Antibacterial Potential of Bacillus amyloliquefaciens GJ1 against Citrus Huanglongbing
Abstract
:1. Introduction
2. Results
2.1. B. amyloliquefaciens GJ1 Increased Photosynthesis
2.2. Parallel Reaction Monitoring Quantification of Three Candidate Proteins
2.3. B. amyloliquefaciens GJ1 Treatment Increases the Content and the Transcript Level of Malic Enzyme and Transketolase
2.4. B. amyloliquefaciens GJ1 Treatment Increases the Transcript Level of Defense-Related Genes
2.5. B. amyloliquefaciens GJ1-flag22 Triggers a ROS Burst
2.6. B. amyloliquefaciens GJ1-flag22 Increases the Content of GSHE, Callose, and the Transcript Level of Defense-Related Genes
2.7. Production of Antibacterial Peptides
3. Discussion
3.1. Bacillus Species as Potential Biocontrol Agents against Citrus Huanglongbing
3.2. Mechanism of B. amyloliquefaciens GJ1 in Preventing and Controlling HLB
4. Materials and Methods
4.1. Plant Materials and Bacterial Growth Condition
4.2. Photosynthetic Parameters, Chlorophyll Content, Soluble Sugar, GSHE, and Callose Content Measurements
4.3. Parallel Reaction Monitoring (PRM) Analysis
4.4. Quantitative Real-Time PCR (qRT-PCR) Analysis
4.5. ROS Production Assays
4.6. Histochemical Staining of ROS
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bové, J.M. Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J. Plant. Pathol. 2006, 88, 7–37. [Google Scholar]
- Wang, N.; Pierson, E.A.; Setubal, J.C.; Xu, J.; Levy, J.G.; Zhang, Y.; Li, J.; Rangel, L.T.; Martins, J., Jr. The Candidatus Liberibacter-Host interface: Insights into pathogenesis mechanisms and disease control. Annu. Rev. Phytopathol. 2017, 55, 451–482. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Trivedi, P. Citrus Huanglongbing: A newly relevant disease presents unprecedented challenges. Phytopathology 2013, 103, 652–665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Folimonova, S.Y.; Robertson, C.J.; Garnsey, S.M.; Gowda, S.; Dawson, W.O. Examination of the responses of different genotypes of Citrus to Huanglongbing (Citrus Greening) under different conditions. Phytopathology 2009, 99, 1346–1354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gottwald, T.R.; Graham, J.H.; Irey, M.S.; McCollum, T.G.; Wood, B.W. Inconsequential effect of nutritional treatments on huanglongbing control, fruit quality, bacterial titer and disease progress. Crop. Protect. 2012, 36, 73–82. [Google Scholar] [CrossRef]
- Clark, K.; Franco, J.Y.; Schwizer, S.; Pang, Z.; Hawara, E.; Liebrand, T.W.H.; Pagliaccia, D.; Zeng, L.; Gurung, F.B.; Wang, P.; et al. An effector from the Huanglongbing-associated pathogen targets citrus proteases. Nat. Commun. 2018, 9, 1718. [Google Scholar] [CrossRef]
- Wang, N. The Citrus Huanglongbing crisis and potential solutions. Mol. Plant. 2019, 12, 607–609. [Google Scholar] [CrossRef]
- Lopez, J.A.; Durborow, S.L. Huanglongbing and the California Citrus industry: A cost comparison of do nothing vs. do something management practices. Tex. J. Agric. Nat. Resour. 2014, 27, 51–68. [Google Scholar]
- Singerman, A.; Burani-Arouca, M.; Futch, S.H. The profitability of new Citrus plantings in Florida in the Era of Huanglongbing. HortScience 2018, 53, 1655–1663. [Google Scholar] [CrossRef] [Green Version]
- Monzo, C.; Stansly, P.A. Economic injury levels for Asian citrus psyllid control in process oranges from mature trees with high incidence of huanglongbing. PLoS ONE 2017, 12, e0175333. [Google Scholar]
- Stansly, P.A.; Arevalo, H.A.; Qureshi, J.A.; Jones, M.M.; Hendricks, K.; Roberts, P.D.; Roka, F.M. Vector control and foliar nutrition to maintain economic sustainability of bearing citrus in Florida groves affected by Huanglongbing. Pest. Manag. Sci. 2014, 70, 415–426. [Google Scholar] [CrossRef] [PubMed]
- Shin, K.; Ascunce, M.S.; Narouei-Khandan, H.A.; Sun, X.; Jones, D.; Kolawole, O.O.; Goss, E.M.; van Bruggen, A.H.C. Effects and side effects of penicillin injection in huanglongbing affected grapefruit trees. Crop. Protect. 2016, 90, 106–116. [Google Scholar] [CrossRef]
- Al-Rimawi, F.; Hijaz, F.; Nehela, Y.; Batuman, O.; Killiny, N. Uptake, translocation, and stability of oxytetracycline and streptomycin in citrus plants. Antibiotics 2019, 8, 196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Killiny, N.; Hijaz, F.; Al-Rimawi, F.; Batuman, O. Translocation of oxytetracycline in citrus plants after root drench and stem delivery. Proc. Fla. State Hort. Soc. 2019, 132, 68–71. [Google Scholar]
- Ehsani, R.; Dewdney, M.; Johnson, E. Controlling HLB with thermotherapy: What have we learned so far? Citrus Ind. 2016, 9, 26–28. [Google Scholar]
- Zhang, M.; Yang, C.; Powell, C.A.; Avery, P.B.; Wang, J.; Huang, Y.; Duan, Y. Field evaluation of integrated management for mitigating Citrus Huanglongbing in Florida. Front. Plant. Sci. 2019, 9, 1890. [Google Scholar]
- Kloepper, J.W.; Lifshitz, R.; Zablotowicz, R.M. Free-living bacterial inocula for enhancing crop productivity. Trends Biotechnol. 1989, 7, 39–44. [Google Scholar]
- Goswami, M.; Deka, S. Plant growth-promoting rhizobacteria-alleviators of abiotic stresses in soil: A review. Pedosphere 2020, 30, 40–61. [Google Scholar] [CrossRef]
- Takishita, Y.; Charron, J.-B.; Smith, D.L. Biocontrol rhizobacterium pseudomonas sp. 23S induces systemic resistance in Tomato (Solanum lycopersicum L.) against Bacterial Canker Clavibacter michiganensis subsp michiganensis. Front. Microbiol. 2018, 9, 2119. [Google Scholar] [CrossRef]
- Zaidi, A.; Khan, M.S.; Ahemad, M.; Oves, M. Plant growth promotion by phosphate solubilizing bacteria. Acta Microbiol. Immunol. Hung. 2009, 56, 263–284. [Google Scholar] [CrossRef]
- Vardharajula, S.; Ali, S.Z.; Grover, M.; Reddy, G.; Bandi, V. Drought-tolerant plant growth promoting Bacillus spp.: Effect on growth, osmolytes, and antioxidant status of maize under drought stress. J. Plant. Interact. 2011, 6, 1–14. [Google Scholar] [CrossRef]
- Subramanian, S.; Smith, D.L. Bacteriocins from the rhizosphere microbiome-from an agriculture perspective. Front. Plant. Sci. 2015, 6, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pieterse, C.M.J.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; van Wees, S.C.M.; Bakker, P.A.H.M. Induced Systemic Resistance by Beneficial Microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, J.; Ding, Y.; Nan, J.; Yang, X.; Sun, L.; Zhao, X.; Jiang, L. Transcriptome sequencing and ITRAQ reveal the detoxification mechanism of Bacillus GJ1, a potential biocontrol agent for Huanglongbing. PLoS ONE 2018, 13, e0200427. [Google Scholar] [CrossRef]
- Koh, E.J.; Zhou, L.; Williams, D.S.; Park, J.; Ding, N.; Duan, Y.P.; Kang, B.H. Callose deposition in the phloem plasmodesmata and inhibition of phloem transport in citrus leaves infected with “Candidatus Liberibacter asiaticus”. Protoplasma 2012, 249, 687–697. [Google Scholar] [CrossRef]
- Bologna, F.P.; Andreo, C.S.; Drincovich, M.F. Escherichia coli malic enzymes: Two isoforms with substantial differences in kinetic properties, metabolic regulation, and structure. J. Bacteriol. 2007, 189, 5937–5946. [Google Scholar] [CrossRef] [Green Version]
- Murphy, D.J.; Walker, D.A. The properties of transketolase from photosynthetic tissue. Planta 1982, 155, 316–320. [Google Scholar] [CrossRef]
- Shi, Q.; Febres, V.J.; Jones, J.B.; Moore, G.A. Responsiveness of different citrus genotypes to the Xanthomonas citri ssp citri-derived pathogen-associated molecular pattern (PAMP) flg22 correlates with resistance to citrus canker. Mol. Plant. Pathol. 2015, 16, 507–520. [Google Scholar] [CrossRef]
- Shi, Q.; Febres, V.J.; Zhang, S.; Yu, F.; McCollum, G.; Hall, D.G.; Moore, G.A.; Stover, E. Identification of gene candidates associated with Huanglongbing tolerance, using ‘Candidatus Liberibacter asiaticus’ flagellin 22 as a proxy to challenge Citrus. Mol. Plant. Microbe Interact. 2018, 31, 200–211. [Google Scholar] [CrossRef]
- Arguelles-Arias, A.; Ongena, M.; Halimi, B.; Lara, Y.; Brans, A.; Joris, B.; Fickers, P. Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microb. Cell Fact. 2009, 8, 63. [Google Scholar] [CrossRef] [Green Version]
- Sharma, R.R.; Singh, D.; Singh, R. Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: A review. Biol. Control. 2009, 50, 205–221. [Google Scholar] [CrossRef]
- Abraham, A.O.; Laing, M.D.; Bower, J.P. Isolation and in vivo screening of yeast and Bacillus antagonists for the control of Penicillium digitatum of citrus fruit. Biol. Control. 2010, 53, 32–38. [Google Scholar]
- Osman, M.S.; Sivakumar, D.; Korsten, L. Effect of biocontrol agent Bacillus amyloliquefaciens and 1-methyl cyclopropene on the control of postharvest diseases and maintenance of fruit quality. Crop. Protect. 2011, 30, 173–178. [Google Scholar] [CrossRef]
- Mahaffee, W.F.; Kloepper, J.W. Temporal changes in the bacterial communities of soil, rhizosphere, and endorhiza associated with field-grown cucumber (Cucumis sativus L.). Microb. Ecol. 1997, 34, 210–223. [Google Scholar] [CrossRef]
- Zhang, M.; Powell, C.A.; Zhou, L.; He, Z.; Stover, E.; Duan, Y. Chemical compounds effective against the citrus Huanglongbing bacterium ‘Candidatus Liberibacter asiaticus’ in planta. Phytopathology 2011, 101, 1097–1103. [Google Scholar] [CrossRef] [Green Version]
- Hu, J.; Wang, N. Evaluation of the Spatiotemporal Dynamics of Oxytetracycline and Its Control Effect Against Citrus Huanglongbing via Trunk Injection. Phytopathology 2016, 106, 1495–1503. [Google Scholar] [CrossRef] [Green Version]
- Gardner, C.L.; da Silva, D.R.; Pagliai, F.A.; Pan, L.; Padgett-Pagliai, K.A.; Blaustein, R.A.; Merli, M.L.; Zhang, D.; Pereira, C.; Teplitski, M.; et al. Assessment of unconventional antimicrobial compounds for the control of ‘Candidatus Liberibacter asiaticus’, the causative agent of citrus greening disease. Sci. Rep. 2020, 10, 5395. [Google Scholar] [CrossRef]
- Mohammadi, P.; Tozlu, E.; Kotan, R.; Kotan, M.S. Potential of some bacteria for biological control of postharvest Citrus green mould caused by Penicillium digitatum. Plant. Prot. Sci. 2017, 53, 134–143. [Google Scholar]
- Leelasuphakul, W.; Hemmanee, P.; Chuenchitt, S. Growth inhibitory properties of Bacillus subtilis strains and their metabolites against the green mold pathogen (Penicillium digitatum Sacc.) of citrus fruit. Postharvest Biol. Technol. 2008, 48, 113–121. [Google Scholar]
- Waewthongrak, W.; Pisuchpen, S.; Leelasuphakul, W. Effect of Bacillus subtilis and chitosan applications on green mold (Penicilium digitatum Sacc.) decay in citrus fruit. Postharvest Biol. Technol. 2015, 99, 44–49. [Google Scholar] [CrossRef]
- Klein, M.N.; da Silva, A.C.; Kupper, K.C. Bacillus subtilis based-formulation for the control of postbloom fruit drop of citrus. World J. Microbiol. Biotechnol. 2016, 32, 205. [Google Scholar] [CrossRef] [PubMed]
- Manjula, K.; Kishore, G.K.; Podile, A.R. Whole cells of Bacillus subtilis AF 1 proved more effective than cell-free and chitinase-based formulations in biological control of citrus fruit rot and groundnut rust. Can. J. Microbiol. 2004, 50, 737–744. [Google Scholar] [CrossRef]
- Daungfu, O.; Youpensuk, S.; Lumyong, S. Endophytic bacteria isolated from citrus plants for biological control of Citrus Canker in Lime plants. Trop. Life Sci. Res. 2019, 30, 73–88. [Google Scholar] [CrossRef] [PubMed]
- Arrebola, E.; Sivakumar, D.; Korsten, L. Effect of volatile compounds produced by Bacillus strains on postharvest decay in citrus. Biol. Control. 2010, 53, 122–128. [Google Scholar] [CrossRef]
- Hong, P.; Hao, W.; Luo, J.; Chen, S.; Hu, M.; Zhong, G. Combination of hot water, Bacillus amyloliquefaciens HF-01 and sodium bicarbonate treatments to control postharvest decay of mandarin fruit. Postharvest Biol. Technol. 2014, 88, 96–102. [Google Scholar] [CrossRef]
- Chen, K.; Tian, Z.; Luo, Y.; Cheng, Y.; Long, C.-A. Antagonistic activity and the mechanism of Bacillus amyloliquefaciens DH-4 against citrus green mold. Phytopathology 2018, 108, 1253–1262. [Google Scholar] [CrossRef] [Green Version]
- Kalai-Grami, L.; Ben Slimane, I.; Mnari-Hattab, M.; Rezgui, S.; Aouani, M.A.; Hajlaoui, M.R.; Limam, F. Protective effect of Bacillus amyloliquefaciens against infections of citrus aurantium seedlings by Phoma tracheiphila. World J. Microbiol. Biotechnol. 2014, 30, 529–538. [Google Scholar] [CrossRef]
- Tian, Z.; Chen, C.; Chen, K.; Liu, P.; Fan, Q.; Zhao, J.; Long, C.-A. Biocontrol and the mechanisms of Bacillus sp. w176 against postharvest green mold in citrus. Postharvest Biol. Technol. 2020, 159, 111022. [Google Scholar] [CrossRef]
- Lucon, C.M.M.; Guzzo, S.D.; de Jesus, C.O.; Pascholati, S.F.; de Goes, A. Postharvest harpin or Bacillus thuringiensis treatments suppress citrus black spot in ‘Valencia’ oranges. Crop. Protect. 2010, 29, 766–772. [Google Scholar] [CrossRef]
- Kim, J.-S.; Sagaram, U.S.; Burns, J.K.; Li, J.-L.; Wang, N. Response of Sweet Orange (Citrus sinensis) to ‘Candidatus Liberibacter asiaticus’ Infection: Microscopy and Microarray Analyses. Phytopathology 2009, 99, 50–57. [Google Scholar] [CrossRef] [Green Version]
- Fu, S.; Shao, J.; Zhou, C.; Hartung, J.S. Transcriptome analysis of sweet orange trees infected with ‘Candidatus Liberibacter asiaticus’ and two strains of Citrus Tristeza Virus. BMC Genomics 2016, 17, 349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, Y.; Zhou, L.; Hall, D.G.; Li, W.; Doddapaneni, H.; Lin, H.; Liu, L.; Vahling, C.M.; Gabriel, D.W.; Williams, K.P.; et al. Complete genome sequence of citrus Huanglongbing bacterium, ‘Candidatus Liberibacter asiaticus’ obtained through metagenomics. Mol. Plant. Microbe Interact. 2009, 22, 1011–1020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albrecht, U.; Bowman, K.D. Gene expression in Citrus sinensis (L.) Osbeck following infection with the bacterial pathogen Candidatus Liberibacter asiaticus causing Huanglongbing in Florida. Plant. Sci. 2008, 175, 291–306. [Google Scholar] [CrossRef]
- Nwugo, C.C.; Duan, Y.; Lin, H. Study on Citrus response to Huanglongbing highlights a down-regulation of defense-related proteins in Lemon Plants upon ‘Ca. Liberibacter asiaticus’ infection. PLoS ONE 2013, 8, e67442. [Google Scholar] [CrossRef] [PubMed]
- Shine, M.B.; Xiao, X.; Kachroo, P.; Kachroo, A. Signaling mechanisms underlying systemic acquired resistance to microbial pathogens. Plant. Sci. 2019, 279, 81–86. [Google Scholar] [CrossRef]
- Tunsagool, P.; Jutidamrongphan, W.; Phaonakrop, N.; Jaresitthikunchai, J.; Roytrakul, S.; Leelasuphakul, W. Insights into stress responses in mandarins triggered by Bacillus subtilis cyclic lipopeptides and exogenous plant hormones upon Penicillium digitatum infection. Plant. Cell Rep. 2019, 38, 559–575. [Google Scholar] [CrossRef]
- Waewthongrak, W.; Leelasuphakul, W.; McCollum, G. Cyclic Lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit. PLoS ONE 2014, 9, e109386. [Google Scholar] [CrossRef]
- Tan, S.; Dong, Y.; Liao, H.; Huang, J.; Song, S.; Xu, Y.; Shen, Q. Antagonistic bacterium Bacillus amyloliquefaciens induces resistance and controls the bacterial wilt of tomato. Pest. Manag. Sci. 2013, 69, 1245–1252. [Google Scholar] [CrossRef]
- Segonzac, C.; Zipfel, C. Activation of plant pattern-recognition receptors by bacteria. Curr. Opin. Microbiol. 2011, 14, 54–61. [Google Scholar] [CrossRef]
- Felix, G.; Duran, J.D.; Volko, S.; Boller, T. Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant. J. 1999, 18, 265–276. [Google Scholar] [CrossRef]
- Gómez-Gómez, L.; Boller, T. FLS2: An LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell 2000, 5, 1003–1011. [Google Scholar] [CrossRef]
- Boller, T.; Felix, G. A Renaissance of elicitors: Perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant. Biol. 2009, 60, 379–406. [Google Scholar] [CrossRef] [PubMed]
- Macho, A.P.; Zipfel, C. Targeting of plant pattern recognition receptor-triggered immunity by bacterial type-III secretion system effectors. Curr. Opin. Microbiol. 2015, 23, 14–22. [Google Scholar] [CrossRef] [PubMed]
- Dimkic, I.; Stankovic, S.; Nisavic, M.; Petkovic, M.; Ristivojevic, P.; Fira, D.; Beric, T. The profile and antimicrobial activity of Bacillus lipopeptide extracts of five potential biocontrol strains. Front. Microbiol. 2017, 8, 925. [Google Scholar] [CrossRef] [Green Version]
- Ongena, M.; Jacques, P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008, 16, 115–125. [Google Scholar] [CrossRef]
- Wei, Q.J.; Liu, Y.Z.; Zhou, G.F.; Li, Q.H.; Yang, C.Q.; Peng, S.A. Overexpression of CsCLCc, a chloride channel gene from Poncirus trifoliata, enhances salt tolerance inArabidopsis. Plant. Mol. Biol. Rep. 2013, 31, 263–268. [Google Scholar] [CrossRef]
- Bartolozzi, F.; Bertazza, G.; Bassi, D.; Cristoferi, G. Simultaneous determination of soluble sugars and organic acids as their trimethylsilyl derivatives in apricot fruits by gas-liquid chromatography. J. Chromatogr. A 1997, 758, 99–107. [Google Scholar] [CrossRef]
- Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano, M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85. [Google Scholar] [CrossRef]
- Wisniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–360. [Google Scholar] [CrossRef]
- Wu, J.; Xu, Z.; Zhang, Y.; Chai, L.; Yi, H.; Deng, X. An integrative analysis of the transcriptome and proteome of the pulp of a spontaneous late-ripening sweet orange mutant and its wild type improves our understanding of fruit ripening in citrus. J. Exp. Bot. 2014, 65, 1651–1671. [Google Scholar] [CrossRef] [Green Version]
Accession | Name | Description | Transcriptome Result | PRM Result |
---|---|---|---|---|
Cs2g07330 | PsbQ | electron transporter | 1.39 | 1.84 |
Cs5g34450 | PsaE | PS1 reaction center subunit III | 1.67 | 2.01 |
Cs5g31180 | PsaD | PSI reaction center subunit II | 1.44 | 1.56 |
Metabolite | Gene | Homology Comparison with B. amylolyticus FZB42 (%) |
---|---|---|
Bacilysin | bacA | 98.56 |
Bacillaene | beaS | 97.80 |
Difficidin | dfnM | 98.10 |
dfnA | 97.73 | |
Bacillibactin | dhbA | 96.89 |
Fengycin | fenA | 95.56 |
fenE | 96.92 | |
IturinA | ItuF1 | 88.60 |
Macrolactin | mlnA | 96.22 |
mlnI | 98.39 | |
Surfactin | srfAA | 94.25 |
srfAD | 98.70 | |
Bacilycin | ywfG | 98.42 |
MrsK2 | 98.61 | |
MrsK2R2 | 99.32 | |
MrsR2 | 97.32 |
Compound | Application Method | Impact on | Reference |
---|---|---|---|
Streptomycin | Greenhouse | Reduction in population density in leaves | [35] |
Penicillin G | Field | Reduction of the titer in leaves | [12] |
Oxytetracycline | Field | The population density in leaves decreased | [36] |
Benzbromarone + tolfenamic acid | Greenhouse | Lower transcription of the CLas 16S rRNA gene was observed | [37] |
Gene | Accession Number | Primer Sequence | Amplification Length (bp) |
---|---|---|---|
GST1 | LOC102614737 | F: GCCCGTTTGTCTCAGTCCAA | 59 |
R: TGCAAATCGACCAAGGTGAA | |||
GAPC2 | LOC102624117 | F: TCTTGCCTGCTTTGAATGGA | 80 |
R: TGTGAGGTCAACCACTGCGACAT | |||
nho 1 | LOC102615775 | F: GAACACAGGTGAGAGGTAGTT | 91 |
R: AGCATAGTTATCGGTGCTTTAG | |||
HSP90 | LOC102578032 | F: TACCCAATTTCCCTCTGGATTG | 97 |
R: CCTCAACTTTACCCTCCTCATC | |||
WRKY 22 | LOC102622218 | F: ACCACAAGTACCACCACAAG | 95 |
R: CTGGTTTGTTCACGGCTAAATG | |||
WRKY 24 | LOC102621617 | F: ACCATCACCACCCAACAAA | 92 |
R: CGGTGCGGAAGATGTAAGAA | |||
WRKY 33 | LOC102608921 | F: CCGGATTGTCCGATGAAGAAA | 98 |
R: GATGTAGGCTTGGGATGATTGT | |||
Cs4g15270 | LOC102622357 | F: CCATGATGGAACTTGAGGGAG | 91 |
R: GAGTGTAAACGACTGGGGAAG | |||
Orange1.1t00226 | LOC102622121 | F: GAAAGCCCTTCCGACATACA | 118 |
R: GTCTGCACTACCACCAAGAA | |||
Actin | LOC102577980 | F: CCAAGCAGCATGAAGATCAA | 101 |
R: ATCTGCTGGAAGGTGCTGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nan, J.; Zhang, S.; Jiang, L. Antibacterial Potential of Bacillus amyloliquefaciens GJ1 against Citrus Huanglongbing. Plants 2021, 10, 261. https://doi.org/10.3390/plants10020261
Nan J, Zhang S, Jiang L. Antibacterial Potential of Bacillus amyloliquefaciens GJ1 against Citrus Huanglongbing. Plants. 2021; 10(2):261. https://doi.org/10.3390/plants10020261
Chicago/Turabian StyleNan, Jing, Shaoran Zhang, and Ling Jiang. 2021. "Antibacterial Potential of Bacillus amyloliquefaciens GJ1 against Citrus Huanglongbing" Plants 10, no. 2: 261. https://doi.org/10.3390/plants10020261