Next Article in Journal
Root Endophytism by Pochonia chlamydosporia Affects Defense-Gene Expression in Leaves of Monocot and Dicot Hosts under Multiple Biotic Interactions
Next Article in Special Issue
DNA Barcode Authentication of Devil’s Claw Herbal Dietary Supplements
Previous Article in Journal
Meta-Analysis of Quantitative Traits Loci (QTL) Identified in Drought Response in Rice (Oryza sativa L.)
Previous Article in Special Issue
Differentiation of Hedyotis diffusa and Common Adulterants Based on Chloroplast Genome Sequencing and DNA Barcoding Markers
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Integrated Approach for Species Identification and Quality Analysis for Labisia pumila Using DNA Barcoding and HPLC

by
Auni Aqilah Ahmad Tarmizi
1,
Alina Wagiran
1,*,
Faezah Mohd Salleh
1,
Lee Suan Chua
2,
Farah Izana Abdullah
2,
Rosnani Hasham
2,3 and
Suraiya Binte Mostafiz
1
1
Department of Biosciences, Faculty of Science, Universiti Teknologi Malaysia, Johor Bahru 81310, Malaysia
2
Institute of Bioproduct Development, Universiti Teknologi Malaysia, Johor Bahru 81310, Malaysia
3
Department of Bioprocess and Polymer Engineering, School of Chemical and Energy Engineering, Faculty of Engineering, Universiti Teknologi Malaysia, Johor Bahru 81310, Malaysia
*
Author to whom correspondence should be addressed.
Plants 2021, 10(4), 717; https://doi.org/10.3390/plants10040717
Submission received: 15 March 2021 / Revised: 26 March 2021 / Accepted: 30 March 2021 / Published: 7 April 2021
(This article belongs to the Special Issue DNA Barcoding for Herbal Medicines)

Abstract

:
Labisia pumila is a precious herb in Southeast Asia that is traditionally used as a health supplement and has been extensively commercialized due to its claimed therapeutic properties in boosting a healthy female reproductive system. Indigenous people used these plants by boiling the leaves; however, in recent years it has been marketed as powdered or capsuled products. Accordingly, accuracy in determination of the authenticity of these modern herbal products has faced great challenges. Lack of authenticity is a public health risk because incorrectly used herbal species can cause adverse effects. Hence, any measures that may aid product authentication would be beneficial. Given the widespread use of Labisia herbal products, the current study focuses on authenticity testing via an integral approach of DNA barcoding and qualitative analysis using HPLC. This study successfully generated DNA reference barcodes (ITS2 and rbcL) for L. pumila var. alata and pumila. The DNA barcode that was generated was then used to identify species of Labisia pumila in herbal medicinal products, while HPLC was utilized to determine their quality. The findings through the synergistic approach (DNA barcode and HPLC) implemented in this study indicate the importance of both methods in providing the strong evidence required for the identification of true species and to examine the authenticity of such herbal medicinal products.

1. Introduction

Herbal medicine consists of herbs, herbal preparations, and mixtures of finished products that contain active ingredients from plant parts or plant materials [1]. In many developed countries, the World Health Organization (WHO) estimates that about 70–80% of the population has used a form of alternative or complementary medicine [1,2]. In Malaysia, many local food supplements and herbal medicines including Labisia pumila-based plants have been commercialized on the market, as the demand has grown over time. As the herbal industry continues to experience growth, quality control must be done. The monograph has been published as a referral standardized operating document for the sourcing of raw material, analytical testing techniques, and safety information [3]. Herbal medicinal products come in various forms, commonly in processed or modified forms (dried material, tablets, powders, capsules, or tablets), thereby presenting a challenge in accurately distinguishing genuine products from fake ones [4]. Consumers often rely on labels of product packages to be informed of their content; however, due to unscrupulous activities, manufacturers may fail to reach the presented quality and efficacy during production. Therefore, the correct identification of such species and their authenticity is vital to ensure their quality and to make them safer for consumption. Intensive tissue culture propagations of Labisia pumila as a high-quality raw product material have been performed [5,6]; however, the market demand exceeds the supply. Several factors contribute to a dwindling of supply such as uncontrolled harvesting activities from the wild, limited cultivation area, and high dependency on imported raw materials. This situation eventually led to the adulteration of raw materials, thus generating poor-quality products. The issue of quality is worsened if no efficient authentication tools are available to monitor the raw material quality and outcome of manufacturing procedures. Hence, the medicinal efficacy of the product may be jeopardized upon entering the market.
The HMPs from L. pumila reportedly benefit consumers in terms of general health maintenance, and they have been used for inner health treatment, easing childbirth, and estrogen replacement therapy for women, as well as other potential treatments for chronic diseases [7,8,9,10,11,12,13] According to the Malaysia National Pharmaceutical Regulatory Agency (2020), most registered Labisia HMPs on the Malaysian market are in the form of capsules (84%), teabags (4%), tablets (3%), emulsions (1%), and bolus (1%), among others. Labisia pumila (family Myrsinaceace) commonly known as Kacip Fatimah (KF) is one of the most famous herbal plants which has a variety of local names [4]. Among the common three varieties, only alata and pumila are the commonly used terms in traditional medicine preparation [7,12,14]. Even though not much information can be found regarding the safety of Labisia products, consumption of Labisia water extract has resulted in unpleasant experiences due to assumedly adverse events [15,16]. Even though no serious adverse effects of Labisia herbal medicinal products for consumption have been reported so far, development of authentication methods is crucial to ensure their safety and efficacy. Various Malaysian government bodies have worked together to develop comprehensive monographs containing specifications for profiling techniques for raw material sourcing until approval [3]. Additionally, the Forest Research Institute Malaysia (FRIM) laboratory provides testing services and acts as an advisor to HMP manufacturers [17].
Chemical fingerprinting techniques such as HPLC have commonly been used for the determination of chemical markers in L. pumila plants. However, tandem LCMS/MS was reported recently for the determination and identification of HMPs of L. pumila var. alata using quercetin and myricetin [18]. A combination of HPLC and infrared (IR) spectroscopy methods was implemented to detect marker compounds in L. pumila plants and HMPs [19]. Several bioactive constituent of L. pumila have been identified, mostly by HPLC in the extract, including flavonoids (rutin, apigenin, kaempferol, naringin, and myricetin) and phenolic compound (gallic acid, caffeic acid, and pyrogallol) [8,20,21,22,23]. Despite the high demand for Labisia product on the market, the efficacy and safety of L. pumila HMPs in long-term usage is highly unclear, since very limited clinical data have been reported in animal studies [24,25]. Usage of chemical fingerprinting has also shown several drawbacks, such as the lack of a specific chemical marker for each herbal species, while mixtures of different plant species in herbal medicine products may gave different results due to different chemical compounds. The different batches of raw material sources used might affect their quality due to geographical location, storage conditions, or processing methods [26], posing difficulties for proper chemical analyses and objective judgment [27], which contribute to unreliable data. In addition, mixtures of several plant species may exhibit different chemical markers, and they may not be species-specific. Safety issues related to HMPs have received considerable attention according to several reports [28,29,30]; thus, effective detection methods are urgently required for more comprehensive identification.
The foundation of an authenticity method based on DNA has been globally used since the development of DNA barcoding, a powerful tool in molecular biology [31,32]. These techniques have been used until now for the detection of various families of medicinal plants, as well as herbal medicine product authentication [33,34]. The DNA barcode was simplified as a unique identifier, specifically for each plant species. These methods can accurately discriminate the same species with similar morphological and chemical compounds, as well as exhibit repeatability. In the last 10 years, DNA barcoding methods have been rapidly applied worldwide for the identification of various species; however, the lack of standard reference material (SRM) may have hindered the progress of DNA barcoding, including for L. pumila. Therefore, the present study was undertaken to investigate the potential of DNA barcoding for L. pumila varieties, with the hope of enriching the GenBank database. Then, these DNA barcodes (ITS2 and rbcL) were used for the identification of L. pumila in HMPs, while HPLC were performed for their quality assessment. Therefore, this study comprehensively applied dual methods for authentication to reveal the extent of adulteration existing in these herbal medicine products.

2. Results

2.1. L. pumila DNA Reference Barcode Generation

In the present study, the sequencing result of the amplified ITS2 revealed that the length of the generated L. pumila ITS2 was 291 bp. The analyzed sequences of the barcode region also revealed that the ITS2 barcode region showed a high degree of identity, which was 98.79% similar to the GenBank hit generated [35] of L. pumila var. lanceolata (MH766971.1) from BLASTn (Basic Local Alignment Search Tool analysis (Figure 1). This was the only comparable ITS2 reference sequence data from L. pumila plant that was previously deposited in the GenBank database. Since the size of the ITS2 barcode of L. pumila var. lanceolata (MH766971.1) was bigger (338 bp) than the L. pumila ITS2 barcode (291 bp) generated in this study, the query coverage between sequences was much lower (56%) due to the position of overlapping regions of ITS2 barcodes.
In this study, the sequencing result of the amplified rbcL revealed that the length generated was 523 bp. The analyzed sequences of the barcode region also revealed that the rbcL showed a high degree of identity with other plants of the L. pumila species but differences in varieties after BLASTn with GenBank (Figure 1). The BLASTn result revealed that the L. pumila rbcL barcode regions generated from this study were 100% similar to rbcL sequences of L. pumila var. lanceolata (MH749147.1) and L. pumila (MH069794.1) previously generated [35]. All the sequences of rbcL and ITS2 barcodes were successfully deposited into the GenBank database with the following references: MK249864.1 (LPPG), MK249865.1 (LPPR), and MK249863.1 (LPA); MH838010.1 (LPPG), MH838008.1 (LPPR), and MH828448.1 (LPA) respectively.

2.2. Species Identification of L. pumila HMPs via DNA Barcoding

In this study, amplification of DNA barcodes was successfully performed using only six products (6/15). According to DNA barcoding sequence analysis, 20% of HMPs were considered authentic, while 13% of them were substituted, and the remaining 7% were considered contaminated. The other nine samples representing 60% (Kacip Fatimah product 4 (KFP4), KFP5, KFP6, KFP7, KFP8, KFP9, KFP10, KFP14, and KFP15) were not amplifiable due to the absence or low concentration of DNA recovery caused by degradation. These samples were declared as “no sequence” (NS), as described in Table 1. The sequencing analysis showed that the ITS2 sequences generated for the L. pumila HMPs ranged from 290–339 bp, while those for rbcL the sequences generated were in the range of 523–552 bp, comparable to the sequence length deposited by [35,36]. The BLASTn results of the rbcL barcode region revealed that three of the tested HMPs (KFP1, KFP11, and KFP13) showed 100% BLAST search hits with the correct species of L. pumila var. pumila (MK249865.1) (Table 1). However, KFP2 showed the highest identity to Nigella arvensis (MG946921.1), while both KFP3 and KFP12 matched to Camellia oleifera (MF541730.2) with 99% to 100% similarities, respectively.
The BLASTn results of the ITS2 barcode region revealed that, among all six of the L. pumila HMPs, four samples (KFP1, KFP11, KFP12, and KFP13) had 100% similarities to L. pumila var. pumila (MH838010.1). The other HMPs (KFP2 and KFP3) were identified as having been substituted with other plants species (Anethum graveolens and Cuminum cyminum). On the contrary, use of the rbcL barcode in KFP12 showed contamination because of presence other species not declared on the packaging label. The rbcL barcode showed 100% similarity to Camellia oleifera (MH838010.1). However, the correct species, Labisia pumila was detected when using the ITS2 barcode. Substitution was detected in KFP2 and KFP3 after BLASTn analysis using ITS2 and rbcL. The use of rbcL and ITS2 DNA barcodes showed 99% and 98% similarity to two other species: Anethum graveolens (KM210329.1) and Nigella arvensis (accession number MG946921.1) respectively. The KFP3 teabag product was found to contain different plant species (Cuminum cyminum; accession number KX108698) when using ITS2 as the DNA barcode. Application of the rbcL barcode revealed the nonmatching species intended for KFA3. Failure in the amplification of DNA barcodes from other samples posed a challenging issue due to insufficient genomic DNA (gDNA) recovered from degraded samples of HMPs.

2.3. HPLC Fingerprinting of the L. pumila HMPs

In this work, six authentic HMPs from DNA barcoding studies were further analyzed quantitatively for the presence gallic acid and rutin. Gallic acid is a bioactive marker compound that is abundantly found in L. pumila [35,36,37]. In order to confirm that the analytical method employed was reliable, it was validated for linearity using calibration curves. The calibration curve was linear over the concentration range of 2–400 mg/L for gallic acid producing a linear regression equation of y = 76,966x − 18,004, where x is the concentration of gallic acid (mg/L) and y is the corresponding peak area. Meanwhile, the calibration curve of rutin was linear within the equation y = 33,615x − 11,476 over a concentration range of 0.2–10 mg/L. The correlation coefficients (r2) for gallic acid (Figure S1) and rutin (Figure S2) were found to be 0.9993 and 0.9843, respectively.
The detection of gallic acid and rutin in L. pumila HMPs was carried out according to the retention time of the standard and the L. pumila plant extracts. The spectral peaks of gallic acid and rutin were at 280 and 357 nm, respectively. The total run time for gallic acid detection was 40 min, and the peak was detected at a retention time of 3.719 min, similar to that of the three L. pumila leaf extracts and all six tested HMPs (KFP1, KFP2, KFP3, KFP11, KFP12, and KFP13). The peak patterns of L. pumila var. alata (LPA) compared to L. pumila var. pumila (LPPG), and L. pumila var. pumila (LPPR) as seen in Figure 2B–D showed a distinct single peak of gallic acid compound comparable to the gallic acid standard in Figure 1A. However, as seen in Figure 2B, L. pumila var. alata (LPA) showed a smaller peak, as detected, and it was shown with a very low concentration of 3.58 mg/L of gallic acid quantified from the analysis.
The HPLC chromatograms in Figure 2 show that all six tested HMPs samples (100%), regardless of whether they were considered authentic, substituted (KFP2 and KFP3), or contaminated (KFP12) on the basis of DNA barcoding, contained the expected gallic acid chemical marker at the expected retention time when compared to the gallic acid standard in Figure 2A. Gallic acid as detected in substituted HMPs (KFP2 and KFP3) proving that the compound is not unique to L. pumila and might also be present in other species such as Anethum graveolens, Nigella arvensis, Cuminum cyminum, and Camellia oleifera. These other species were identified using the DNA barcoding method (Table 1). In the present study, detection of another compound, rutin, was employed to improve the detection of bioactive compounds. A total run time of 26 min was conducted for rutin detection, and the compound peak was detected at a retention time of 6.297 min. The results of the chromatogram in Figure 3 display only L. pumila var. alata (LPA), whereby five of the tested HMPs (KFP2, KFP3, KFP11, KFP12, and KFP13) had a rutin peak. Short and small separated peaks were also observed in the samples with rutin detection, indicating that the concentration was very low. The HPLC analysis implies that the contents of gallic acid and rutin, as seen in Table 2, varied between the samples. The concentration of gallic acid was highest in the red leaf extract of L. pumila var. pumila (LPPR) at a concentration of 113.93 mg/L, followed by green leaves of L. pumila var. pumila (LPPG) at 47.10 mg/L, and lowest for L. pumila var. alata (LPA) at 3.58 mg/L. Meanwhile, the concentration of gallic acid in all six tested HMP (KFP1, KFP2, KFP3, KFP11, KFP12, and KFP13) samples ranged from 2.23–132.17 mg/L. Low concentrations of rutin were detected for L. pumila var. alata (LPA) at 1.26 mg/L, whereas, for the HMPs (KFP2, KFP3, KFP11, KFP12, and KFP13), the concentrations ranged from 0.56–7.40 mg/L.

3. Discussion

3.1. The Establishment of L. pumila DNA Barcodes and HMP Authentication

Considering the morphological distinctness between the two varieties of L. pumila (var. alata and var. pumila) sequence analyzed in this work, the present study contributes to the GenBank data. Novel high-quality bidirectional barcodes for the two varieties of Labisia var. alata (LPA) and var. pumila (LPPG, LPPR) were successfully amplified using rbcL (523bp) and ITS2 sequences (291bp). The present study proves the enrichment of GenBank databases with the three additional sequences of L. pumila for ITS2 and another three for rbcL. The studies revealed a very low success rate of amplification (40%) regardless of DNA barcodes applied for HMPs. According to Table 1, amplifiable barcodes were from KFP1, KFP2, KFP3, KFP11, KFP12, and KFP13(40%), while 60% could not be barcoded even after several amplification attempts. Thus, this failure might be due to the type of HMP (capsule), which may contain high amounts of secondary metabolites from different varieties with additional formulation content such as excipients (fillers, lubricants, pigments, diluents, glidants, stabilizers, and binders) [10,17,33]. Previous reports also stated that successful DNA amplification from botanical materials (teas and roots) was higher compared to pharmaceutical formulations capsules, caplets, and tablets [38]. According to the phylogenetic neighbor-joining (NJ) analysis of rbcL HMPs in Figure 4, three amplified barcodes (KFP1, KFP11, and KFP13) formed a strongly supported monophyletic clade of bootstrap (BS) = 100 with L. pumila reference sequences generated in this work (MK249865.1, MK249864.1, MK249863.1) and other hits of similar species but different variety from GenBank (MH069794.1 and MH749147.1). In addition, NJ analysis of the ITS2 barcode region in Figure 5 also revealed that four of the tested L. pumila HMPs (KFP1, KFP11, KFP12, and KFP13) formed a strongly supported monophyletic clade (BS = 99) with L. pumila reference sequences (MH838008.1, MH828448.1, and MH838010.1) established from this work and other reference sequences retrieved from the GenBank database, i.e., L. pumila var. lanceolata (MH766971.1). The results obtained from BLASTn analysis supported by NJ analysis indicated that three of the tested HMPs were truly authentic. Results showed that the other two L. pumila HMPs (KFP2 and KFP3) nested outside the L. pumila clade and clustered with Anethum graveolens for KFP2 and Cuminum cyminum for KFP3, suggesting substitution.
Sequence analysis of the ITS2 DNA barcode from KFP2 was revealed to contain Anethum graveolens and Nigella arvensis instead of L. pumila, confirming substitution. Anethum graveolens is usually used as a spice, while Nigella arvensis is known as wild fennel [39,40]. The content of KFP3 is believed to have been substituted with spices Cuminum cyminum and Camellia oleifera when ITS2 and rbcL were used, respectively. Undeclared plant species (Camellia oleifera) were detected, indicating contamination for KFP12. These results show that adulteration and ingredient substitution apparently occurred due to the addition of inferior species, suggesting fraudulent activities by manufacturers. In terms of efficiency, both rbcL and ITS2 barcodes were equally ideal markers for the authentication of L. pumila HMPs. Using BLASTn and NJ tree criteria, a certain extent of authenticity and fraudulence was detected for L. pumila HMPs samples.

3.2. HPLC Fingerprinting of L. pumila HMPs

The presence of a chemical marker is not sufficient to validate herbal medicine preparation; however, a minimal concentration of the chemical marker must be present [41]. In order to validate the first screening step for HMP authentication using DNA barcoding, further HPLC analysis was employed to detect gallic acid and rutin in HMPs. Gallic acid (GA) is a chemical constituent that primarily acts as an antioxidant and is found abundantly in all three L. pumila varieties. Previously, evidence on the antioxidant activities of gallic acid was restricted to results from in vitro experimentations with different human cell lines and blood cells [30,42]. However, further studies conducted on animals showed that it induces antioxidant enzymes and protects the liver against the effects of cytotoxicity [43,44,45]. On the other hand, rutin is a flavonol that also demonstrates several important pharmacological effects such as antioxidant, anticarcinogenic, vasoprotective, cytoprotective, neuroprotective, and cardioprotective activities. According to the results of the HPLC chromatogram shown in Figure 1, the gallic acid compound was detected at Rt 3.719 min and observed at a single peak in L. pumila var. alata (LPA), L. pumila var. pumila (LPPG), and L. pumila var. pumila (LPPR). However, additional peaks were also observed in the later elution, which might indicate the presence of other unidentified compounds such as aromatic and hydrophobic compounds. For commercialization purposes, L. pumila var. pumila and L. pumila var. alata are commonly used by manufacturers in HMP production [44]. Figure 1 shows that rutin was detected at Rt 6.297 min. Interestingly, it can be observed in Figure 1b that rutin was only detected in the L. pumila var. alata extract at Rt 6.282 min. In the case of L. pumila HMPs, only five of the tested samples (KFP2, KFP3, KFP11, KFP12, and KFP13) were found to contain rutin.
The HPLC analysis implied that the HMPs might comprise two or more plant species, and these plants might possess the same chemical marker detectable via chemical analysis without accurately identifying to which species they belong. The weakness of this might be misdiagnosis due to limitations and a lack of expertise. The results of HPLC may vary because of external factors such as temperature, humidity, and soil composition [24]. However, this does not corroborate the authenticity of these HMPs, as the presence of a bioactive compound marker may not indicate the presence of the label-declared plant species. The peaks observed in each chromatogram (Figure 1 and Figure 2) were also different for each L. pumila HMP (KFP1 was monoherbal, while the others were polyherbal). However, multiple peaks showed the possible presence of other compounds due to the complexity of the product content. According to Table 2, gallic acid concentrations were found highest in L. pumila var. pumila (LPPR) and KFP2 at 113.93 mg/L and 132.17 mg/L, respectively. Meanwhile, rutin was found at the highest level in the KFP3 sample at 7.40 mg/L. The table also shows that, for product KFP1, without detection of one of the tested bioactive compounds, this might lessen the product efficacy when being consumed. Previous work found that the threshold concentration for no adverse effects of gallic acid in rodents is 120 mg/kg, a dose equivalent to 2.9 g/day in a 70 kg man [45]. In the case of rutin, previous studies showed that data related to the compound’s potential toxicity support its safety as a dietary supplement with an intake range of 5 mg to 40 mg of rutin per day. Hence, the concentrations found in products were already lower than the suggested amounts to provide enough of a therapeutic effect for the consumer. Larger-scale analysis is required in the determination of a GA and rutin dosage standard, which should be extensively studied at the clinical level to establish an effective dosage standard for human consumption. High-added-value bioactive compounds are being actively extracted and used as HMP active ingredients, such as GA, which currently attracts substantial interest thanks to its powerful antioxidant properties. However, in the case of polyherbal preparations, the pharmacological effects of a certain compound might derive from all or some of the species listed. Since KFP2, KFP3, KFP11, KFP12, and KFP13 (Table 3) are known to contain various polyherbals listed in the ingredients list, it can be suggested that the detection of galic acid and rutin might not have solely been from the L. pumila plant. For instance, KFP2 is known to contain Quercus infectoria and Parameria polyneura. Detection of GA and rutin compounds for Quercus infectoria was reported; however, no data are available for Parameria polyneura [46]. KFP3 is known to contain Pueraria mirifica and Camellia sinensis (black tea leaves), in which gallic acid and rutin compounds have previously been detected [47,48].
The likelihood of KFP3 and KFP11 containing gallic acid and rutin compounds is higher due to Camellia sinensis (black tea leaves), while this is the case with Pueraria mirifica in KFP12. KFP13 also features a similar pattern due to Chamaemelum nobile that was reported to contain both gallic acid and rutin compounds [48]. The presence of other plant species in the products showed potential adulterations or substitutions in L. pumila HMPs despite the label claiming L. pumila as the active ingredient. The combination methods for L. pumila HMP authentication using DNA barcoding and HPLC analysis revealed that certain results were found to correlate with one another. This was shown in the three tested samples (KFP1, KFP11, and KFP13) identified as authentic using DNA barcoding and gallic acid measurements.
Usage of the dual methods of DNA barcoding and chemical analysis (HPLC) is, thus, beneficial in screening the authenticity and quality of HMPs. Previous reports showed that a combination of DNA barcoding and HPLC successfully identified five Fritillariae bulbus species from TCM (Traditional Chinese Medicine) and its effective chemical constituents [49]. The authenticity of Eurycoma longifolia HMPs has been tested by DNA barcoding using the ITS2 marker, and its quality was verified using HPLC [50]. The quality of the famous Curcuma longa L. sold on the Chinese market was also assessed with DNA barcoding by discriminating the species using the ITS/LSU D1/D3 marker and HPLC to determine the chemical compositions [51]. Previous reports successfully evaluated the quality and species of Phellodendri cortex using DNA barcoding with ITS and psbA-trnH, as well as HPLC fingerprinting [52,53]. The use of dual authentication methods (DNA barcoding and HPLC) for bigger datasets of 257 samples from the Brazilian market revealed a high level of substitution (71%) [41]. The present study showed that chemical methods cannot distinguish species that have similar chemical markers, possibly misidentifying the sources of raw materials, consistent with the findings from other researchers [3,52]. In summary, the present work showed the establishment of molecular analysis and chemical fingerprinting methods for discriminating Labisia herbal medicinal products. The results reveal that DNA barcoding overcomes the limitation of HPLC fingerprinting, potentiating its use for the accurate and scientific confirmation of herbal identities in medicinal materials from multiple sources. Nevertheless, the DNA barcoding approach presented here has a limiting factor in that it is unable to retrieve high-quality gDNA from several herbal medicinal products after several attempts, which are then deemed not amplifiable. The use of a normal PCR mixture for degraded DNA might not be suitable for severely degraded DNA. Therefore, we proposed a high-fidelity PCR mixture for severely degraded gDNA in the future. Once the high-quality gDNA is obtained, the use of a mini barcode (less than 200 bp) may be beneficial. There are no standardized chemical markers specifically for L. pumila; thus, the quality assessment of mixed HMPs might give misleading results. Calibration and development methods also take a longer time compared to DNA barcoding.

4. Materials and Methods

4.1. Collection of Plant Samples and Herbal Medicinal Products

The L. pumila plants (var. alata and var. pumila) were collected from Agriculture Department, Parit Botak, Batu Pahat, Johor and sent to the Forest Research Institute Malaysia (FRIM), Kepong for species identification (Tables S1 and S2, Supplementary Materials). In this work, two morphologically different var. pumila with green and red leaves were verified as PID 250817-17 (LPPG) and PID 260817-17 (LPPR), respectively. L. pumila var. alata (LPA) was verified as PID 270817-17. In the present study, 15 HMPs (labeled as KFP) consisting of teabags and capsules were purchased from various retail shops in Johor, Malaysia and through an online website.

4.2. Genomic DNA Extraction, PCR Amplification, and Sequencing

Approximately 100 mg of fresh leaves and herbal medicinal products (HMPs) in different forms (approximately 150 mg) were extracted using a NucleoSpin Plant II Kit (Macherey-Nagel, Düren, Germany). The yield and purity of the gDNA extracted were analyzed using a spectrophotometric nanodrop with an absorbance ratio (A260/280). The quality of gDNA extracted from the plant and HMPs was examined on 1% (w/v) agarose gel electrophoresis. The high-quality genomic data were then used for PCR amplification. Amplification of the chloroplast barcode of ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) and nuclear barcode internal transcribed spacer 2 (ITS2) genes were carried out on a MJ Mini™ Thermal Cycler from Bio-Rad (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The gDNA template (50–100 ng/µL) was added to the PCR mixture containing 5 µL of 5× PCR buffer, 2 µL of MgCl2, 1 µL each of forward and reverse primers (10 mM), 0.4 µL of dNTP(deoxyribonucleotide triphosphate) mix, 0.625 U of Taq DNA Polymerase (Promega, Madison, WI, USA), and sterile distilled water. The primers used in the PCR amplification of both barcode regions were rbcL_F ATGTCACCACAAACAGAGACTAAAGC [54], rbcL_R GTAAAATCAAGTCCACCRCG (Kress and Erickson, 2007), and ITS2_F GGGGCGGATATTGGCCTCCCCTTGC, ITS2_R GACGCTTCTCCAGACTACAAT [28]. The PCR amplification profile for rbcL region was as follows: 95 °C for 2 min, followed by 30 cycles at 95 °C for 1 min, 57 °C for 1 min, 72 °C for 1 min, and a final elongation step at 72 °C for 5 min. Next, for ITS2, the amplification was programmed as follows: 95 °C for 2 min, followed by 30 cycles at 95 °C for 1 min, 57 °C for 15 s, 72 °C for 1 min, and a final elongation step at 72 °C for 5 min. The PCR products were examined on 2% (w/v) agarose gel electrophoresis. The negative control reaction with no gDNA template was included in all experiments to ensure that the PCR mixture was free from contamination. Successfully amplified barcodes were sent to Apical Scientific Sdn. Bhd. (Seri Kembangan, Selangor, Malaysia) for bidirectional sequencing using an ABI3730xl Genetic Analyzer (Applied Biosystem, Foster City, CA, USA).

4.3. DNA Sequencing Analysis

To generate standard references barcodes, DNA barcode regions were trimmed and edited using the BioEdit software (version 7.2.5). The generated sequences were then submitted to BLAST in the GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 5 December 2020) for identification of a closely related species match. The sequences generated along with the selected closely matched sequences in the BLASTn search were downloaded in FASTA format and included in the analysis. All novel SRM sequences were subsequently deposited into National Center of Biotechnology Information (NCBI) database. The HMP authenticity was assessed by two criteria: 97% top match or above, and neighbor-joining (NJ) method based on the Kimura two-parameter model (K2P) evaluation using 1000 bootstrap (BS) replicates. The HMPs containing Labisia were considered “authentic” if a DNA barcode matched to the species. However, they were considered “substituted” if other species of DNA barcodes were found other than those labeled on the HMP with no barcode detected for the main ingredient. The HMP was considered “contaminated” if a DNA barcode was found other than that on the HMP packaging label, in addition to the authentic barcode. Lastly, the HMP was considered “no sequence” (NS) if the DNA was unable to be retrieved from the tested HMP [29,54].

4.4. Chemicals and Reagents for HPLC Analysis

To determine the presence and concentration of bioactive markers in the L. pumila leaves and HMP extracts, an HPLC chromatographic fingerprint analysis was performed. The stock concentration of reference standards gallic acid (Sigma-Aldrich) and rutin (Sigma-Aldrich) were separately prepared, and working standard solutions were produced before calibration testing. Gallic acid was further diluted to produce working standard solutions with concentrations in parts per million (ppm) of 400 ppm, 200 ppm, 100 ppm, 80 ppm, 20 ppm, and 2 ppm. Meanwhile, rutin was also prepared at concentrations of 10 ppm, 8 ppm, 5 ppm, 2 ppm and 0.2 ppm. The ppm unit is convertible to milligrams per liter (mg/L). All stock and working solutions were stored at 4 °C prior to HPLC analysis.

4.5. Preparation of L. pumila Leaves and HMP Extracts

The fresh leaves of L. pumila were oven-dried for 2 weeks at 45 °C and cut into very small pieces at a size of approximately 1 cm before preparation of the chromatographic analysis. Crude extracts were obtained from the leaves. Two grams of the dried L. pumila was accurately weighed and added into a reflux system containing 80 mL of boiled ethanol 70% (v/v) for 1 h. Using Whatman No. 1 filter paper, the infusion was then filtered and concentrated using a rotary evaporator (IKA® HRC 2 basic) at 50 °C. The concentrated filtrate was further dried in a freeze-drier (Christ) to form a powder. The L. pumila crude extract was stored at −20 °C in a freezer for subsequent analysis [55]. Approximately 250 mg L. pumila HMP capsules were accurately weighed and dissolved in 10 mL of HPLC-grade methanol. The methanol solution was vortexed and ultrasonically extracted for 15 min at room temperature in order to ensure the complete extraction of bioactive compounds. The sample solution was filtered through a 0.45 µm syringe filter (Sartorius) prior to HPLC analysis. For the teabag samples, the extraction was conducted as reported by [56,57,58]. Briefly, 250 mg of teabag contents were placed into a 100 mL conical flask containing 10 mL of ethanol 70% (v/v) which was brought to boiling point for 5 min. The sample solution was then allowed to cool before centrifuging for 10 min at 14,000 rpm at 1 °C. The supernatant was filtered through a 0.45 µm syringe filter (Sartorius) before HPLC injection.

4.6. Quantification of Gallic Acid and Rutin in L. pumila Leaves and HMP Extracts

HPLC analysis was performed at the Institute of Bioproduct Laboratory, UTM, using a Waters Alliance 2690 HPLC equipped with an ultraviolet (UV) detector [59]. Chromatographic separation was carried out using a Luna® C18 column (150 × 4.6 mm2, 5 µm). The chromatographic conditions were different for gallic acid and rutin. The mobile phase for gallic acid comprised acetonitrile and 3% phosphoric acid with a flow rate of 0.7 mL/min. Meanwhile, the conditions for rutin analysis comprised acetonitrile and 0.5% acetic acid at a similar flow rate of 0.7 ml/min. A volume of 20 µL of each sample was injected into the HPLC system, and the run times for gallic acid and rutin were maintained for 40 min and 26 min, respectively, throughout the analysis. The photodiode array detector (PDA) wavelengths were set at 280 nm for gallic acid and 357 nm for rutin. The linear regression equations obtained from gallic acid and rutin standard curves were applied to calculate the concentrations of both compounds in the L. pumila HMPs. This was also used to calculate the concentration of the standards in the plant extracts. The peak areas corresponding to gallic acid and rutin were assigned by comparing their retention times with those of the reference standard [60].

5. Conclusions

The present work contributes to the enrichment of reference barcodes for another two varieties of L. pumila. New molecular and chemical analysis methods were also established for distinguishing genuine HMPs containing Labisia spp. The results revealed that comprehensive and dual authentication methods strengthened the identification methods of Labisia species. The unique DNA barcodes generated in this study can be used for quality control and authentication of Labisia HMPs in the herbal industry.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/plants10040717/s1, Table S1. The observable fresh and dried samples of L. pumila plants; Table S2. The observable contents of L. pumila HMPs; Figure S1. Calibration curve of gallic acid; Figure S2. Calibration curve of rutin.

Author Contributions

Conceptualization, A.W., F.M.S., L.S.C. and R.H.; investigation, A.A.A.T. and F.I.A.; methodology, F.I.A., L.S.C. and A.A.A.T.; supervision, F.M.S. and A.W.; writing—original draft, A.A.A.T. and A.W.; writing—review and editing, A.A.A.T., A.W., F.M.S., R.H. and S.B.M. All authors have read and agreed to the published version of the manuscript.

Funding

This project was financially sponsored by the Universiti Teknologi Malaysia (UTM) under a GUP-Tier 1 Grant (Q.J130000.2545.18H17) and UTM Transdisciplinary Research Grant Q.J130000.3554.05G69.

Acknowledgments

We are grateful to the Plant Biotechnology Laboratory, Department of Biosciences, Faculty of Science, Universiti Teknologi Malaysia for the facilities. HPLC analysis was conducted at the Metabolite Profiling Laboratory, Institute of Bioproduct Development, Universiti Teknologi Malaysia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Herbal Medicine Research Center. Compedium of Medicinal Plant S Used in Malaysia; IMR: Kuala Lumpur, Malaysia, 2002; Volume 1. [Google Scholar]
  2. World Health Organization (WHO). Traditional Medicine. Available online: http://Www.Wpro.Who.Int/China/Mediacentre/Factsheets/Traditional_Medicine/En/.2021 (accessed on 25 February 2021).
  3. Tan, T.Y.C.; Lee, J.C.; Mohd Yusof, N.A.; Teh, B.P.; Syed Mohamed, A.F. Malaysian Herbal Monograph Development and Challenges. J. Herb. Med. 2020, 23, 100380. [Google Scholar] [CrossRef]
  4. Sunarno, B. Revision of The Genus Labisia (Myrsinaceae). Blumea 2005, 50, 579–597. [Google Scholar] [CrossRef] [Green Version]
  5. Samsul Bahari, S.N.; Md Ariff, F.F.; Zaki, M. Propagation of Five Yeilding Clones of Labisia pumila var alata and Evaluation of Their Growth Performance at Nursery Stages. Int. J. Agric. Res. 2014, 3, 121–125. [Google Scholar]
  6. Samsul Bahari, S.N.; Md Ariff, F.F.; Saffie, N. Evaluation of Different Cutting Shape and Prunning Techniques of Root and Shoot Production of Labisia pumila. J. Agric. Biotechol. 2019, 10, 10–16. [Google Scholar]
  7. Abdul Kadir, A.; Nik Husain, N.H.; Wan Bebakar, W.M.; Mohd, D.M.; Wan Mohammad, W.M.Z.; Hassan, I.I.; Shukor, N.; Kamarudddin, N.A.; Wan Mohamud, W.M. The Effect of Labisia pumila var alata on Postmenopousal Women: A Pilot Study. Evid. Based Complementary Altern. Med. 2012. [Google Scholar] [CrossRef] [Green Version]
  8. Chua, L.S.; Lee, S.Y.; Abdullah, N.; Sarmidi, M.R. Review on Labisia pumila (Kacip Fatimah): Bioactive Phytochemicals and Skin Collagen Synthesis Promoting Herb. Fitoterapia 2012, 83, 1322–1335. [Google Scholar] [CrossRef] [PubMed]
  9. Nadia, M.E.; Norazlina, M.; Isa, N.M.; Norliza, M.; Ima Nirwana, S. The Anti-Inflammatory, Phytoestrogenic, And Antioxidative Role Of Labisia pumila In Prevention Of Postmenopausal Osteoporosis. Adv. Pharmacol. Sci. 2012. [Google Scholar] [CrossRef] [Green Version]
  10. Booker, A.; Johnston, D.; Heinrich, M. Value Chains of Herbal Medicines-Research Needs and Key Challenges in the Context of Ethnopharmacology. J. Ethnopharmacol. 2012, 140, 624–633. [Google Scholar] [CrossRef] [Green Version]
  11. Nik Hussain, N.H.; Abdul Kadir, A. The Potential Role of Labisia pumila in the Preventation and Treatment of Chronic Diseases. J. Food Res. 2013, 2, 55–60. [Google Scholar] [CrossRef] [Green Version]
  12. Stone, B.C. Notes on Genus Labisia Lindl (Myrisinaceae). Malay. Natl. J. 1999, 42, 43–51. [Google Scholar]
  13. Singh, G.D.; Singh, I.; Ganjoo, M.; Youssouf, M.S.; Koul, A.; Sharma, R.; Singh, S.; Sangwan, P.L.; Koul, S.; Ahamad, D.B.; et al. Sub-Acute Toxicity Evaluation of an Aques Extract of Labisia pumila. Malays. Herb. Food Chem. Toxicol. 2009, 47, 2661–2665. [Google Scholar] [CrossRef]
  14. Jamal, J.A.; Houghton, P.J.; Milligan, S.R.; Jantan, I. The Oestrogenic And Cytotoxic Effects of the Extracts of Labisia pumila var. alata and Labisia pumila var. Pumila in vitro. Malays. J. Med. Health Sci. 2003, 1, 53–60. [Google Scholar]
  15. George, A.; Wilson, D.; Abas, A.; Evans, M. Safety and Efficacy of Labisia pumila var alata Water Extract on Sexual Well Being and Lipid Profile of Pre-and Postmenopausal Women; A Randomized Double-Blind Pilot Study. Afr. J. Biotechnol. 2014, 13, 768–777. [Google Scholar]
  16. Saleh, M.S.; Saharuddin, S.; Sarker, M.M.R.; Ming, L.C. Safety and Efficacry of Labisia Containig Products. Arch. Pharm. Pract. 2016, 7, S53–S56. [Google Scholar]
  17. Molina, J.; Sherpa, C.; Ng, J.; Sonam, T.; Stuhr, N. DNA Barcoding of Online Herbal Supplements: Crowd-Sourcing Pharmacovigilance in High School. Open Life Sci. 2018, 13, 48–55. [Google Scholar] [CrossRef] [PubMed]
  18. Abdull Latif, N.; Chua, L.S.; Sarmidi, M.R.; Ware, I.; Abdul Rashid, S.N.A.; Yahayau, M. Liquid Chromatography Tandem Mass Spectrometry For The Detection Of Quercetin-3-O-Rutinoside And Myrictin From Fractionated Labisia pumila var alata. Malays. J. Anal. Sci. 2018, 22, 817–827. [Google Scholar]
  19. Abdullah, F.; Ling, S.K.; Man, S.; Tan, A.L. Characterization and Identification of Labisia pumila By Multi Steps Infrared Spectroscopy. Vib. Spectrosc. 2012, 62, 200–206. [Google Scholar] [CrossRef]
  20. Chua, L.S.; Abdull Latiff, N.; Lee, S.Y.; Sarmidi, M.R.; Abdul Aziz, R. Flavanoids And Phenolic Acids from Labisia pumila (Kacip Fatimah). Food Chem. 2011, 127, 1186–1192. [Google Scholar] [CrossRef]
  21. Aladdin, N.-A.; Husain, K.; Jalil, J.; Sabandar, C.W.; Jamal, J.A. Xanthine Oxidase Inhibitory Activity of a New Isocoumarin Obtained From Maratodes pumilm var pumila Leaves. BMC Complement. Altern. Med. 2020, 20, 324–335. [Google Scholar] [CrossRef]
  22. Mohd Arie, A.; Luqman Chuan, A.; Pin, Y.K.; Tan, H.P. Effects on Solvent on The Extracyion of Kacip Fatimah (Labisia pumila) Leaves. J. Chem. Pharm. Res. 2014, 6, 172–176. [Google Scholar]
  23. Zúñiga, J.D.; Gostel, M.R.; Mulchay, D.G.; Barker, K.; Hill, A.; Sedagatpour, M.; Vo, S.Q.; Funk, V.A.; Coddington, J.A. DNA Release: DNA Barcodes of Plant Species Collected For The Global Genome Initiaitive For Garden Program, National Museum of Natural History, Smithsonian Institution. GGI-Gardens 2017, 88, 119–122. [Google Scholar]
  24. Wan Ezumi, M.F.; Sulaiman, S.A.; Islam, M.N.; Abdul Wahab, M.S.; Sahil Jamalulail, S.M. Evaluation of the Teratogenicity of Aqueous Extract of Labisia Pumila Var. Alata in Rats. Malays. J. Med. Sci. 2005, 12, 13–21. [Google Scholar]
  25. Zakaria, N.; Mohd Kamsah, S.; Ahmed Saeed, M.A.; Ahmed Hassan, L.E.; Shafaei, A.; Al-Suede, F.S.R.; Memon, A.H.; Ismail, Z. Anti-Uterine Fibroid Effect of Standardized Labisia pumila var alata Extracts In Vitro And In Human Uteine Fibroid Cancer Xenograf Model. Asian Pac. J. Cancer Prev. 2020, 21, 943–951. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Parveen, I.; Gafner, S.; Techen, N.; Murch, S.J.; Khan, I.A. DNA Barcoding for the Identification of Botanicals In Herbal Medicine and Dietary Supplements: Strengths And Limitations. Planta Med. 2016, 82, 1225–1235. [Google Scholar] [CrossRef] [Green Version]
  27. De Boer, H.J.; Ichim, M.C.; Newmaster, S.G. DNA Barcoding and Pharmacovigilance of Herbal Medicines. Drug Saf. 2015, 38, 611–620. [Google Scholar] [CrossRef]
  28. Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; Zhu, Y.; Ma, X.; Gao, T.; Pang, X. Validation of The Its2 Region As A Novel DNA Barcode For Identifying Medicinal Plant Species. PLoS ONE. 2010, 5, E8613. [Google Scholar] [CrossRef]
  29. Newmaster, S.G.; Grguric, M.; Shanmughanandhan, D.; Ramalingam, S.; Ragupathy, S. DNA Barcoding Detects Contamination and Substitution In North American Herbal Products. BMC Med. 2013, 11, 222. [Google Scholar] [CrossRef] [Green Version]
  30. Abdelwahed, A.; Bouhlel, I.; Skandrani, I.; Valenti, K.; Kadri, M.; Guiraud, P.; Steiman, R.; Mariotte, A.-M.; Ghedira, K.; Laporte, F. Study of Antimutagenic And Antioxidant Activities of Gallic Acid And 1, 2, 3, 4, 6-Pentagalloylglucose From Pistacia lentiscus: Confirmation By Microarray Expression Profiling. Chem. Biol. Interact. 2007, 165, 1–13. [Google Scholar] [CrossRef] [PubMed]
  31. Hebert, P.D.; Cywinska, A.; Ball, S.L.; Dewaard, J.R. Biological Identifications Through DNA Barcodes. Proc. R. Soc. Biol. Sci. Ser. B. 2003, 270, 313–321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Karimi, E.; Jaafar, H.Z.E.; Ahmad, S. Phytochemical Analysis And Antimicrobial Activities Of Methanolic Extracts of Leaf, Stem And Root From Different Varieties of Labisa pumila Benth. Molecules 2011, 16, 4438–4450. [Google Scholar] [CrossRef]
  33. Wallace, L.J.; Boilard, S.M.; Eagle, S.H.; Spall, J.L.; Shokralla, S.; Hajibabaei, M. DNA Barcodes for Everyday Life: Routine Authentication of Natural Health Products. Food Res. Int. 2012, 49, 446–452. [Google Scholar] [CrossRef]
  34. Yu, J.; Wu, X.; Liu, C.; Newmaster, S.; Ragupathy, S.; Kress, W.J. Progress in The Use of DNA Barcodes In The Identification and Classification of Medicinal Plants. Ecotoxicol. Environ. Saf. 2021, 208, 1–7. [Google Scholar] [CrossRef]
  35. Tnah, L.H.; Lee, S.L.; Tan, A.L.; Lee, C.T.; Ng, K.K.S.; Ng, C.H.; Nurul Farhanah, Z. DNA Barcode Database of Common Herbal Plants in The Tropics: A Resource For Herbal Product Authentication. Food Control. 2019, 95, 318–326. [Google Scholar] [CrossRef]
  36. Costa, J.; Amaral, J.S.; Fernandes, T.J.; Batista, A.; Oliveira, M.B.P.; Mafra, I. DNA Extraction from Plant Food Supplements: Influence of Different Pharmaceutical Excipients. Mol. Cell. Probes. 2015, 29, 473–478. [Google Scholar] [CrossRef] [Green Version]
  37. Abdah, S.N.M.; Sarmidi, M.R.; Yaakob, H.; Ware, I. Fractionation of Labisia pumila Using Solid-Phase Extraction For Extraction of Gallic Acid. J. Teknol. 2014, 69, 65–68. [Google Scholar]
  38. Jana, S.; Shekhawat, G. Anethum Graveolens: An Indian Traditional Medicinal Herb and Spice. Pharmacogn. Rev. 2010, 4, 179–184. [Google Scholar]
  39. Chahardoli, A.; Karimi, N.; Fattahi, A. Nigella Arvensis Leaf Extract Mediated Green Synthesis of Silver Nanoparticles: Their Characteristic Properties and Biological Efficacy. Adv. Powder Technol. 2018, 29, 202–210. [Google Scholar] [CrossRef]
  40. Serrano, A.; Palacios, C.; Roy, G.; Cespón, C.; Villar, M.A.L.; Nocito, M.; González-Porqué, P. Derivatives of Gallic Acid Induce Apoptosis in Tumoral Cell Lines And Inhibit Lymphocyte Proliferation. Arc. Biochem. Biophys. 1998, 350, 49–54. [Google Scholar] [CrossRef]
  41. Palhares, R.M.; Drummond, M.G.; Brasil, B.D.S.A.F.; Cosenza, G.P.; Brandão, M.D.G.L.; Oliveira, G. Medicinal Plants Recommended By The World Health Organization: DNA Barcode Identification Associated With Chemical Analyses Guarantees Their Quality. PLoS ONE 2015, 10, e0127866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Yeh, C.-T.; Yen, G.-C. Induction of Hepatic Antioxidant Enzymes by Phenolic Acids in Rats is Accompanied by Increased Levels of Multidrug Resistance–Associated Protein 3 mRNA Expression. J. Nutr. 2006, 136, 11–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Yahya, M.F.; Hassan, N.H.; Abdullah, N.; Abd Wahid, M.S.; Khalid, R.; Abdullah, R.; Ramuddin, S. Induction of Labisia pumila var. alata (Kacip Fatimah) Adventitious Roots in vitro. Trans. Malays. Soc. Plant Physiol. 2017, 25, 119–123. [Google Scholar]
  44. Niho, N.; Shibutani, M.; Tamura, T.; Toyoda, K.; Uneyama, C.; Takahashi, N.; Hirose, M. Subchronic Toxicity Study of Gallic Acid by Oral Administration In F344 Rats. Food Chem. Toxicol. 2001, 39, 1063–1070. [Google Scholar] [CrossRef]
  45. Nur Syukriah, A.R.; Liza, M.S.; Harisun, Y.; Fadzillah, A. Effect of Solvent Extraction on Antioxidant and Antibacterial Activities from Quercus infectoria (Manjakani). Int. Food Res. J. 2014, 21, 1067–1073. [Google Scholar]
  46. Chattuwatthana, T.; Okello, E. Anti-Collagenase, Anti-Elastase and Antioxidant Activities of Pueraria candollei var. mirifica Root Extract and Coccinia grandis Fruit Juice Extract: An In Vitro Study. Eur. J. Med. Plants 2015, 5, 318. [Google Scholar] [CrossRef] [Green Version]
  47. Gramza, A.; Korczak, J. Tea Constituents (Camellia sinensis L.) ss Antioxidants in Lipid Systems. Trends Food Sci. Technol. 2005, 16, 351–358. [Google Scholar] [CrossRef]
  48. Boudıeb, K.; Kaki, S.A.S.-A.; Oulebsir-Mohandkaci, H.; Bennacer, A. Phytochemical Characterization and Antimicrobial Potentialities of Two Medicinal Plants, Chamaemelum nobile (L.) all and Matricaria chamomilla (L.). Int. J. Innov. Approaches Sci. Res. 2018, 2, 126–139. [Google Scholar] [CrossRef]
  49. Zhong, Y.; Wang, H.; Wei, Q.; Cao, R.; Zhang, H.; He, Y.; Wang, L. Combining DNA Barcoding And HPLC Fingerprints To Trace Species of An Important Traditional Chinese Medicine Fritillariae Bulbus. Molecules 2017, 24, 3269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Abubakar, B.M.; Mohd Salleh, F.; Omar, M.S.S.; Wagiran, A. Assessing Product Adulteration of Eurycoma longifolia (Tongkat Ali) Herbal Medicinal Product Using DNA Barcoding and HPLCAnalysis. Pharm. Biol. 2018, 56, 368–377. [Google Scholar] [CrossRef] [Green Version]
  51. Duan, Z.; Song, W.; Chen, K.; Qiao, X.; Ye, M. Assessment of Genetic and Chemical Variability In Curcumae longe Rhizom (Curcuma longa) Based On DNA Barcoding Markers And HPLC Fingerprints. Biol. Pharm. Bull. 2017, 40, 1638–1645. [Google Scholar] [CrossRef] [Green Version]
  52. Poornima, B. Adulteration and Substitution in Herbal Drugs A Critical Analysis. Int. J. Res. Ayurveda Pharm. 2010, 1, 8–12. [Google Scholar]
  53. Zhang, Z.; Zhang, Y.; Zhng, Z.; Yao, H.; Zhang, B.; Liao, Y. Comparative Analysis of DNA Barcoding And HPLC Fingerprint To Trace Species of Phellodendri cortex, An Important Traditional Chinese Medicine From Multiple Sources. Biol. Pharm. Bull. 2016, 39, 1325–1330. [Google Scholar] [CrossRef] [Green Version]
  54. Levin, R.A.; Wagner, W.L.; Hoch, P.C.; Nepokroeff, M.; Pires, J.C.; Zimmer, E.A.; Sytsma, K.J. Family-Level Relationships of Onagraceae Based on Chloroplast Rbcl And Ndhf Data. Am. J. Bot. 2003, 90, 107–115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Chua, L.S.; Ruzlan, N.N.; Sarmidi, M.R. Recovery of Rutin From Labisia Pumila Extract Using Solid Phase Extraction. Acta Chim. Slov. 2017, 64, 888–894. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Friedman, M.; Kim, S.Y.; Lee, S.J.; Han, G.P.; Han, J.S.; Lee, K.R.; Kozukue, N. Distribution of catechins, theaflavins, caffeine, and theobromine in 77 teas consumed in the United States. J. Food Sci. 2005, 70, C550–C559. [Google Scholar] [CrossRef]
  57. Wan Ezumi, M.F.; Amrah, S.S.; Suhaimi, A.; Mohsin, S. Evaluation of the Female Reproductive Toxicity of Aqueous Extract of Labisia pumila var. alata in Rats. Indian J. Pharmacol. 2007, 39, 30–32. [Google Scholar]
  58. Ayida, A.W.; Wan Nazaimoon, W.M.; Farihah, H.S.; Azian, A.L. Effect of Water Extract of Labisia pumila var alata Treatment and Estrogen Replacement Therapy Morphology of Adipose Tissue in Ovariectomized Sprague Dawley Rats. J. Med. Biol. Sci. 2006, 1, 1–6. [Google Scholar]
  59. Wahab, N.; Yusof, W.; Shuid, A.; Mahmoud, W.; Ali, K. Labisia pumila has Similar Effects to Estrogen on the Reproductive Hormones of Ovariectomized Rats. Int. J. Herb. Plant. Med. 2011, 2, 1–6. [Google Scholar]
  60. Zhang, J.; Hu, X.; Wang, P.; Huang, B.; Sun, W.; Xiong, C.; Hu, Z.; Chen, S. Investigation on Species Authenticity for Herbal Products of Celastrus orbiculatus and Tripterygum wilfordii From Markets Using ITS2 Barcoding. Molecules 2018, 23, 967. [Google Scholar] [CrossRef] [Green Version]
Figure 1. (a) Multiple sequence alignment of ITS2 gene (291 bp) from Labisia pumila leaves (var. pumila green leaf (LPPG), var. pumila red leaf (LPPR), and var. alata (LPA)) with L. pumila var. lanceolata (MH766971.1) (338 bp) aligned using Jalview software. The conserved region shows nucleotides overlapping at base 175 until 339 (164 bp). The nucleotides are coded according to color; A: adenine (green), T: thymine (blue), G: guanine (red), C: cytosine (yellow). (b) Multiple sequence alignment of rbcL gene (523 bp) from L. pumila leaves (LPPG_rbcL, LPPR_rbcL, and LPA_rbcL) with rbcL sequences of L. pumila var. lanceolata (MH749147.1) and L. pumila (MH069794.1) previously generated by Tnah et al., 2019 [35] and Zuniga et al., 2017 [23] aligned using Jalview software. The nucleotides are coded according to color; A: adenine (green), T: thymine (blue), G: guanine (red), C: cytosine (yellow).
Figure 1. (a) Multiple sequence alignment of ITS2 gene (291 bp) from Labisia pumila leaves (var. pumila green leaf (LPPG), var. pumila red leaf (LPPR), and var. alata (LPA)) with L. pumila var. lanceolata (MH766971.1) (338 bp) aligned using Jalview software. The conserved region shows nucleotides overlapping at base 175 until 339 (164 bp). The nucleotides are coded according to color; A: adenine (green), T: thymine (blue), G: guanine (red), C: cytosine (yellow). (b) Multiple sequence alignment of rbcL gene (523 bp) from L. pumila leaves (LPPG_rbcL, LPPR_rbcL, and LPA_rbcL) with rbcL sequences of L. pumila var. lanceolata (MH749147.1) and L. pumila (MH069794.1) previously generated by Tnah et al., 2019 [35] and Zuniga et al., 2017 [23] aligned using Jalview software. The nucleotides are coded according to color; A: adenine (green), T: thymine (blue), G: guanine (red), C: cytosine (yellow).
Plants 10 00717 g001
Figure 2. HPLC chromatograms of (A) gallic acid standard marker, (B) L. pumila var. pumila plant green leaf (LPPG), (C) L. pumila var. pumila plant red leaf (LPPR), (D) L. pumila var. alata plant (LPA), and L. pumila HMPs (E) KFP1, (F) KFP2, (G) KFP3, (H) KFP11, (I) KFP12, and (J) KFP13.
Figure 2. HPLC chromatograms of (A) gallic acid standard marker, (B) L. pumila var. pumila plant green leaf (LPPG), (C) L. pumila var. pumila plant red leaf (LPPR), (D) L. pumila var. alata plant (LPA), and L. pumila HMPs (E) KFP1, (F) KFP2, (G) KFP3, (H) KFP11, (I) KFP12, and (J) KFP13.
Plants 10 00717 g002
Figure 3. HPLC chromatograms of (a) rutin standard marker, (b) L. pumila var. pumila plant green leaf (LPPG), (c) L. pumila var. pumila plant red leaf (LPPR), (d) L. pumila var. alata plant (LPA), and L. pumila HMPs [(e) KFP1, (f) KFP2, (g) KFP3, (h) KFP11, (i) KFP12, and (j) KFP13].
Figure 3. HPLC chromatograms of (a) rutin standard marker, (b) L. pumila var. pumila plant green leaf (LPPG), (c) L. pumila var. pumila plant red leaf (LPPR), (d) L. pumila var. alata plant (LPA), and L. pumila HMPs [(e) KFP1, (f) KFP2, (g) KFP3, (h) KFP11, (i) KFP12, and (j) KFP13].
Plants 10 00717 g003
Figure 4. Neighbor-joining (NJ) tree of L. pumila HMP rbcL trimmed sequences compared to reference sequences generated in this work (MK249863.1, MK249864.1, and MK249865.1) and other DNA reference barcodes retrieved from GenBank (MH749147.1 and MH069794.1). KFP: Kacip Fatimah product. Numbers on the nodes of each branch are the bootstrap values for 1000 replicates.
Figure 4. Neighbor-joining (NJ) tree of L. pumila HMP rbcL trimmed sequences compared to reference sequences generated in this work (MK249863.1, MK249864.1, and MK249865.1) and other DNA reference barcodes retrieved from GenBank (MH749147.1 and MH069794.1). KFP: Kacip Fatimah product. Numbers on the nodes of each branch are the bootstrap values for 1000 replicates.
Plants 10 00717 g004
Figure 5. NJ tree of L. pumila HMPs ITS2 trimmed sequences compared to reference sequences generated in this work (MH828448.1, MH838008.1, and MH838010.1) and another DNA reference barcode retrieved from GenBank (MH766971.1). KFP: Kacip Fatimah product. Numbers on the node of each branch are the bootstrap values for 1000 replicates.
Figure 5. NJ tree of L. pumila HMPs ITS2 trimmed sequences compared to reference sequences generated in this work (MH828448.1, MH838008.1, and MH838010.1) and another DNA reference barcode retrieved from GenBank (MH766971.1). KFP: Kacip Fatimah product. Numbers on the node of each branch are the bootstrap values for 1000 replicates.
Plants 10 00717 g005
Table 1. Authentication summary of selected L. pumila herbal medicine products (HMPs) via DNA barcoding.
Table 1. Authentication summary of selected L. pumila herbal medicine products (HMPs) via DNA barcoding.
CodeDeclared
Ingredients
Barcode RegionBLASTn Best HitIdentity (%)Query Cover (%)Accession No.Barcode IDIdentity of Barcodes
KFP1 (capsule)Labisia pumilaITS2Labisia pumila var. pumila100100MH838010.1Labisia pumila var. pumilaAuthentic
rbcLLabisia pumila var. pumila100100MK249865.1
KFP2 (capsule)Labisia pumila, Quercus
infectoria, Parameria
polyneura
ITS2Anethum graveolens99.2989KM210329.1Anethum graveolens, Nigella arvensSubstituted
rbcLNigella arvensis98.65100MG946921.1
KFP3 (capsule)Labisia pumila, Camellia sinensis, Pueraria mirificaITS2Cuminum cyminum90.1189KX108698.1Cuminum cyminum, Camellia oleiferaSubstituted
rbcLCamellia oleifera99.81100MF541730.2
KFP4 (capsule)Labisia pumilaNANSNSNSNSNSNS
KFP5 (capsule)Labisia pumila, Querqus
lusitanica
NANSNSNSNSNSNS
KFP6 (capsule)Labisia pumila, Quercus
infectoria
NANSNSNSNSNSNS
KFP7 (capsule)Labisia pumila, Terminalia chebulaNANSNSNSNSNSNS
KFP8 (capsule)Labisia pumila, Croton
caudatum
NANSNSNSNSNSNS
KFP9 (capsule)Labisia pumila, Nigella
sativa, Goniothalamus macrophyllus, Elephantopus scaber, Terminalia chebula, Kaempferia galangal,
Curcuma longa
NANSNSNSNSNSNS
KFP10 (capsule)Labisia pumilaNANSNSNSNSNSNS
KFP11 (tea bag)Labisia pumila, Camellia sinensisITS2Labisia pumila var. pumila100100MH838010.1Labisia pumila var. pumilaAuthentic
rbcLLabisia pumila var. pumila100100MK249865.1
KFP12 (tea bag)Labisia pumila, Pueraria mirificaITS2Labisia pumila var. pumila100100MH838010.1Labisia pumila var. pumila, Camellia oleiferaContamination
rbcLCamellia oleifera100100MF541730.2
KFP13 (tea bag)Labisia pumila, Chamaemelum nobileITS2Labisia pumila var. pumila100100MH838010.1Labisia pumila var. pumilaAuthentic
rbcLLabisia pumila var. pumila100100MK249865.1
KFP14 (tea bag)Labisia pumilaNANSNSNSNSNSNS
KFP15 (capsule)Labisia pumilaNANSNSNSNSNSNS
NA: non-amplifiable; NS: no sequence; KFP: Kacip Fatimah product, BLAST: Basic Local Alignment Search Tool.
Table 2. Concentration (mg/L) of gallic acid and rutin in Labisia pumila leaf extract and HMPs.
Table 2. Concentration (mg/L) of gallic acid and rutin in Labisia pumila leaf extract and HMPs.
Sample IDGallic AcidRutin
Retention Time (min)Concentration (mg/L)Retention Time (min)Concentration (mg/L)
LPPG3.52447.10ND0.00
LPPR3.613113.93ND0.00
LPA3.6173.586.2821.26
KFP13.63321.94ND0.00
KFP23.631132.176.2410.79
KFP33.74584.966.2707.40
KFP113.76473.456.2724.94
KFP123.74266.066.3586.38
KFP133.7182.236.3220.56
ND: not detected.
Table 3. Summary of L. pumila HMP authentication using DNA barcoding and HPLC.
Table 3. Summary of L. pumila HMP authentication using DNA barcoding and HPLC.
Serial NumberProduct Type Analysis
DNA BarcodeHPLC
Gallic AcidRutin
KFP1CapsuleAuthenticYesNo
KFP2CapsuleSubstitutedYesYes
KFP3Tea bagSubstitutedYesYes
KFP11Tea bagAuthenticYesYes
KFP12Tea bagContaminatedYesYes
KFP13Tea bagAuthenticYesYes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tarmizi, A.A.A.; Wagiran, A.; Mohd Salleh, F.; Chua, L.S.; Abdullah, F.I.; Hasham, R.; Binte Mostafiz, S. Integrated Approach for Species Identification and Quality Analysis for Labisia pumila Using DNA Barcoding and HPLC. Plants 2021, 10, 717. https://doi.org/10.3390/plants10040717

AMA Style

Tarmizi AAA, Wagiran A, Mohd Salleh F, Chua LS, Abdullah FI, Hasham R, Binte Mostafiz S. Integrated Approach for Species Identification and Quality Analysis for Labisia pumila Using DNA Barcoding and HPLC. Plants. 2021; 10(4):717. https://doi.org/10.3390/plants10040717

Chicago/Turabian Style

Tarmizi, Auni Aqilah Ahmad, Alina Wagiran, Faezah Mohd Salleh, Lee Suan Chua, Farah Izana Abdullah, Rosnani Hasham, and Suraiya Binte Mostafiz. 2021. "Integrated Approach for Species Identification and Quality Analysis for Labisia pumila Using DNA Barcoding and HPLC" Plants 10, no. 4: 717. https://doi.org/10.3390/plants10040717

APA Style

Tarmizi, A. A. A., Wagiran, A., Mohd Salleh, F., Chua, L. S., Abdullah, F. I., Hasham, R., & Binte Mostafiz, S. (2021). Integrated Approach for Species Identification and Quality Analysis for Labisia pumila Using DNA Barcoding and HPLC. Plants, 10(4), 717. https://doi.org/10.3390/plants10040717

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop