Propagation Methods for the Conservation and Preservation of the Endangered Whorled Sunflower (Helianthus verticillatus)
Abstract
:1. Introduction
2. Results and Discussion
2.1. Rooted Cuttings
2.2. Clones for Incompatibility Study
2.3. Seed Viability and Germination Studies
3. Materials and Methods
3.1. Rooted Cuttings
3.2. Clones for Incompatibility Study and Seed Production
3.3. Seed Production, Viability and Germination
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Matthews, J.F.; Allison, J.R.; Ware, R.T.; Nordman, C. Helianthus verticillatus Small (Asteraceae) rediscovered and redescribed. Castanea 2002, 67, 13–24. [Google Scholar]
- Ellis, J.R.; Bentley, K.; McCauley, D. Detection of rare paternal chloroplast inheritance in controlled crosses of the endangered sunflower Helianthus verticillatus. Hereditary 2008, 100, 574–580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- US Fish and Wildlife Service. Endangered and Threatened Wildlife and Plants: Designation of Critical Habitat for Physaria globsa (Short’s Badderpod, Helianthus verticillatus (Whorled Sunflower), and Leavenworthia crassa (Fleshy-Fruit Gladcress); Final Rule; US Fish and Wildlife Service: Washington, DC, USA, 2014; Volume 79, pp. 50990–51039.
- Chafin, L.; Owers, K. Species Account of Helianthus verticillatus. Available online: https://georgiabiodiversity.a2hosted.com/natels/profile?es_id=21967 (accessed on 28 July 2021).
- Edwards, T.P.; Trigiano, R.N.; Ownley, B.H.; Windham, A.S.; Wyman, C.R.; Wadl, P.A.; Hadziabdic, D. Genetic Diversity and Conservation Status of Helianthus verticillatus, an Endangered Sunflower of the Southern United States. Front. Genet. 2020, 11, 410. [Google Scholar] [CrossRef]
- Ellis, J.R.; McCauley, D.E. Phenotypic differentiation in fitness related traits between populations of an extremely rare sunflower: Conservation management of isolated populations. Biol. Conserv. 2009, 142, 1836–1843. [Google Scholar] [CrossRef]
- Mandel, J.R. Clonal diversity, spatial dynamics, and small genetic population size in the rare sunflower, Helianthus verticillatus. Conserv. Genet. 2010, 11, 2055–2059. [Google Scholar] [CrossRef]
- Strange, N.C.; Moulton, J.K.; Bernard, E.C.; Klingeman, W.E.; Sampson, B.J.; Trigiano, R.N. Floral Visitors to Helianthus verticillatus, a Rare Sunflower Species in the Southern United States. HortScience 2020, 55, 1980–1986. [Google Scholar] [CrossRef]
- Kane, M. Propagation by shoot culture. In Plant Tissue Culture, Development, and Biotechnology; Trigiano, R.N., Gray, D.J., Eds.; CRC Press: Boca Raton, FL, USA, 2011; pp. 181–191. [Google Scholar]
- Inoka, K.P.I.; Dahanayake, N. Effect of plant growth regulators on micro-propagation of sunflower (Helianthus annuus L.). Int. J. Sci. Res. Publ. 2015, 5, 1–5. [Google Scholar]
- Nowakowska, M.; Pavlović, Z.; Nowicki, M.; Boggess, S.L.; Trigiano, R.N. In Vitro Propagation of an Endangered Helianthus verticillatus by Axillary Bud Proliferation. Plants 2020, 9, 712. [Google Scholar] [CrossRef]
- Ruter, J.M. Cloning plant by rooting stem cuttings. In Plant Propagation Concepts and Laboratory Exercises; Trigiano, R.N., Beyl, C.A., Eds.; CRC Press: Boca Raton, FL, USA, 2015; pp. 219–229. [Google Scholar]
- Druege, U.; Franken, P. Petunia as model for elucidating adventitious root formation and mycorrhizal symbiosis: At the nexus of physiology, genetics, microbiology and horticulture. Physiol. Plant. 2018, 165, 58–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Druege, U.; Hilo, A.; Pérez-Pérez, J.M.; Klopotek, Y.; Acosta, M.; Shahinnia, F.; Zerche, S.B.; Franken, P.; Hajirezaei, M.R. Molecular and physiological control of adventitious rooting in cuttings: Phytohormone action meets resource allocation. Ann. Bot. 2019, 123, 929–949. [Google Scholar] [CrossRef] [Green Version]
- Ahkami, A.H.; Melzer, M.; Ghaffari, M.R.; Pollmann, S.; Javid, G.M.; Shahinnia, F.; Hajirezaei, M.R.; Druege, U. Distribution of indoe-3-acetic acid in Petunia hybrid shoot tip cuttings and relationship between auxin transport, carbohydrate metabolism and adventitious root formation. Planta 2013, 238, 499–517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norcini, J.G.; Aldrich, J.H. Cutting propagation and container production of ‘Flora Sun’ beach sunflower. J. Environ. Hortic. 2000, 18, 185–187. [Google Scholar] [CrossRef]
- Liu, J.-H.; Yeung, E.C.; Mukherjee, I.; Reid, D.M. Stimulation of Adventitious Rooting in Cuttings of Four Herbaceous Species by Piperazine. Ann. Bot. 1995, 75, 119–125. [Google Scholar] [CrossRef]
- Abdalla, N.; Domokos-Szabolcsy, É.; El-Ramady, H.; Hodossi, S.; Fari, M.; Ragab, M.; Taha, H. Jerusalem artichoke (Helianthus tuberosus L.): A review of in vivo and in vitro propagation. Int. J. Hortic. Sci. 2014, 20, 131–136. [Google Scholar] [CrossRef] [Green Version]
- Burger, D.W. Intermittent mist control for plant propagation. In Plant Propagation Concepts and Laboratory Exercises; Trigiano, R.N., Beyl, C.A., Eds.; CRC Press: Boca Raton, FL, USA, 2015; pp. 123–126. [Google Scholar]
- Trigiano, R.N.; Bernard, E.; Hadziabdic, D.; Dattilo, A.J.; Wadl, P.A. First report of powdery mildew on whorled sunflower (Helianthus verticillatus) caused by Golovinomyces ambrosae. Plant Dis. 2016, 100, 1017. [Google Scholar] [CrossRef]
- Hass, A.; Bishop, A.; Hancock, G.; Jennings, M. Recovery Success Stories: Tennessee Purple Coneflower; U.S. Fish and Wildlife Service: Washington, DC, USA, 2011. Available online: www.fws.gov/endangered/what-we-do/ep-09.html (accessed on 21 July 2021).
- Davies, F.; Geneve, R.; Wilson, S. Plant Propagation: Principles and Practices, 9th ed.; Pearson Education, Inc.: New York, NY, USA, 2018. [Google Scholar]
- Pop, T.I.; Pamfil, D.; Bellini, C. Auxin Control in the Formation of Adventitious Roots. Not. Bot. Horti Agrobot. Cluj-Napoca 2011, 39, 307–316. [Google Scholar] [CrossRef] [Green Version]
- Castañeda-Saucedo, M.C.; Tapia-Campos, E.; Ramírez-Anaya, J.D.P.; Beltrán, J. Growth and Development of Stevia Cuttings During Propagation with Hormones in Different Months of the Year. Plants 2020, 9, 294. [Google Scholar] [CrossRef]
- Shirin, F.; Mishra, J.P.; Bhadrawale, D.; Saudagar, I.A.; Gupta, T.; Berry, N. Seasonal and hormonal variation during adventitious rhizogenesis in five commercially important bamboo species for production of quality planting material. J. For. Res. 2021, 1–9. [Google Scholar] [CrossRef]
- Crawford, B.D.; Dole, J.M.; Bergmann, B. Influences of Season and Cutting Week within a Propagation Cycle on Rooting of ‘Stained Glass’ Coleus Shoot Tip Cuttings Are Not Overcome by Rooting Compound Treatment. HortTechnology 2016, 26, 620–627. [Google Scholar] [CrossRef]
- Stuepp, C.A.; de Bitenourt, J.; Wendling, I.; Koehler, H.S.; Zuffellato-Ribas, C. Age of stock plants, seasons and IBA effect on vegetative propagation of Ilex paraguariensis. Rev. Arvore 2017, 41, e410204. [Google Scholar]
- Chabikwa, T.G.; Brewer, P.B.; Beveridge, C.A. Initial Bud Outgrowth Occurs Independent of Auxin Flow from Out of Buds. Plant Physiol. 2018, 179, 55–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shinohara, N.; Taylor, C.; Leyser, O. Strigolactone Can Promote or Inhibit Shoot Branching by Triggering Rapid Depletion of the Auxin Efflux Protein PIN1 from the Plasma Membrane. PLoS Biol. 2013, 11, e1001474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balla, J.; Medvedová, Z.; Kalousek, P.; Matiješčuková, N.; Friml, J.; Reinöhl, V.; Procházka, S. Auxin flow-mediated competition between axillary buds to restore apical dominance. Sci. Rep. 2016, 6, 35955. [Google Scholar] [CrossRef] [Green Version]
- Renton, M.; Hanan, J.; Ferguson, B.J.; Beveridge, C.A. Models of long-distance transport: How is carrier-dependent auxin transport regulated in the stem? New Phytol. 2012, 194, 704–715. [Google Scholar] [CrossRef] [PubMed]
- Mason, M.; Ross, J.J.; Babst, B.A.; Wienclaw, B.N.; Beveridge, C.A. Sugar demand, not auxin, is the initial regulator of apical dominance. Proc. Natl. Acad. Sci. USA 2014, 111, 6092–6097. [Google Scholar] [CrossRef] [Green Version]
- Fichtner, F.; Barbier, F.; Feil, R.; Watanabe, M.; Annunziata, M.G.; Chabikwa, T.; Höfgen, R.; Stitt, M.; Beveridge, C.A.; Lunn, J.E. Trehalose 6-phosphate is involved in triggering axillary bud outgrowth in garden pea (Pisum sativum L.). Plant J. 2017, 92, 611–623. [Google Scholar] [CrossRef] [Green Version]
- Guan, L.; Tayengwa, R.; Cheng, Z.; Peer, W.A.; Murphy, A.S.; Zhao, M. Auxin regulates adventitious root formation in tomato cuttings. BMC Plant Biol. 2019, 19, 435. [Google Scholar] [CrossRef] [Green Version]
- Pashley, C.H.; Ellis, J.R.; McCauley, D.E.; Burke, J.M. EST Databases as a Source for Molecular Markers: Lessons from Helianthus. J. Hered. 2006, 97, 381–388. [Google Scholar] [CrossRef]
- DeGrandi-Hoffman, G.; Watkins, J.C. The foraging activity of honey bees Apis mellifera and non-Apis bees on hybrid sunflowers (Helianthus annuus) and its influence on cross-pollination and seed set. J. Apic. Res. 2000, 39, 37–45. [Google Scholar] [CrossRef]
- Greenleaf, S.S.; Kremen, C. Wild bees enhance honey bees’ pollination of hybrid sunflower. Proc. Natl. Acad. Sci. USA 2006, 103, 13890–13895. [Google Scholar] [CrossRef] [Green Version]
- Parker, F.D. How efficient are bees in pollinating sunflowers? J. Kans. Entomol. Soc. 1981, 54, 61–67. [Google Scholar]
- Baskin, C.C.; Baskin, J.M. Seeds: Ecology, Biogeography, and Evolution of Dormancy and Germination, 2nd ed.; Academic Press: San Diego, CA, USA, 2014. [Google Scholar]
- Castillo-Lorenzo, E.; Pritchard, H.W.; Finch-Savage, W.E.; Seal, C.E. Comparison of seed and seedling functional traits in native Helianthus species and the crop H. annuus (sunflower). Plant Biol. 2019, 21, 533–543. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brakie, M. Evaluation of Swamp Sunflower Accessions of the Western Coastal Plain; Final Report; USDA: Washington, DC, USA, 2020. Available online: https://www.nrcs.usda.gov/Internet/FSE_PLANTMATERIALS/publications/etpmcsr13601.pdf (accessed on 28 July 2021).
- Lachabrouilli, A.-S.; Rigal, K.; Corbineau, F.; Bailly, C. Effects of agroclimatic conditions on sunflower seed dormancy at harvest. Eur. J. Agron. 2021, 124, 126209. [Google Scholar] [CrossRef]
- Gay, C.; Corbineau, F.; Côme, D. Effects of temperature and oxygen on seed germination and seedling growth in sunflower (Helianthus annuus L.). Environ. Exp. Bot. 1991, 31, 193–200. [Google Scholar] [CrossRef]
- Tukey, J. The Problem of Multiple Comparisons; Chapman & Hall: London, UK, 1953. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2016. [Google Scholar]
- Hamm, T.P.; Nowicki, M.; Boggess, S.L.; Klingeman, W.E.; Hadziabdic, D.; Huff, M.L.; Staton, M.E.; Trigiano, R.N. Development and characterization of 15 novel genomic SSRs for Viburnum farreri. Plants 2021, 10, 487. [Google Scholar] [CrossRef] [PubMed]
- Dean, D.A.; Wadl, P.A.; Hadziabdic, D.; Wang, X.; Trigiano, R.N. Analyzing microsatellites using the QIAxcel system. In Microsatellites: Methods and Protocols, Methods in Molecular Biology; Kantartzi, S., Ed.; Springer: Berlin, Germany, 2013; Volume 1006, pp. 223–243. [Google Scholar]
- Wang, X.; Rinehart, T.A.; Wadl, P.A.; Windham, M.T.; Spiers, J.M.; Johnson, D.H.; Trigiano, R.N. A new electrophoresis technique to separate microsatellite alleles. Afr. J. Biotechnol. 2009, 8, 2432–2436. [Google Scholar]
- Amos, W.; Hoffman, J.I.; Frodsham, A.; Zhang, L.; Best, S.; Hill, A.V.S. Automated binning of microsatellite alleles: Problems and solutions. Mol. Ecol. Notes 2006, 7, 10–14. [Google Scholar] [CrossRef]
- Iseldy, D. Rules for Testing Seeds; Association of Official Seed Analysts: Las Cruces, NM, USA, 2016. [Google Scholar]
- Peters, J. Tetrazolium Testing Handbook; Association of Official Seed Analysts: Las Cruces, NM, USA, 2005. [Google Scholar]
Primer Code | Repeat Motif | Primers: F = Forward; R = Reverse | Location One (bp) | Location Two (bp) | Location Three (bp) |
---|---|---|---|---|---|
BL006 | (GTGA)3 | F: CATGGGTGATCAATGGAGTG | 264 | 263 | 263 |
(HV006) | R: CGGCACATAACAAGTGCTTC | ||||
BL0012 | (GTTA)3 | F: CGAGACGGTTAAGAGCTTGC | 337 | 337 | 337 |
(HV012) | R: GGTGTACAACCAACTCACACC | ||||
BL0022) | (TAA)4 | F: ACTTACCGTTGCATTTGGTG | 107 | 107 | 107 |
(HV017) | R: TTATCCCTAGAACACGATTACAG | ||||
BL0019 | (GAAA)3 | F: GAGTCCTGGCCTGAACAGAG | 296 | 295 | 295 |
(HV026) | R: AAACTGCAATGTACCTTCTTGAC | ||||
BL0024 | (GTAA)3 | F: CTCCCGCACTTCAAGCTAAC | 125 | 124 | 124 |
(HV028) | R: CATACACCTTTGCGGTTTCC | ||||
BL0031 | (GAC)4 | F: CCGGAAGATAACGACGAGTG | 423 | 423 | 424 |
(HV031) | R: TCCATCGCTTTCCCTAAATC | ||||
BL0042 | (GGC)4 | F: GGTTACAACGGTGGAAGTCG | 363 | 363 | 364 |
(HV042) | R: TCCGGTTCACCAATTCATTC | ||||
BL0048 | (GAA)4 | F: TTGTGGAGACGGTGAATGAG | 221 | 220 | 220 |
(HV048) | R: TAACCGAACGACCATTCTTC |
Temp. (°C) | Germination (%) | T50 (d) | Dormant (%) |
---|---|---|---|
22/11 | 96.3 b | 7.5 a | 3.3 b |
27/15 | 98.8 a | 2.5 b | 0.8 c |
29/19 | 95.6 b | 2.0 c | 2.8 b |
33/24 | 75.5 c | 2.0 c | 23.0 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trigiano, R.N.; Boggess, S.L.; Wyman, C.R.; Hadziabdic, D.; Wilson, S. Propagation Methods for the Conservation and Preservation of the Endangered Whorled Sunflower (Helianthus verticillatus). Plants 2021, 10, 1565. https://doi.org/10.3390/plants10081565
Trigiano RN, Boggess SL, Wyman CR, Hadziabdic D, Wilson S. Propagation Methods for the Conservation and Preservation of the Endangered Whorled Sunflower (Helianthus verticillatus). Plants. 2021; 10(8):1565. https://doi.org/10.3390/plants10081565
Chicago/Turabian StyleTrigiano, Robert N., Sarah L. Boggess, Christopher R Wyman, Denita Hadziabdic, and Sandra Wilson. 2021. "Propagation Methods for the Conservation and Preservation of the Endangered Whorled Sunflower (Helianthus verticillatus)" Plants 10, no. 8: 1565. https://doi.org/10.3390/plants10081565