples, and peaches. N. Zeal. J. Crop Hort. 1997, 25, 19–31. [Google Scholar] [CrossRef] [Green Version]
- Spiers, A.; Edwards, W.; Hopcroft, D. Effects of Silverleaf infection on ultrastructure of foliage of Prunus, Rosa, and Populus. N. Z. J. Bot. 1987, 25, 411–423. [Google Scholar] [CrossRef]
- Simpson, R.M.; Van Hekezen, R.; Van Lune, F.; Brewster, D.; Spiers, A.G. Extracellular enzymes of Chondrostereum purpureum, causal fungus of Silverleaf disease. N. Z. Plant Prot. 2001, 54, 202–208. [Google Scholar] [CrossRef]
- Cloete, M.; Fourie, P.; Damm, U.; Crous, P.; Mostert, L. Fungi associated with die-back symptoms of apple and pear trees, a possible inoculum source of grapevine trunk disease pathogens. Phytopathol. Mediterr. 2011, 50, 176–190. [Google Scholar] [CrossRef]
- Ozgonen, H.; Erkilic, A.; Baloglu, S. First report of Chondrostereum purpureum causing Silverleaf disease of apricot (Prunus armeniaca) in Malatya, Turkey. N. Z. J. Crop Hortic. Sci. 2006, 34, 357. [Google Scholar] [CrossRef] [Green Version]
- Børve, J.; Ippolito, A.; Tanovic, B.; Michalecka, M.; Sanzani, S.M.; Ponitowska, A.; Mari, M.; Hrustic, J. Fungal diseases. In Cherries. Botany, Production and Uses; Quero-García, J., Iezzoni, A., Pulawska, J., Lang, G.A., Eds.; CABI: Wallingford, CT, UK, 2017; pp. 338–364. [Google Scholar]
- Spiers, A.; Brewster, D.; Bus, V.; Hopcroft, H. Seasonal variation in susceptibility of xylem tissue of Malus, Pyrus, Prunus, and Salix species to Chondrostereum purpureum in New Zealand. Mycol. Res. 1998, 102, 881–890. [Google Scholar] [CrossRef]
- Ogawa, J.; English, H. Diseases of Temperate Zone Tree Fruit and Nut Crops; University of California: Oakland, CA, USA, 1991; Volume 3345, 461p. [Google Scholar]
- Pearce, R.B.; Sumer, S.; Doran, S.J.; Carpenter, T.A.; Hali, L.D. Non-invasive imaging of fungal colonization and host response in the living sapwood of sycamore (Acer pseudoplatanus L.) using nuclear magnetic resonance. Physiol. Mol. Plant Path. 1994, 45, 359–384. [Google Scholar] [CrossRef]
- Vartiamäki, H.; Hantula, J.; Uotila, A. Susceptibility of silver birch pruning wounds to infection by white-rot fungus (Chondrostereum purpureum), a potential bioherbicide. Silva Fenn. 2009, 43, 537–547. [Google Scholar] [CrossRef] [Green Version]
- Senda, M.; Narita, T.; Akada, S.; Okuno, T.; Miyairi, K. Characterization of an endopolygalacturonase gene cppgl from phytopathogenic fungus Chondrostereum purpureum. J. Gen. Plant Pathol. 2001, 67, 41–44. [Google Scholar] [CrossRef]
- Bishop, G.C. Studies on Silver Leaf Disease of Stone and Pome Fruit Trees. Ph.D. Thesis, University of Adelaide, Adelaide, Australia, 1978; 128p. [Google Scholar]
- Głowacka, A.; Rozpara, E. Evaluation of several dessert cultivars of plum, new under climatic conditions of Poland. Hort. Sci. (Prague) 2017, 44, 126–132. [Google Scholar] [CrossRef] [Green Version]
- Kaufmane, E.; Grâvîte, I.; Ikase, L. Plum research and growing in Latvia. Proc. Latv. Acad. Sci. Sect. B 2019, 73, 195–206. [Google Scholar] [CrossRef] [Green Version]
- Børve, J.; Talgø, V.; Stensvand, A. Silver Leaf in Norwegian Prunus domestica Plum Orchards. In Proceedings of the IOBC/WPRS Working Groups: Pheromones and Other Semiochemicals in IP & Integrated Protection of Fruit Crops, PheroFIP 2019, Lisbon, Portugal, 20–25 January 2019; p. 219. [Google Scholar]
- Atkinson, J.D. Diseases of Tree Fruits in New Zealand; Bulletin 81; Department of Scientific and Industrial Research: Auckland, New Zealand, 1971; 406p.
- Bien, S.; Damm, U. Prunus trees in Germany—A hideout of unknown fungi? Mycol. Prog. 2020, 19, 667–690. [Google Scholar] [CrossRef]
- Espargham, N.; Mohammadi, H.; Gramaje, D. A survey of trunk disease pathogens within Citrus trees in Iran. Plants 2020, 9, 754. [Google Scholar] [CrossRef]
- Bertsch, C.; Ramirez-Suero, M.; Magnin-Robert, M.; Larignon, P.; Chong, J.; Abou-Mansour, E.; Spagnolo, A.; Clément, C.; Fontaine, F. Grapevine trunk diseases: Complex and still poorly understood. Plant Pathol. 2013, 62, 243–265. [Google Scholar] [CrossRef] [Green Version]
- Spiers, A.; Brewster, D.; Slade, A.; Gardiner, S. Characterization of New Zealand isolates of Chondrostereum purpureum with regard to morphology, growth, pathogenicity and RAPD bandings patterns. Mycol. Res. 2000, 104, 395–402. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungi ribosomal RNA genes for phylogenetics. In PCR Protocols. A Guide to Methods and Applications: 315–322; Academic Press: San Diego, CA, USA, 1990. [Google Scholar]
- France, A.; Santelices, C.; Buddie, A.; Kirk, P. Silverleaf: First worlwide report of a new and harmful disease on blueberry. Acta Hortic. (ISHS) 2009, 810, 341–344. [Google Scholar] [CrossRef]
- Petit, A.N.; Vaillant, N.; Boulay, M.; Clément, C.; Fontaine, F. Alteration of photosynthesis in grapevines affected by esca. Phytopathology 2006, 96, 1060–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fontaine, F.; Pinto, C.; Vallet, J.; Clément, C.; Gomes, A.; Spagnolo, A. The effects of grapevine trunk diseases (GTDs) on vine physiology. Eur. J. Plant Pathol. 2015. [Google Scholar] [CrossRef]
- Hamberg, L.; Vartiamäki, H.; Hantula, J. Breeding Increases the Efficacy of Chondrostereum purpureum in the Sprout Control of Birch. PLoS ONE 2015, 10, e0117381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grinbergs, D.; Chilian, J.; Padilla, N.; Reyes, M.; France, A.; Gerding, M.; Ernesto, A. Moya-Elizondo.. Endophytic microorganisms associated with reversion of Silverleaf disease symptoms in apple. Phytopathology 2021. [Google Scholar] [CrossRef] [PubMed]
- Xing, J.; Li, P.; Zhang, Y.; Li, J.; Liu, Y.; Lachenbruch, B.; Su, X.; Zhao, J. Fungal pathogens of canker disease trigger canopy dieback in poplar saplings by inducing functional failure of the phloem and cambium and carbon starvation in the xylem. Physiol. Mol. Plant Path. 2020, 112, 101523. [Google Scholar] [CrossRef]
- Bailey, B.; Bae, H.; Strem, M.; Crozier, J.; Thomas, S.; Samuels, G.; Vinyard, B.; Holmes, K. Antibiosis, mycoparasitism, and colonization success for endophytic Trichoderma isolates with biological control potential in Theobroma cacao. Biol. Control 2008, 46, 24–35. [Google Scholar] [CrossRef]
- Grinbergs, D.; France, A.; Chilian, J. Silverleaf disease in apple orchards: Understanding and preventing an increasing problem. In Proceedings of the 11th International IOBC-WPRS Workshop on Pome Fruit Diseases, Jurmala, Latvia, 26–30 June 2017; Stensvand, A., Lennox, C., Wenneker, M., Morocko-Bicevska, I., Rancane, R., Eds.; International Organization for Biological and Integrated Control of Noxious Animals and Plants, West Palearctic Regional Section (IOBC-WPRS): Darmstadt, Germany, 2018; Volume 138, p. 100. [Google Scholar]
- Rivero, M.; Quiroga, M.; Gonzalez, O.; Moraga, L. Plum postharvest manual. INTA, Instituto de Investigaciones Agropecuarias. 2013. Available online: https://inta.gob.ar/sites/default/files/script-tmp-ficha_n_1_-_cosecha.pdf (accessed on 27 April 2021).
Isolate | Species | Host | Geographic Origin | APN1 | ITS GenBank Accession Number | ||
---|---|---|---|---|---|---|---|
HMCi 314 | Chondrostereum purpureum | Prunus domestica subsp. domestica | D’Agen | Colbún | 35°45′01.1592″ S, 71°25′46.4889″ W | Positive | - |
HMCi 325 | Chondrostereum purpureum | Prunus domestica subsp. domestica | D’Agen | Sagrada Familia | 34°59′50.0820″ S, 71°21′48.2976″ W | Positive | - |
HMCi 331 | Chondrostereum purpureum | Prunus domestica subsp. domestica | D’Agen | San Javier | 35°38′54.7944″ S, 71°36′47.9340″ W | Positive | - |
HMCi 341 | Chondrostereum purpureum | Prunus domestica subsp. italica | Reina Claudia | Chillán | 34°58′10.7536″ S, 71°21′14.8464″ W | Positive | - |
HMCi 308 | Chondrostereum purpureum | Prunus domestica subsp. italica | Reina Claudia | San Rafael, Maule | 35°18′37.0044″ S, 71°29′06.5832″ W | Positive | - |
HMCi 290 | Chondrostereum purpureum | Prunus domestica subsp. italica | Reina Claudia | Yungay | 37°07′21.6127″ S, 72°00′02.1028″ W | Positive | - |
HMCi 249 | Chondrostereum purpureum | Prunus salicina | Angeleno | Codegua | 34°01′12.3420″ S, 70°41′50.0352″ W | Positive | - |
HMCi 7 | Chondrostereum purpureum | Prunus salicina | Angeleno | Curicó | 34°58′58.21″ S, 71°16′37.01″ W | Positive | MW938164 |
HMCi 340 | Chondrostereum purpureum | Prunus salicina | Angeleno | Portezuelo | 36°34′43.9356″ S, 72°33′19.7424″ W | Positive | - |
HMCi 121 | Chondrostereum purpureum | Prunus salicina | Black amber | Curicó | 36°37′27.1128″ S, 72°00′27.8532″ W | Positive | MW938165 |
HMCi 272 | Chondrostereum purpureum | Prunus salicina | Black amber | Romeral | 34°57′17.2836″ S, 71°08′11.2560″ W | Positive | - |
HMCi 276 | Chondrostereum purpureum | Prunus salicina | Black amber | Teno | 34°52′39.4149″ S, 71°05′19.0032″ W | Positive | - |
HMCi 168 | Chondrostereum purpureum | Prunus salicina | Fortune | Melipilla | 33°41′09.3696″ S, 71°06′23.7960″ W | Positive | - |
HMCi 253 | Chondrostereum purpureum | Prunus salicina | Friar | Paine | 33°52′11.7156″ S, 70°44′21.5700″ W | Positive | - |
HMCi 148 | Chondrostereum purpureum | Prunus salicina | Larry Ann | Curicó | 34°58′56.0352″ S, 71°16′34.0896″ W | Positive | MW938167 |
HMCi 147 | Chondrostereum purpureum | Prunus salicina | Larry Ann | Rio Claro | 35°12′0.18936″ S, 71°14′36.1140″ W | Positive | MW938166 |
HMCi 157 | Chondrostereum purpureum | Prunus salicina | Larry Ann | Yungay | 37°08′50.452″ S, 71°52′20.673″ W | Positive | - |
Primer | Target | Sense | Sequence (5′-3′) | TM (°C) | Reference |
---|---|---|---|---|---|
ITS1 | ITS | Forward | CTTGGTCATTTAGAGGAAGTAA | 51 | [45] |
ITS4 | ITS | Reverse | TCCTCCGCTTATTGATATGC | 52 | [45] |
APN1-F | IGS | Forward | GCACGGAGAAGGAGAAGATTGGCT | 61.6 | [14] |
APN1-R | IGS | Reverse | TTTCGGACTTTTGGGGCTCATTTCG | 64.7 | [14] |
APM22D13F | SCAR | Forward | GGGGTGACGAGGACGACGGTG | 63.2 | [14] |
APM22D13R | SCAR | Reverse | GGGGTGACGACATTATACTGCAGGTAGTAG | 60 | [14] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grinbergs, D.; Chilian, J.; Hahn, C.; Reyes, M.; Isla, M.; France, A.; Børve, J. Silverleaf (Chondrostereum purpureum) Effects on Japanese Plum (Prunus salicina). Plants 2021, 10, 2777. https://doi.org/10.3390/plants10122777
Grinbergs D, Chilian J, Hahn C, Reyes M, Isla M, France A, Børve J. Silverleaf (Chondrostereum purpureum) Effects on Japanese Plum (Prunus salicina). Plants. 2021; 10(12):2777. https://doi.org/10.3390/plants10122777
Chicago/Turabian StyleGrinbergs, Daina, Javier Chilian, Carla Hahn, Marisol Reyes, Mariana Isla, Andrés France, and Jorunn Børve. 2021. "Silverleaf (Chondrostereum purpureum) Effects on Japanese Plum (Prunus salicina)" Plants 10, no. 12: 2777. https://doi.org/10.3390/plants10122777