Next Article in Journal
Post-Proline Cleaving Enzymes (PPCEs): Classification, Structure, Molecular Properties, and Applications
Next Article in Special Issue
Distribution, Polymorphism and Function Characteristics of the GST-Encoding Fhb7 in Triticeae
Previous Article in Journal
In Vitro Cultures and Volatile Organic Compound Production in Chiliadenus montanus (Vhal.) Brullo
Previous Article in Special Issue
Identification of Peanut Aux/IAA Genes and Functional Prediction during Seed Development and Maturation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 11
Issue 10
10.3390/plants11101329
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cytogenetic Identification of the Wheat–Dasypyrum villosum T3DL·3V#3S Translocation Line with Resistance against Stripe Rust

by
Jie Zhang
1,2,
Shuyao Tang
1,
Tao Lang
1,
Ying Wang
1,
Hai Long
3,
Guangbing Deng
3,
Qian Chen
1,
Yuanlin Guo
1,
Pu Xuan
4,
Jun Xiao
1 and
Yun Jiang
1,*
1
Institute of Biotechnology and Nuclear Technology Research, Sichuan Academy of Agricultural Sciences, Chengdu 610061, China
2
Key Laboratory of Wheat Biology and Genetic Improvement on Southwestern China (Ministry of Agriculture), Chengdu 610066, China
3
Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China
4
Institute of Agro-Products Processing Science and Technology, Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
*
Author to whom correspondence should be addressed.
Plants 2022, 11(10), 1329; https://doi.org/10.3390/plants11101329
Submission received: 15 April 2022 / Revised: 8 May 2022 / Accepted: 10 May 2022 / Published: 18 May 2022
(This article belongs to the Special Issue Plant Chromosome Biology and Genomics for Breeding)
Browse Figures
Versions Notes

Abstract

:
The annual species Dasypyrum villosum possesses several potentially valuable genes for the improvement of common wheat. Previously, we identified a new stripe rust-resistant line, the Chinese Spring (CS)–D. villosum 3V#3 (3D) substitution line (named CD-3), and mapped its potential rust resistance gene (designated as YrCD-3) on the 3V#3 chromosome originating from D. villosum. The objective of the present study was to further narrow down the YrCD-3 locus to a physical region and develop wheat-3V#3 introgression lines with strong stripe rust resistance. By treating CD-3 seeds with 60Co γ-irradiation, two CS-3V#3 translocation lines, T3V#3S.3DL and T3DS.3V#3L (termed 22-12 and 24-20, respectively), were identified from the M4 generation through a combination of non-denaturing fluorescence in situ hybridization (ND-FISH) and functional molecular markers. Stripe rust resistance tests showed that the line 22-12 exhibited strong stripe rust resistance similarly to CD-3, whereas 24-20 was susceptible to stripe rust similarly to CS, indicating that YrCD-3 is located on the short arm of 3V#3. The line 22-12 can potentially be used for further wheat improvement. Additionally, to trace 3V#3 in the wheat genetic background, we produced 30 3V#3-specific sequence tag (EST) markers, among which, 11 markers could identify 3V#3S. These markers could be valuable in fine-mapping YrCD-3.

1. Introduction

Bread wheat (Triticum aestivum L.) is a staple food crop whose global production has been challenged by many fungal diseases including stripe rust [1]. Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst), was previously considered endemic in areas with low temperatures [2]; however, recently, its incidence has been reported in regions with warmer climate during the wheat-growing season [3,4,5]. Genetic resistance is the most effective measure to manage this disease [6]. To date, 83 stripe rust resistance genes (Yr1 to Yr83) have been identified [6], and resistance to many of these genes’ products has been acquired by the pathogen. For example, Yr9, a rye-derived stripe rust resistance gene, which was widely used in Chinese wheat breeding programs in the 1960s, became ineffective due to the emergence and spread of the pathogen race CYR29, which was first documented in 1987 [7]. Afterward, during the 2008–2009 crop season, Yr24/Yr26 resistance was acquired by a new race, V26 [7,8], which is also virulent to wheat lines harboringYr10 [7,9]. The wild relatives of common wheat carry valuable resistance genes for wheat diseases [10,11,12], for example, the rust resistance genes Yr9/Sr31/Lr26 and Yr83, originated from Secale cereale; of these, Yr9/Sr31/Lr26 is prevalent in commercial wheat cultivars in China [9,13,14].
Dasypyrum villosum (L.) Candargy (syn. Haynaldia villosa (L.) Schur, 2n = 2x = 14, VV) is an annual wild relative of common wheat and it is highly resistant to wheat diseases such as powdery mildew, eyespot, and stripe rust [15,16,17]. Although more than 300 D. villosum accessions have been collected [18], only 5 accessions (designated as V#1–V#5) have been used to produce wheat–D. villosum alien lines [19,20,21,22,23,24]. Among these lines, the D. villosum–common wheat 6V#2S.6AL translocation line has been widely applied in wheat breeding [25] for its well-known durable powdery mildew resistance gene, Pm21, located on 6V#2S of D. villosum [26]. Recently, Pm21 has been cloned [27,28]. Studies have reported stripe rust resistance in some D. villosum populations [17]. However, limited progress has been made in the exploration of stripe rust resistance genes in D. villosum [29]. Previously, we characterized a novel CS-D. villosum 3V#3 (3D) substitution line, named CD-3, which exhibited strong stripe rust resistance [30]. The stripe rust resistance gene originating from D. villosum, namely, YrCD-3, was found to be located on the 3V#3 chromosome [30]. This indicated that CD-3 may be a valuable source of resistance genes to stripe rust in wheat, and its stripe rust-resistant gene (named Yr CD-3) should be exploited further.
Numerous molecular markers have been developed to monitor D. villosum chromatin in the wheat background [31,32], map favorable characteristics on chromosomal regions [12], and detect resistance genes located on the chromosomes originating from D. villosum [33,34]. However, only a few molecular markers are available for the utilization of D. villosum in wheat breeding. Transcriptome information based on next-generation sequencing (NGS) is a high-throughput and low-cost method that is widely used to develop molecular markers for simple sequence repeats (SSR) mining [35] and single-nucleotide polymorphism discovery [36]. Studies have reported the development of some molecular primers specific to D. villosum#4 chromosomes 1V to 7V based on RNA sequencing (RNA-seq) information [37].
Gamma irradiation is considered an effective method for inducing mutations [38], and this method has been widely used for transferring alien chromatin to the wheat genetic background [39], for wheat breeding [40], and for creating wheat–alien introgression lines to map and clone target genes [41]. In the present study, we treated CD-3 seeds with 60Co γ-irradiation and precisely identified 3V#3.3D translocation lines from the M4 generation; then, YrCD-3 was mapped on the short arm of the 3V#3 chromosome. Finally, new EST markers were developed in the present study to monitor the 3V#3 chromosome arms in the wheat genetic background.

2. Results

2.1. Generation and Screening for Wheat–D. villosum 3V#3.3D Translocation Stocks

A total of 315 seeds of CD-3 were irradiated by 60Co γ-rays in the present study. Fifteen seeds from each line (CD-3200Gy and CD-3ck) were randomly selected and analyzed through conventional Feulgen staining for chromosomal behavior assessment. The results of the cytological analysis indicated large-scale structural aberrations of chromosomes and abnormal mitotic chromosomal behavior, for example, chromosome segments and chromatin bridges were observed in the line CD-3200Gy, whereas 42 chromosomes and no chromosomal fragment were observed in the line CD-3ck (Figure S1A–D). The remaining 300 seeds from each line were sown in field plots to analyze their survival rate. The survival rates of CD-3200Gy and CD-3ck were found to be 75% and 98%, respectively, and the survival rate of CD-3ck was significantly higher than that of CD-3200Gy (t-test, p = 0.0011) (Figure S1E). These results indicated that mutants of this batch of CD-3 seeds were effectively induced by 60Co-γ ray.
Then, 1000 M1 plants were randomly selected and screened by V-genome-specific marker, DV1 [31], analyses, and the M1 plants carrying V-genome-specific bands were used for FISH analyses. In total, 563 M1 plants were successfully identified using FISH. We observed three types of chromosomal structural changes, involving 3V#3 chromosome (3V#3.wheat translocation (type 1), 3V#3.3V#3 translocation (type 2), and 3V#3 deletion (type 3)) in 79 plants (Figure S2A,B). The average inducing frequency was 14.03%. However, most of the aberration lines were heterozygous (i.e., they contained either one aberrant chromosome and one intact 3V#3 or two types of aberrant chromosomes). Most of the structural aberrations in the M1 plants could be transmitted to their progenies. More than 100 plants with only one translocation or deletion segregated in the M2–M3 progenies. From the self-fertilized progenies (M4) with the aforementioned aberrations, based on FISH and V-genome-specific marker analyses, two homozygous translocation lines for unique wheat-3V#3 translocations were isolated.

2.2. Identification of T. aestivum–D. villosum Structural Aberrations by ND-FISH

ND-FISH analysis using the probes Oligo-pHv62-1, Oligo-Ku, and Oligo-D showed that the lines 22-12 and 24-20 contained 42 chromosomes including a pair of 3V#3.D translocation chromosomes (Figure 1A,C). Subsequently, a second round of ND-FISH using the probes Oligo-pSc119.2 and Oligo-pTa535 was conducted on the same mitotic spread chromosomes of 22-12 and 24-20, as well as on the control CD-3 and CS. The results showed all wheat and 3V#3 chromosomes could be accurately distinguished using the probes Oligo-pSc119.2 and Oligo-pTa535 (Figure 1B,D). By comparing the standard wheat karyotype obtained using the probes Oligo-pSc119.2 and Oligo-pTa535 [42] and based on the results of the first round of FISH analysis, we inferred that the wheat–D. villosum translocations in 22-12 and 24-20 were 3V#3S.3DL and 3DS.3V#3L, respectively.
Additionally, we observed that the signal patterns of some chromosomes in 22-12 and 24-20 differed from those in CS. For example, 5A in 24-20 exhibited a weak signal of Oligo-pSc119.2 in the terminal region of the short arm, not observed in CS. Additionally, 3B in 24-20 exhibited no Oligo-pTa535 signal at the end of the long arm, whereas 3B in CS carried an unmistakable Oligo-pTa535 signal at the end of the long arm. Similarly, 5D in 24-20 exhibited no Oligo-pTa535 signal at the end of the long arm, differently from CS. Notably, 6D in 24-20 harbored a barely visible Oligo-pTa535 signal at the end of the short arm, whereas 6D in CS exhibited an apparent terminal oligo-pTa535 signal on the short arm, and 6D in 22-12 carried a stronger oligo-pTa535 signal on the short arm compared to CS (Figure 1E).

2.3. Molecular Marker Analysis

The lines 22-12 and 24-20, their parent line CD-3, the positive control D. villosum, and the negative control CS were analyzed by employing 18 PLUG markers specific for wheat homoeologous group 3 chromosomes. Among the 18 PLUG primer pairs, two primer pairs (TNAC1241 and TNAC1326) generated D. villosum-specific bands in D. villosum, CD-3, and 22-12, whereas the other two primers (TNAC1267 and TNAC1359) amplified the D. villosum fragment from D. villosum, CD-3 and 24-20 (Figure 2). Ishikawa et al. [43] reported that TNAC1248 and TNAC1326 were located on the short arm, whereas TNAC1267 and TNAC1359 were located on the long arm (Table 1). Combined with the FISH analysis, we confirmed the line 22-12 as T3DL.3V#3S RobT and the line 24-20 as T3DS.3V#3L RobT.

2.4. Stripe Rust Response

To identify the IT of the lines 22-12 and 24-20, the adult plant resistance (APR) test of stripe rust was conducted on all tested materials, including two CS–D. villosum 3V#3.3D translocation lines, CD-3, D. villosum accession PI 491576, and CS. The line 22-12 was found to be near immune to stripe rust (IT 0;), similarly to its parent line, CD-3, and the positive control D. villosum, whereas the line 24-20 exhibited moderate susceptibility (IT 3), similarly to the negative control CS (Figure 3). The stripe rust resistance gene YrCD-3, originated from D. villosum and therefore was mapped to the short arm of the 3V#3 chromosome.

2.5. Development and Verification of 3V#3-Specific EST Markers

By comparing the CD-3 sequences with D. villosum accession PI 491576 sequences acquired by RNA-seq, followed by the removal of the CS transcripts by reference genome matching, a subset of 3901 unigene sequences was obtained and used as putative 3V#3 chromosome-specific sequences. Based on the candidate sequences, we obtained 12 primer pairs, namely, 3V#3-1–3V#3-12, which could amplify stable, clear, and 3V-specific bands in CD-3 and D. villosum. The genomic DNA from CS, CD-3, D. villosum accession PI 491576, and the lines 22-12 and 24-20 was used to localize the new markers. Of the 12 primer pairs, 4 were found to be specific for 3V#3S (3V#3-1, 3V#3-4, 3V#3-7 and 3V#3-10), and the remaining 8 were found to be specific for 3V#3L (Figure 4, Table 2).
To produce high-density molecular markers to target the short arm and long arm of D. villosum chromosome 3V#3, PCR was performed on CS, CD-3 (3V#3), D. villosum accession PI 491576, and the lines 22-12 and 24-20 by using the EST primers specific to 3V#4 [37], which helped determine the effectiveness of these markers and localize them on 3V#3. Among the 27 3V#4-specific EST markers, 18 primer pairs could produce stable, clear and 3V#3-specific fragments in CS, CD-3 and D. villosum accession PI 491576. Eleven of 18 EST markers were mapped on the long arm of 3V#3, whereas the remaining 7 markers were mapped on the short arm of 3V#3 (Figure 5). Additionally, some products’ sizes in D. villosum#3 were not consistent with those in D. villosum#4, such as the sizes of the products amplified by 3V#4-1, 3V#4-3, 3V#4-7, 3V#4-20, 3V#4-21, and 3V#4-22.
The results indicated that a total of 30 EST markers specific to chromosome 3V#3 could be used to characterize the 3V#3 chromosome’s arms. Among these markers, 11 markers could target 3V#3S. The markers are all specific and stable and thus valuable in detecting and localizing the novel stripe rust resistance gene YrCD-3 on the D. villosum chromosome 3V#3S in wheat.

3. Discussion

D. villosum confers resistance to several wheat diseases such as powdery mildew, stripe rust, leaf rust, stem rust, eyespot, and take-all, as well as to wheat spindle streak mosaic virus (WSSM) [44,45]. Thus, it has been extensively used as a vital genetic resource for wheat breeding. Since the last century, several D. villosum–common wheat alien lines, such as amphidiploids [19], additional lines [20], substitution lines [21,46] and translocation lines [47,48,49], have been developed, and several resistance genes, such as Pm62 [18], Pm21 [50], Sr52 [51], have been explored and mapped on individual V-genome chromosomes by using wheat–D. villosum alien lines. In 2000, Yildirim et al. [17] tested the stripe rust reactions of D. villosum accessions, and the results showed that, of the 115 D. villosum accessions tested, 41 (35.65%) were resistant to stripe rust, indicating that D. villosum provides a vast pool of genes for stripe rust resistance. However, there only a few stripe rust resistance genes have been explored in D. villosum [52].
Gamma irradiation (by 60Co-γ) is an effective means to transfer many beneficial traits from the genomes of alien species to those of wheat [30,41]. In the current study, the seeds of CD-3 were treated with 60Co γ-rays to develop wheat–3V#3 translocation lines carrying strong stripe rust resistance conferred by YrCD-3. Chromosome fragmentation, chromatin bridges, and a substantial decrease in the survival rate were observed in the M0 generation, which was consistent with the findings of previous studies [38,53,54]. The results indicated that mutants of this batch of CD-3 seeds were effectively induced by 60Co-γ ray. Thus, the subsequent generations could be used as candidate populations for further screening the 3V#3.wheat translocation lines. In addition, several 3V#3 structural aberration lines were obtained from the irradiation progenies, and these chromosomal structural aberration lines could help for the further physical mapping of YrCD-3 on the 3V#3 chromosomal region.
Combined analysis based on FISH, V-genome-specific markers helped in identifying two new wheat–D. villosum translocation lines, namely, 22-12 and 24-20, from the M4 generation. FISH analysis showed that the line 22-12 was T3DL.3V#3S RobT, and the line 24-20 was T3DS.3V#3L RobT. Moreover, the presence of 3V#3S and 3V#3L in 22-12 and 24-20, respectively, was also confirmed by the subsequent PLUG marker analysis. The Pst resistance test at the adult stage indicated that 22-12 is highly resistant to stripe rust similar to CD-3 and D. villosum, whereas 24-20 is susceptible to stripe rust similar to CS. Thus, YrCD-3, derived from D. villosum, was mapped on the short arm of the 3V#3 chromosome, indicating that YrCD-3 can be expressed in the genetic background of 22-12 (T3DL.3V#3S RobT). Furthermore, the novel T3DL.3V#3S RobT, 22-12, with a high degree of resistance to stripe rust, could be a valuable germplasm for wheat improvement.
ND-FISH has been widely used for identifying chromosomal structural variations of wheat and its relatives [38,55]. Some probes that can replace conventional genomic in situ hybridization (GISH) were developed to distinguish alien genomes in the wheat genetic background, including Oligo-B and Oligo-D for targeting the genomes B and D of wheat [56], Oligo-1162 for targeting the R genome of rye [55], Oligo-Ku for identifying the V-genome of D. villosum [57], and Oligo-B11 and Oligo-pThp3.93 for monitoring the E genome of Thinopyrum [58]. The present study used the probes Oligo-D and Oligo-Ku along with Oligo-pSc119.2, Oligo-pTa535, and the V-genome-specific probe Oligo-Hv62-1 to characterize the chromosomal structural variants in the lines 22-12 and 24-20. Oligo-D and Oligo-Ku could accurately identify the chromosome breakage–reunion occurring between V-genome and D-genome chromosomes. The probe Oligo-Hv62-1 could easily highlight 3V#3 chromosomes with strong signals, whereas the probes Oligo-pSc119.2 and Oligo-pTa535 could discriminate every individual chromosome and detect chromosomal structural changes. Chromosomal structural changes have been commonly observed in the progeny of the plants subjected to 60Co-γ-irradiation [38,53]. In the present study, slight FISH signal pattern changes, in addition to the translocation chromosomes, were observed in the lines 22-12 and 24-20 compared with the CS chromosomal karyotype. Large-scale mutants, such as deletion mutants and dicentromerics, which are commonly observed in the early generation (M0) [38,53], were not observed in the lines 22-12 and 24-20 (M4), indicating that substantial structural changes in somatic chromosomes are likely to be recovered to some extent.
RNA-seq is a potential technique for identifying novel molecular markers in some plant species, especially those with limited existing genomic information. Markers based on transcription data have been developed to target the chromatin of wild wheat relatives transferred into the wheat genetic background. For example, Thinopyrum intermedium genome-specific EST-SSR markers [59], Agropyron cristatum chromosome 6P-specific EST markers [60], Aegilops longissima chromosome arm-specific PCR markers [61], rye-specific PCR markers [62], and D. villosum#4 chromosome 1V#4-7V#4-specific PCR markers [37,63] have been developed based on transcriptome data of wheat relatives. In the present study, 12 3V#3-specific EST markers were developed based on the transcriptome data of CD-3 and D. villosum. Of these, four markers were mapped to 3V#3S, whereas eight makers were mapped to 3V#3L. We also compared the locations of these markers on the wheat groups 1–7 and found that the locations of nine markers specific to 3V#3 chromosomes were consistent with their chromosomal locations in wheat, whereas two markers including 3V#3-2 and 3V#3-4 displayed different chromosomal locations in wheat. The present result showed that the high homologous sequence of marker 3V#3-2 mapped on 3V#3S was located on 1DS, whereas that of 3V#3-4 mapped on 3V#3S was located on chromosomes 1AL in wheat, which revealed that the collinearity of the developed markers on the chromosomal regions in D. villosum#3 and wheat was interrupted, and these genomic divergences were likely to drive the establishment of new species. A similar phenomenon was observed in a previous study [36]. Additionally, 27 3V#4-specific EST markers reported by Li et al. [37] were selected to test their effectiveness on the 3V#3 chromosome. Finally, only 18 primer pairs could produce stable, precise, and 3V#3-specific bands. Among them, 7 markers were mapped to 3V#3S, whereas 11 were mapped to 3V#3L. Additionally, five product sizes in D. villosum#3 were not consistent with those in D. villosum#4, indicating that genomic divergence occurred between D. villosum#3 and D. villosum#4 during the evolutionary process, which may be due to differences in the adaptation of the two Dasypyrum accessions to the environment. Therefore, the 30 PCR markers identified could potentially be used for tracing 3V#3 arms in the wheat genetic background, and the 11 3V#3S-specific markers could help for the further physical mapping of YrCD-3 on the 3V#3 chromosomal region.

4. Materials and Methods

4.1. Plant Materials

D. villosum accession PI 491576 (genome VV, 2n = 2x = 14) was obtained from the National Genetic Resources Program, United States Department of Agriculture. CS-D. villosum 3V#3 (3D) substitution line, namely, CD-3, is an F6 progeny derived from hybridization between CS and CS–D. villosum 3V#3 addition line, as described by Zhang et al. [30]. CD-3 and the common wheat CS were maintained by our laboratory. In total, 315 seeds of CD-3 were subjected to 60Co-γ irradiation, and 15 seeds from the mutagenized generation (M0) were selected randomly and used for evaluating the effectiveness of the irradiation treatment. The remaining 300 seeds were planted in the field. The subsequent generations (M2–M4) were used as candidate populations for screening and identifying the 3V#3.wheat translocation lines. The lines 22-12 and 24-20 were selected from the self-pollinated progenies (M4). A mixture of the cultivars Mingxian169 and SY95-71 was used as spreaders in the stripe rust test and was maintained by our laboratory.

4.2. 60Co γ-Irradiation Treatment of CD-3 Seeds

In total, 315 CD-3 seeds were treated by 60Co γ-irradiation at a dosage of 200 Gy, at a dosage rate of 1.0 Gy/m. The irradiation treatment was performed at the Institute of Biotechnology and Nuclear Technology Research, Sichuan Academy of Agricultural Sciences, China.

4.3. Mitotic Analysis and Survival Rate Investigation of the M0 Generation

Fifteen M0 generation seeds (named CD-3200Gy) were randomly selected for mitotic analysis, and 15 nonirradiated seeds of CD-3 were used as the control (named CD-3CK). The root tip preparation and mitotic studies were conducted using the methods described by Blanco et al. [64]. Cytological observations were performed using the Leica DM2500 microscope (Leica, Shanghai, China).
The survival rate of the M0 generation was investigated in Pixian city, Sichuan, China, in 2017. A total of 600 seeds (300 seeds for each line, CD-3200Gy and CD-3ck) were sown following an experimental block design with sixty 3 m rows (10 seeds per row). Three replicates (100 seeds from each line and a total of 200 seeds per replicate) were sown in the experimental block (3 m × 20 m).

4.4. Statistics Analysis

Statistical analyses were performed using GraphPad Prism version 8.01 (GraphPad Software, San Diego, CA, USA). Student’s t-test was used to estimate the statistical significance of the comparison, with a p-value of 0.05 as the threshold.

4.5. FISH Analysis

To synchronize cell division, the seeds of CD-3, 22-12, and 24-20 were placed on wet filter paper at 23 °C for 24 h and then transferred to 4 °C for 24 h, followed by their transfer to 22 °C for 24 h. Root tips (approximately 2 cm long) were collected and then treated with nitrous oxide for 2 h and fixed with 90% acetic acid for 8–10 min. Afterward, the root tips were washed twice with ddH2O and stored in 70% ethanol at −20 °C. Chromosome preparation was performed according to the procedures described by Kato et al. [65]. The oligonucleotides Oligo-pSc119.2, Oligo-pTa-535 [42], V-genome-specific probe (Oligo-pHv62-1) [66], V-genome-specific probe (Oligo-Ku) [57], and D genome-specific probe (Oligo-D) [56] were used to identify individual chromosomes. These probes were synthesized by Invitrogen (Shanghai, China). ND-FISH analysis was performed as described by Fu et al. [55]. All images were captured using a Leica DM2500 microscope (Leica, Shanghai, China).

4.6. Molecular Marker Analysis

Genomic DNA of D. villosum accession PI 491576, common wheat CS, CD-3, 22-12, and 24-20 was extracted from 2-week-old leaves by using the CTAB method [67]. V-genome-specific SCAR markers of DV1 were synthesized, as described by Zhang et al. [31]. The PLUG primers for the homologous group 3 and the EST primers specific to 3V#4 chromosomes were synthesized using the procedures described by Ishikawa et al. [43] and Li et al. [37], respectively. PCR was conducted using the T100TM Thermal cycler (Bio-RAD Laboratories, Emeryville, CA, USA) in a 25 μL reaction mixture containing 2.5 μL of 10X buffer (50 mM KCl, 1.5 mM MgCl2, and 10 mM Tris-HCl; pH 8.3), 200 nmol of each dNTP, 100 ng of genomic DNA, 0.2 U of Taq polymerase (TianGen, Beijing, China), and 400 nmol of each primer. The cycling parameters were: 94 °C for 3 min for the initial denaturation, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C (dependent on different primer sets) for 1 min, extension at 72 °C for 2 min, and a final extension at 72 °C for 10 min. The amplified products were separated on 2% (w/v) agarose gels and visualized by EtBr staining.

4.7. Assessment of Adult Plant Resistance to Stripe Rust

Thirty seeds from each line, including CD-3, 22-12, and 24-20 identified by ND-FISH, D. villosum accession PI 491576, and CS were sown in the field, and the plants were rated for stripe rust infection at the heading stage in the growing seasons during the years 2020 and 2021. The field test was conducted in Pixian city, Sichuan, China. CD-3 and D. villosum accession PI 491576 were used as resistance controls, and CS was used as the susceptible control. Ten seeds of each line were sown in a single-row plot. Three replicates were sown in an experimental block (3 m × 4 m), which was surrounded by a 30 cm-wide row of susceptible spreader. The mixed Pst strains, mainly CYR32, CYR33, and CYR34, that are currently prevailing in China [68], were used to infect the plants including the test lines and the spreader. Adult plant infection types (IT) (response of flag leaf) were recorded 18–20 days after inoculation based on a 0–4 scale, where 0, 0; 1, 2, 3, and 4 were considered to denote immune (I), near-immune (NI), high resistance (HR), moderate resistance (MR), moderate susceptibility (MS), and susceptibility (S), respectively [68]. The IT was recorded once every 10 days, totaling three times of recording. The Pst strains used were provided by the Plant Protection Institute, Sichuan Academy of Agricultural Sciences, China.

4.8. RNA-Seq and Transcriptome Assembly

Total RNA from CD-3 and D. villosum accession PI 491576 was extracted from the samples of 2-week-old leaves by using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The RNA quality was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). RNA-seq was performed by the Beijing Biomarker Technology Company, Beijing, China. High-quality clean reads were obtained from the raw reads after removing adaptor sequences, duplicated sequences, ambiguous reads (reads with “N” bases), and low-quality reads (reads with a length less than 20 bp). All reliable, clean reads were assembled into contigs by using the Trinity platform (http://trinityrnaseq.github.io, accessed on 10 April 2022) with the inchworm k-mer method [69]. The related contigs were clustered using TGICL software [70] to produce unigenes.

4.9. Development and Validation of 3V#3 Chromosome-Specific EST Markers

The unigene fragments of CD-3 were compared with those of D. villosum accession PI 491576 to select the unigene sequences having high similarities (identity ≥ 90%) (designated as data pool 1). After removing the transcripts of CS from date pool 1 through reference genome matching, the candidate unigenes (data pool 2) for developing the 3V#3-specific markers were obtained. Subsequently, the candidate unigenes from data pool 2 were compared with CS sequences on www.ncbi.nlm.nih.gov, accessed on 10 April 2022. Primers were designed using Primer Premier 5.0 (PREMIER Biosoft, Palo Alto, CA, USA) based on the low-homologous region between candidate unigenes and those of CS, followed by synthesis by Shanghai Sangon Biotech Co., Ltd (Sangon Biotech, Shanghai, China). PCR was conducted in a T100TM Thermal cycler (Bio-RAD Laboratories) by using a 25 μL reaction system containing 2.5 μL of 10× buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris-HCl; pH 8.3), 40–100 ng of genomic DNA, 200 nmol of each primer, and 1 U of Taq DNA polymerase (TianGen Biotech, Beijing, China). The PCR protocol was as follows: initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min; annealing at 56 °C for 1 min (dependent on different primer sets); and extension at 72 °C for 2 min, followed by a final extension at 72 °C for 10 min. The amplicons were separated on a 1% (w/v) agarose gel and visualized by EtBr staining.

5. Conclusions

By using a combination of ND-FISH and PLUG markers, wheat–D. villosum 3V#3.3D translocation lines, 22-12 and 24-20, were identified. The line 22-12 exhibited strong stripe rust resistance, whereas the line 24-20 showed susceptibility to stripe rust, indicating that the YrCD-3 is located on the short arm of 3V#3S. Furthermore, the line 22-12 could be a valuable resource for both basic and applied research for wheat resistance breeding. The 3V#3S-specific EST markers developed in the current study are available for marker-assisted selection in wheat breeding.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11101329/s1, Figure S1: Irradiation-induced chromosomal aberrations and survival rate in M0. (A–D): Feulgen staining of CD-3200Gy (A) and CD-3ck (B–D); (E): Survival rate of CD-3200Gy and CD-3ck. The black arrows indicate the chromosome segments, and the red arrows indicate the chromatin bridge.; Figure S2: PCR products of DV1 and summary of chromosomal aberrations in M1. (A), PCR amplification generated by the marker DV1; (B), FISH karyotype of aberrant chromosomes in M1. M, Trans2k plus DNA markers (Trangene, Beijing, China); 1, common wheat CS “Chinese Spring”; 2, CD-3; 3, D. villosum; 4–24, partial M0 plants; the arrow indicates D. villosum-specific bands. Type 1 indicates the 3V#3.wheat translocations, type 2 indicates the 3V#3.3V#3 translocation, and type 3 indicates the 3V#3 deletions. All chromosomes in (B) were stained with DAPI (blue), Oligo-pTa535 (red), Oligo-pSc119.2 (green) and Oligo-pHv62-1(white).

Author Contributions

Data curation, J.Z. and T.L.; Formal analysis, G.D.; Funding acquisition, J.Z.; Investigation, Q.C. and J.X.; Methodology, Y.W.; Project administration, Y.J.; Validation, H.L. and P.X.; Writing—original draft, J.Z.; Writing—review & editing, S.T. and Y.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Nature Science Foundation of China (No. 31801362), Applied Basic Research Programs of Science and Technology Department, Sichuan Province (Key Project) (No. 2019YJ0605), Project of Innovation Ability Improvement, Sichuan Province (No. 2019KXJJ-001), Foundation for Excellent Thesis of Sichuan Academy of Agricultural Sciences (No. 2018LWJJ-017), Fund for Talents of Sichuan Academy of Agricultural Sciences (2019LJRC020), Sichuan Wheat Breeding Community (No. 2021YFYZ0002-05), Crop Molecular Breeding Platform of Sichuan Province (No. 2021YFYZ0027) and The 1 + 9 Open Competition Project of Sichuan Academy of Agricultural Sciences to Select the Best Candidates (No. 1+9KJGG001).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We would like to thank Hai Du, College of Agronomy and Biotechnology, Southwest University, and Zujun Yang, School of Life Science and Technology, University of Electronic Science and Technology of China for careful reviewing and helpful comments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, X. Review Article: High-Temperature Adult-Plant Resistance, Key for Sustainable Control of Stripe Rust. Am. J. Plant Sci. 2013, 4, 608–627. [Google Scholar] [CrossRef] [Green Version]
  2. Zadoks, T.C. Epidemiology of Wheat Rust in Europe. Glob. Chang. Bio. 1967, 13, 29–46. [Google Scholar] [CrossRef]
  3. Milus, E.A.; Kristensen, K.; Hovmøller, M.S. Evidence for increased aggressiveness in a recent widespread strain of Puccinia striiformis f. sp. Tritici causing stripe rust of wheat. Phytopathology 2009, 99, 89–94. [Google Scholar] [PubMed] [Green Version]
  4. Hovmøller, M.S.; Walter, S.; Justesen, A.F. Escalating Threat of Wheat Rusts. Science 2010, 329, 369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Wellings, C.R. Global status of stripe rust: A review of historical and current threats. Euphytica 2011, 179, 129–141. [Google Scholar] [CrossRef]
  6. Li, J.; Dundas, I.; Dong, C.; Li, G.; Trethowan, R.; Yang, Z.; Hoxha, S.; Zhang, P. Identification and characterization of a new stripe rust resistance gene Yr83 on rye chromosome 6R in wheat. Theor. Appl. Genet. 2020, 133, 1095–1107. [Google Scholar] [CrossRef]
  7. McIntosh, R.A.; Mu, J.M.; Han, D.J.; Kang, Z.S. Wheat stripe rust resistance gene Yr24/Yr26: A retrospective review. Crop J. 2018, 6, 3–11. [Google Scholar] [CrossRef]
  8. Liu, T.G.; Peng, Y.L.; Chen, W.Q.; Zhang, Z.Y. First detection of virulence in Puccinia striiformis f. sp. Tritici in China to re-sistance genes Yr24 (=Yr26) present in wheat cultivar Chuanmai 42. Plant Dis. 2010, 94, 1163. [Google Scholar] [CrossRef]
  9. Zeng, Q.-D.; Han, D.-J.; Wang, Q.-L.; Yuan, F.-P.; Wu, J.; Zhang, L.; Wang, X.-J.; Huang, L.-L.; Chen, X.-M.; Kang, Z.-S. Stripe rust resistance and genes in Chinese wheat cultivars and breeding lines. Euphytica 2013, 196, 271–284. [Google Scholar] [CrossRef] [Green Version]
  10. Danilova, T.V.; Zhang, G.; Liu, W.; Friebe, B.; Gill, B.S. Homoeologous recombination-based transfer and molecular cytogenetic mapping of a wheat streak mosaic virus and Triticum mosaic virus resistance gene Wsm3 from Thinopyrum intermedium to wheat. Theor. Appl. Genet. 2016, 130, 549–556. [Google Scholar] [CrossRef]
  11. Zhang, R.; Feng, Y.; Li, H.; Yuan, H.; Dai, J.; Cao, A.; Xing, L.; Li, H. Cereal cyst nematode resistance gene CreV effective against Heterodera filipjevi transferred from chromosome 6VL of Dasypyrum villosum to bread wheat. Mol. Breed. 2016, 36, 122. [Google Scholar] [CrossRef]
  12. Zhang, R.Q.; Sun, B.X.; Chen, J.; Cao, A.Z.; Xing, L.P.; Feng, Y.G.; Lan, C.X.; Chen, P.D. Pm55, a developmental-stage and tissue-specifc powdery mildew resistance gene introgressed from Dasypyrum villosum into common wheat. Theor. Appl. Genet. 2016, 129, 1975–1984. [Google Scholar] [CrossRef] [PubMed]
  13. Cao, Y.; Si, B.; Zhu, G.; Xu, X.; Li, W.; Chen, S.; Zhao, J.; Li, T. Race and virulence of asexual and sexual populations of Puccinia graminis f. sp. Tritici in China from 2009 to 2015. Eur. J. Plant Pathol. 2018, 153, 545–555. [Google Scholar] [CrossRef]
  14. Zhao, X.L.; Zheng, T.C.; Xia, X.C.; He, Z.H.; Liu, D.Q.; Yang, W.X.; Yin, G.H.; Li, Z.F. Molecular mapping of leaf rust resistance gene LrZH84 in Chinese wheat line Zhou 8425B. Theor. Appl. Genet. 2008, 117, 1069–1075. [Google Scholar] [CrossRef] [PubMed]
  15. De Pace, C.; Montebove, L.; Delre, V.; Jan, C.C.; Qualset, C.O.; Scarascia Mugnozza, G.T. Biochemical versatility of amphiploids derived from crossing Dasypyrum villosum (L.) Candargy and wheat: Genetic control and phenotypical aspects. Theor. Appl. Genet. 1988, 76, 513–529. [Google Scholar] [CrossRef] [PubMed]
  16. Chen, P.D.; Qi, L.L.; Zhou, B.; Zhang, S.Z.; Liu, D.J. Development and molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6AL translocation lines specifying resistance to powdery mildew. Theor. Appl. Genet. 1995, 91, 1125–1128. [Google Scholar] [CrossRef] [PubMed]
  17. Yildirim, A.; Jones, S.S.; Murray, T.; Line, R.F. Evaluation of Dasypyrum villosum Populations for Resistance to Cereal Eyespot and Stripe Rust Pathogens. Plant Dis. 2000, 84, 40–44. [Google Scholar] [CrossRef] [Green Version]
  18. Zhang, R.; Fan, Y.; Kong, L.; Wang, Z.; Wu, J.; Xing, L.; Cao, A.; Feng, Y. Pm62, an adult-plant powdery mildew resistance gene introgressed from Dasypyrum villosum chromosome arm 2VL into wheat. Theor. Appl. Genet. 2018, 131, 2613–2620. [Google Scholar] [CrossRef]
  19. McFadden, E.S.; Sears, E.R. The Genome Approach in Radical Wheat Breeding. Agron. J. 1947, 39, 1011–1025. [Google Scholar] [CrossRef]
  20. Sears, E.R. Addition of the genome of Haynaldia villosa to Triticum aestivum. Am. J. Bot. 1953, 40, 168–174. [Google Scholar] [CrossRef]
  21. Liu, D.J.; Chen, P.D.; Pei, G.Z.; Wang, Y.N.; Qiu, B.X.; Wang, S.L. Transfer of Haynaldia villosa chromosomes into Triticum aestivum. In Proceedings of the 7th International Wheat Genet Symposium, Cambridge, UK, 13–19 July 1988; Miller, T.E., Koebner, R.M.D., Eds.; Institute of Plant Science Research, Cambridge Laboratory: Cambridge, UK, 1988; pp. 355–361. [Google Scholar]
  22. Lukaszewski, A.J.; Cowger, C. Re-Engineering of the Pm21 transfer from Haynaldia villosa to bread wheat by induced homoeologous Recombination. Crop. Sci. 2017, 57, 2590–2594. [Google Scholar] [CrossRef]
  23. Zhao, W.C.; Qi, L.L.; Gao, X.; Zhang, G.S.; Dong, J.; Chen, Q.J.; Friebe, B.; Gill, B.S. Development and characterization of two new Triticum aestivum-Dasypyrum villosum Robertsonian translocation lines T1DS·1V#3L and T1DL·1V#3S and their effect on grain quality. Euphytica 2010, 175, 343–350. [Google Scholar]
  24. Chen, P.D.; Liu, D.J. Identification of Haynaldia villosa chromosomes in wheat alien addition lines. In Proceedings of the 1st International Symposium on Chromosome Engineering in Plants, Xian, China, 20–25 October 1986; Zhensheng, L., Swaminathan, M.S., Eds.; pp. 31–32. [Google Scholar]
  25. Zhang, R.Q.; Zhang, M.Y.; Wang, X.E.; Chen, P.D. Introduction of chromosome segment carrying the seed storage protein genes from chromosome 1V of Dasypyrum villosum showed positive effect on bread-making quality of common wheat. Theor. Appl. Genet. 2014, 127, 523–533. [Google Scholar]
  26. Qi, L.L.; Wang, S.L.; Chen, P.D.; Liu, D.J.; Gill, B.S. Identification and physical mapping of three Haynaldia villosa chromo-some-6V deletion lines. Theor. Appl. Genet. 1998, 97, 1042–1046. [Google Scholar] [CrossRef]
  27. He, H.G.; Zhu, S.Y.; Zhao, R.H.; Jiang, Z.N.; Ji, Y.Y.; Ji, J.; Liu, D.; Li, H.J.; Bie, T.D. Pm21, encoding a typical CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol. Plant. 2018, 11, 879–882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Xing, L.; Hu, P.; Liu, J.; Witek, K.; Zhou, S.; Xu, J.; Zhou, W.; Gao, L.; Huang, Z.; Zhang, R.; et al. Pm21 from Haynaldia villosa Encodes a CC-NBS-LRR Protein Conferring Powdery Mildew Resistance in Wheat. Mol. Plant 2018, 11, 874–878. [Google Scholar] [CrossRef] [Green Version]
  29. Li, G.R.; Zhao, J.M.; Li, D.H.; Yang, E.N.; Huang, Y.F.; Liu, C.; Yang, Z.J. A novel Wheat-Dasypyrum breviaristatum substitution line with stripe rust resistance. Cytogenet. Genome Res. 2014, 143, 280–287. [Google Scholar] [CrossRef]
  30. Zhang, J.; Jiang, Y.; Wang, Y.; Guo, Y.; Long, H.; Deng, G.; Chen, Q.; Xuan, P. Molecular markers and cytogenetics to characterize a wheat–Dasypyrum villosum 3V (3D) substitution line conferring resistance to stripe rust. PLoS ONE 2018, 13, e0202033. [Google Scholar] [CrossRef] [Green Version]
  31. Zhang, J.; Long, H.; Pan, Z.; Liang, J.; Yu, S.; Deng, G.; Yu, M. Characterization of a genome-specific Gypsy-like retrotransposon sequence and development of a molecular marker specific for Dasypyrum villosum (L.). J. Genet. 2013, 92, 103–108. [Google Scholar] [CrossRef]
  32. Wang, H.; Dai, K.; Jin, X.; Yuan, C.; Zhao, R.; Doležel, J.; Wu, Y.F.; Cao, A.Z.; Chen, P.D.; Zhang, S.Z.; et al. Development of intron targeting (IT) markers specific for chromosome arm 4VS of Haynaldia villosa by chromosome sorting and next-generation sequencing. BMC Genom. 2017, 18, 167. [Google Scholar] [CrossRef] [Green Version]
  33. Cao, A.Z.; Wang, X.E.; Chen, Y.P.; Zou, X.W.; Chen, P.D. A sequence-specific PCR marker linked with Pm21 distinguishes chromosomes 6AS, 6BS, 6DS of Triticum aestivum and 6VS of Haynaldia villosa. Plant Breed. 2006, 125, 201–205. [Google Scholar] [CrossRef]
  34. Song, W.; Xie, C.; Du, J.; Xie, H.; Liu, Q.; Ni, Z.; Yang, T.; Sun, Q.; Liu, Z. A “one-marker-for-two-genes” approach for efficient molecular discrimination of Pm12 and Pm21 conferring resistance to powdery mildew in wheat. Mol. Breed. 2008, 23, 357–363. [Google Scholar] [CrossRef]
  35. Zhang, J.; Liang, S.; Duan, J.; Wang, J.; Chen, S.; Cheng, Z.; Zhang, Q.; Liang, X.; Li, Y. De novo assembly and Characterisation of the Transcriptome during seed development, and generation of genic-SSR markers in Peanut (Arachis hypogaea L.). BMC Genom. 2012, 13, 90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Druka, A.; Muehlbauer, G.; Druka, I.; Caldo, R.; Baumann, U.; Rostoks, N.; Schreiber, A.; Wise, R.; Close, T.; Kleinhofs, A.; et al. An atlas of gene expression from seed to seed through barley development. Funct. Integr. Genom. 2006, 6, 202–211. [Google Scholar] [CrossRef] [PubMed]
  37. Li, S.; Wang, J.; Wang, K.; Chen, J.; Wang, K.; Du, L.; Ni, Z.; Lin, Z.; Ye, X. Development of PCR markers specific to Dasypyrum villosum genome based on transcriptome data and their application in breeding Triticum aestivum-D. villosum#4 alien chromosome lines. BMC Genom. 2019, 20, 289. [Google Scholar] [CrossRef] [Green Version]
  38. Zhang, J.; Jiang, Y.; Guo, Y.; Li, G.; Yang, Z.; Xu, D.; Xuan, P. Identification of Novel Chromosomal Aberrations Induced by 60Co-γ-Irradiation in Wheat-Dasypyrum villosum Lines. Int. J. Mol. Sci. 2015, 16, 29787–29796. [Google Scholar] [CrossRef] [Green Version]
  39. Friebe, B.; Hatchett, J.H.; Mukai, Y.; Gill, B.S.; Sebesta, E.E. Transfer of Hessian fly resistance from rye to wheat via radiation-induced terminal and intercalary chromosomal translocations. Theor. Appl. Genet. 1991, 83, 33–40. [Google Scholar] [CrossRef]
  40. Tomlekova, N.B. Induced mutagenesis for crop improvement in bulgaria. Plant Mutat. Rep. 2010, 2, 4–27. [Google Scholar]
  41. Chen, P.; You, C.; Hu, Y.; Chen, S.; Zhou, B.; Cao, A.; Wang, X. Radiation-induced translocations with reduced Haynaldia villosa chromatin at the Pm21 locus for powdery mildew resistance in wheat. Mol. Breed. 2012, 31, 477–484. [Google Scholar] [CrossRef]
  42. Tang, Z.X.; Yang, Z.J.; Fu, S.L. Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J. Appl. Genet. 2014, 55, 313–318. [Google Scholar] [CrossRef]
  43. Ishikawa, G.; Nakamura, T.; Ashida, T.; Saito, M.; Nasuda, S.; Endo, T.R.; Wu, J.; Matsumoto, T. Localization of anchor loci representing five hundred annotated rice genes to wheat chromosomes using PLUG markers. Theor. Appl. Genet. 2008, 118, 499–514. [Google Scholar] [CrossRef] [PubMed]
  44. De Pace, C.; Vaccino, P.; Cionini, G.; Pasquini, M.; Bizzarri, M.; Qualset, C.O. Dasypyrum. In Wild Crop Relatives: Genomic and Breeding Resources, Cereals; Kole, C., Heidelberg, F.L., Eds.; Springer Press: Berlin/Heidelberg, Germany, 2011; pp. 185–292. [Google Scholar]
  45. Zhang, Q.P.; Li, Q.; Wang, X.E.; Wang, H.Y.; Lang, S.P.; Wang, Y.L.; Wang, S.L.; Chen, P.D.; Liu, D.J. Development and characterization of a Triticum aestivum-Haynaldia villosa translocation line T4VS.4DL conferring resistance to wheat spindle streak mosaic virus. Euphytica 2005, 145, 317–320. [Google Scholar] [CrossRef]
  46. Ma, J.A.; Zhou, R.H.; Jia, J.Z. Identification of wheat Haynaldia villosa substitution lines conferring resistance to powdery mildew using genomic in situ hybridization (GISH) and RFLP markers. Acta Genet. Sin. 1997, 24, 449–451. [Google Scholar]
  47. Qi, L.L.; Chen, P.D.; Liu, D.J.; Zhou, B.; Zhang, S.Z. Development of translocation lines of Triticum aestivum with powdery mildew resistance introduced from Haynaldia villosa. In Proceedings of the 8th International Wheat Genetics Symposium, Beijing, China, 20–25 July 1993; Li, Z.S., Xin, Z.Y., Eds.; China Agriculture Scientech Press: Beijing, China, 1995; Volume 1, pp. 333–337. [Google Scholar]
  48. Chen, Q.-Z.; Qi, Z.-J.; Feng, Y.-G.; Wang, S.-L.; Chen, P.-D. Structural changes of 4V chromosome of Haynaldia villosa induced by gametocidal chromosome 3C of Aegilops triuncialis. Acta Genet. Sin. 2002, 29, 355–358. [Google Scholar]
  49. Chen, S.; Chen, P.; Wang, X. Inducement of chromosome translocation with small alien segments by irradiating mature female gametes of the whole arm translocation line. Sci. China Ser. C Life Sci. 2008, 51, 346–352. [Google Scholar] [CrossRef]
  50. Zhu, S.; Ji, Y.; Ji, J.; Bie, T.; Gao, A.; He, H. Fine Physical Bin Mapping of the Powdery Mildew Resistance Gene Pm21 Based on Chromosomal Structural Variations in Wheat. Int. J. Mol. Sci. 2018, 19, 643. [Google Scholar] [CrossRef] [Green Version]
  51. Qi, L.L.; Pumphrey, M.Q.; Friebe, B.; Zhang, P.; Qian, C.; Bowden, R.L.; Rouse, M.N.; Jin, Y.; Gill, B.S. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat. Theor. Appl. Genet. 2011, 123, 159–167. [Google Scholar] [CrossRef]
  52. Zhao, W.; Gao, X.; Dong, J.; Zhao, Z.; Chen, Q.; Chen, L.; Shi, Y.; Li, X. Stripe rust resistance and dough quality of new wheat–Dasypyrum villosum translocation lines. Genet. Mol. Res. 2015, 14, 8077–8083. [Google Scholar] [CrossRef]
  53. Wang, H.J.; Yu, Z.H.; Li, G.R.; Yang, Z.J. Diversified chromosome rearrangements detected in a wheat–Dasypyrum brevia-ristatum substitution line induced by gamma-ray irradiation. Plants 2019, 8, 175. [Google Scholar] [CrossRef] [Green Version]
  54. Marcu, D.; Damian, G.; Cosma, C.; Cristea, V. Gamma radiation effects on seed germination, growth and pigment content, and ESR study of induced free radicals in maize (Zea mays). J. Biol. Phys. 2013, 39, 625–634. [Google Scholar] [CrossRef] [Green Version]
  55. Fu, S.; Chen, L.; Wang, Y.; Li, M.; Yang, Z.; Qiu, L.; Yan, B.; Ren, Z.; Tang, Z. Oligonucleotide Probes for ND-FISH Analysis to Identify Rye and Wheat Chromosomes. Sci. Rep. 2015, 5, 10552. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Tang, S.; Tang, Z.; Qiu, L.; Yang, Z.; Li, G.; Lang, T.; Zhu, W.; Zhang, J.; Fu, S. Developing New Oligo Probes to Distinguish Specific Chromosomal Segments and the A, B, D Genomes of Wheat (Triticum aestivum L.) Using ND-FISH. Front. Plant Sci. 2018, 9, 1104. [Google Scholar] [CrossRef] [PubMed]
  57. Xiao, Z.; Tang, S.; Qiu, L.; Tang, Z.; Fu, S. Oligonucleotides and ND-FISH Displaying Different Arrangements of Tandem Repeats and Identification of Dasypyrum villosum Chromosomes in Wheat Backgrounds. Molecules 2017, 22, 973. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Xi, W.; Tang, Z.; Tang, S.; Yang, Z.; Luo, J.; Fu, S. New ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes in Wheat Backgrounds. Int. J. Mol. Sci. 2019, 20, 2031. [Google Scholar] [CrossRef] [Green Version]
  59. Cui, Y.; Bao, Y.G.; Wang, H.G.; Li, X.F. Development of specific molecular markers for Thinopyrum intermedium using RNA-seq data. J. Triticeae Crops 2016, 36, 699–707. [Google Scholar]
  60. Dai, C.; Zhang, J.P.; Wu, X.Y.; Yang, X.M.; Li, L.H. Development of EST markers specifc to Agropyron cristatum chromosome 6P in common wheat background. Acta Agron. Sin. 2013, 38, 1791–1801. [Google Scholar] [CrossRef]
  61. Wang, K.; Lin, Z.; Wang, L.; Wang, K.; Shi, Q.; Du, L.; Ye, X. Development of a set of PCR markers specific to Aegilops longissima chromosome arms and application in breeding a translocation line. Theor. Appl. Genet. 2017, 131, 13–25. [Google Scholar] [CrossRef]
  62. Wu, N.; Li, M.; Sun, H.X.; Cao, Z.L.; Liu, P.; Ding, T.C.; Xu, H.B.; Chu, C.G.; Zhuang, L.F.; Qi, Z.J. RNA-seq facilitates development of chromosome-specific markers and transfer of rye chromatin to wheat. Mol. Breed. 2018, 38, 6. [Google Scholar] [CrossRef]
  63. Li, S.J.; Lin, Z.S.; Liu, C.; Wang, K.; Du, L.P.; Ye, X.G. Development and comparative genomic mapping of Dasypyrum villosum 6V#4S-specifc PCR markers using transcriptome data. Theor. Appl. Genet. 2017, 130, 2057–2068. [Google Scholar]
  64. Blanco, A.; Simeone, R.; Resta, P. The addition of Dasypyrum villosum (L.) Candargy chromosomes to durum wheat (Triticum durum Desf.). Theor. Appl. Genet. 1987, 74, 328–333. [Google Scholar] [CrossRef]
  65. Kato, A.; Lamb, J.C.; Birchler, J.A. Chromosome painting using repetitive DNA sequences as probes for somatic chromosome identification in maize. Proc. Natl. Acad. Sci. USA 2004, 101, 13554–13559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Li, G.; Gao, D.; Zhang, H.; Li, J.; Wang, H.; La, S.; Ma, J.; Yang, Z. Molecular cytogenetic characterization of Dasypyrum breviaristatum chromosomes in wheat background revealing the genomic divergence between Dasypyrum species. Mol. Cytogenet. 2016, 9, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Yang, F.; Liu, Q.; Wang, Q.; Yang, N.; Li, J.; Wan, H.; Liu, Z.; Yang, S.; Wang, Y.; Zhang, J.; et al. Characterization of the Durum Wheat-Aegilops tauschii 4D(4B) Disomic Substitution Line YL-443 with Superior Characteristics of High Yielding and Stripe Rust Resistance. Front. Plant Sci. 2021, 12, 745290. [Google Scholar] [CrossRef]
  69. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.D.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Green Version]
  70. Pertea, G.; Huang, X.; Liang, F.; Antonescu, V.; Sultana, R.; Karamycheva, S.; Lee, Y.; White, J.; Cheung, F.; Parvizi, B.; et al. TIGR Gene Indices clustering tools (TGICL): A software system for fast clustering of large EST datasets. Bioinformatics 2003, 19, 651–652. [Google Scholar] [CrossRef] [Green Version]
Plants 11 01329 g001 550
Figure 1. FISH patterns of 22-12 and 24-20. (A,C), Chromosomes of 22-12 (A) and 24-20 (C) stained with DAPI (blue), Oligo-Ku (red), Oligo-PHV62-1(white) and Oligo-D (green). (B,D), Chromosomes of 22-12 (B) and 24-20 (D) stained with DAPI (blue), Oligo-pTa535 (red) and Oligo-pSc119.2 (green). (E), FISH karyotype of individual chromosomes in CS (left), 22-12 (middle) and 24-20 (right); The A, B, D and V in (E) indicated A subgenome, B subgenome, D subgenome and 3V#3 chromosome, respectively; the wheat and 3V#3 chromosomes were stained with DAPI (blue), Oligo-pTa535 (red), Oligo-pSc119.2 (green) and Oligo-pHv62-1(white); the translocations (left) were stained with DAPI (blue), Oligo-Ku (red), Oligo-pHv62-1(white) and Oligo-D (green), and the translocations (right) were stained with DAPI (blue), Oligo-pTa535 (red), Oligo-pSc119.2 (green). The white arrows show 3V#3S.3DL, and the yellow arrows indicate 3DS.3V#3L. The asterisks indicate the chromosomes showing different signal patterns with respect to CS.
Figure 1. FISH patterns of 22-12 and 24-20. (A,C), Chromosomes of 22-12 (A) and 24-20 (C) stained with DAPI (blue), Oligo-Ku (red), Oligo-PHV62-1(white) and Oligo-D (green). (B,D), Chromosomes of 22-12 (B) and 24-20 (D) stained with DAPI (blue), Oligo-pTa535 (red) and Oligo-pSc119.2 (green). (E), FISH karyotype of individual chromosomes in CS (left), 22-12 (middle) and 24-20 (right); The A, B, D and V in (E) indicated A subgenome, B subgenome, D subgenome and 3V#3 chromosome, respectively; the wheat and 3V#3 chromosomes were stained with DAPI (blue), Oligo-pTa535 (red), Oligo-pSc119.2 (green) and Oligo-pHv62-1(white); the translocations (left) were stained with DAPI (blue), Oligo-Ku (red), Oligo-pHv62-1(white) and Oligo-D (green), and the translocations (right) were stained with DAPI (blue), Oligo-pTa535 (red), Oligo-pSc119.2 (green). The white arrows show 3V#3S.3DL, and the yellow arrows indicate 3DS.3V#3L. The asterisks indicate the chromosomes showing different signal patterns with respect to CS.
Plants 11 01329 g001
Plants 11 01329 g002 550
Figure 2. PCR products of PLUG markers in CS, CD-3, D. villosum, 22-12 and 24-20. (A–D) PCR amplification generated by the markers TNAC1248, TNAC1326, TNAC1267 and TNAC1359 respectively; M, Trans2k plus DNA markers (TransGen Biotech, Beijing, China); 1, common wheat CS “Chinese Spring”; 2, CD-3; 3, D. villosum; 4, 22-12; 5, 24-20. The arrows indicate D. villosum-specific bands.
Figure 2. PCR products of PLUG markers in CS, CD-3, D. villosum, 22-12 and 24-20. (A–D) PCR amplification generated by the markers TNAC1248, TNAC1326, TNAC1267 and TNAC1359 respectively; M, Trans2k plus DNA markers (TransGen Biotech, Beijing, China); 1, common wheat CS “Chinese Spring”; 2, CD-3; 3, D. villosum; 4, 22-12; 5, 24-20. The arrows indicate D. villosum-specific bands.
Plants 11 01329 g002
Plants 11 01329 g003 550
Figure 3. Phenotypic response to stripe rust of D. villosum, CD-3, 22-12, 24-20 and CS.
Figure 3. Phenotypic response to stripe rust of D. villosum, CD-3, 22-12, 24-20 and CS.
Plants 11 01329 g003
Plants 11 01329 g004 550
Figure 4. PCR patterns obtained with the primers 3V#3-1–3V#3-12 for wheat–D. villosum derivatives and their parents. M is Trans2K plus DNA marker, 1–5 are CS, CD-3, D. villosum accession PI 491576, 22-12 and 24-20, respectively. (A–L) Markers 3V#3-1–3V#3-12. The arrows showe D. villosum-specific bands.
Figure 4. PCR patterns obtained with the primers 3V#3-1–3V#3-12 for wheat–D. villosum derivatives and their parents. M is Trans2K plus DNA marker, 1–5 are CS, CD-3, D. villosum accession PI 491576, 22-12 and 24-20, respectively. (A–L) Markers 3V#3-1–3V#3-12. The arrows showe D. villosum-specific bands.
Plants 11 01329 g004
Plants 11 01329 g005 550
Figure 5. PCR patterns of 18 primers 3V#4 for wheat-D. villosum translocations and their parents. M indicates Trans2K plus DNA marker, 1–5 are CS, CD-3, D. villosum accession PI 491576, 22-12 and 24-20, respectively. (A–R) Markers 3V#4-1, 3V#4-2, 3V#4-3, 3V#4-5, 3V#4-7, 3V#4-11, 3V#4-12, 3V#4-14, 3V#4-16, 3V#4-17, 3V#4-18, 3V#4-19, 3V#4-20, 3V#4-21, 3V#4-22, 3V#4-24, 3V#4-26, 3V#4-27. The arrows show D. villosum-specific bands.
Figure 5. PCR patterns of 18 primers 3V#4 for wheat-D. villosum translocations and their parents. M indicates Trans2K plus DNA marker, 1–5 are CS, CD-3, D. villosum accession PI 491576, 22-12 and 24-20, respectively. (A–R) Markers 3V#4-1, 3V#4-2, 3V#4-3, 3V#4-5, 3V#4-7, 3V#4-11, 3V#4-12, 3V#4-14, 3V#4-16, 3V#4-17, 3V#4-18, 3V#4-19, 3V#4-20, 3V#4-21, 3V#4-22, 3V#4-24, 3V#4-26, 3V#4-27. The arrows show D. villosum-specific bands.
Plants 11 01329 g005
Table
Table 1. PLUG primers belonging to Triticeae homoeologous Group 3 used in the study.
Table 1. PLUG primers belonging to Triticeae homoeologous Group 3 used in the study.
Marker NamePrimer Sequence (5′–3′)Wheat Bin Map LocationWheat Chromosomal LocationRestriction EnzymesLength of 3V Bands, bp
TNAC1248F: ATGATGCAGCAGCAAATTACA3AS4-0.45-1.003AS-211.50TaqI1000
R: CTGAGGAGCCTCTCCAACTCTC-3BS1-0.333BS-251.65
3DS3-0.24-0.313DS-172.90
TNAC1326F:ACAGATCGAGATGTTTATTGAAA3AS4-0.45-1.003AS-137.91TaqI750
R: GATCAAAGAGATGCGCTGAAG3BS1-0.33-0.573BS-181.49
3DS10-0.31-0.443DS-127.34
TNAC1267F: GAGAGGCAGCTTCACTAGCAG3AL3-0.42-0.613AL-522.17TaqI200
R: CGTCAGGATCAGCTCTCATGT3BL2-0.22-0.413BL-527.29
3DL1-0.23-0.813DL-401.87
TNAC1359F: GTAAATAGCGCCATCTGCGTA3AL3-0.42-0.613AL-531.08TaqI750
R: CTCTGGATGCAGTTGGAATGT3BL3-0.41-0.503BL-547.12
3DL1-0.23-0.813DL-419.90
Table
Table 2. Localization of the new markers and D. villosum#4-specific markers in D. villosum#3, their primer sequences and product sizes.
Table 2. Localization of the new markers and D. villosum#4-specific markers in D. villosum#3, their primer sequences and product sizes.
Primers No.Primer Sequences(5’–3’)Localization in D. villosum#3Localization in WheatProduct Size in D. villosum#3 (bp)Product Size in D. villosum#4 (bp)
ForwardReverse
3V#3-1GCCTCATGCGGCTGTTGGGAGGTCATGGTGAGCACGAGA3V#3S3BS148-
3V#3-2CGGCAAGAGGTCGATGGTTGACCCACGCACGCACTA3V#3L1DS210-
3V#3-3GCGTCTTGGATGTCCTGCGATTTGCTGCCCTACAT3V#3L3AL177-
3V#3-4GCATGATAGAGAGGTTAGCCATCACTGGTGATGTTGTTCAGTACT3V#3S1AL90-
3V#3-5TCGATACAATTGTTCTTGAGATATGACTGGTGCCCTCTTGACG3V#3L3AL560-
3V#3-6AAACAATCTAGCACTACCCAGAGGAAGAGGAAGAGAAATAAGCGAGG3V#3L3DL166-
3V#3-7AGGTCCTTGTCCGAGGTGATATGTTACCGATACTGATGCCACT3V#3S3AS982-
3V#3-8ATGCTGAACGCAAGGTCAAATATGCTGAAGCCCATCACGAAG3V#3L3DL1500-
3V#3-9CGACTGGTCCACCGTTTCCGCTGCCTAGTTACCTCTGTT3V#3L3DL1700-
3V#3-10CTTTCAAGGTAATCCCAGAACTTGGAAAGCAAACAGGATACG3V#3S3AS126-
3V#3-11TACGAATAACAACTGCAAGCAGAATTGCTAATGGCATCAGCGTCA3V#3L3DL1302-
3V#3-12CGACTGGTCCACCGTTTCCGCTGCCTAGTTACCTCTGTT3V#3L3AL1700-
3V#4-1 *TCCATCATAGCACCTTCAGACTCAAGGACAACTCGGCAATCACCAAGGA3V#3S5BL850377
3V#4-2 *GGCAACTCAAATTATAGGATCACGACGCAAGGCGGAGTAGCTCACA3V#3L5DL243243
3V#4-3 *TTCGTCATCTTTGTTGACATGGCAAGCAAGGCGGAGTAGCTCACA3V#3L5DL240263
3V#4-5 *TTAGAGCGACGACAACTATGCCAGTATAAGATAGGAGAAGCGACAG3V#3L3AL175175
3V#4-7 *GTTATATCGGTTGAGGCGTCTATACAACAGTGAGTTCTTCAGGACAGA3V#3L3DL700341
3V#4-11 *CTCGTCGGTCTCAGAAGTCAATCCACAGAATCATCGGCTCTC3V#3L3DL760760
3V#4-12 *CCTCCTCTTCCTCCTCTTCCTCGCACCATCACCGTACTT3V#3L3DL499499
3V#4-14 *GGACGGATGTAGTCTTGTTCAACTCGTATCGTACTGCTACTCA3V#3L3DL593593
3V#4-16 *GTCCACCAAATCACATCAAACAGCTCTCACAAGTCACAACAATT3V#3L3DL180180
3V#4-17 *ACCATATACTTCGGTGGAACATACGCATAGTTACTCTATCACAGACTCA3V#3L3DL304304
3V#4-18 *TACCATATACTTCGGTGGAACATACGCATAGTTACTCTATCACAGACTCA3V#3L3DL305305
3V#4-19 *TGCTCTTCACAGTTCATCTCCTAGACAAGTTCAGTTCCACACTC3V#3L3DL364364
3V#4-20 *TGGTTGCTTCTCAGTTGTGTTGTACTCGGATAGTGCCTTGTTGA3V#3S3AS600237
3V#4-21 *GTTGCTTCTCAGTTGTGTTGGATACTCGGATAGTGCCTTGTTGA3V#3S3AS600235
3V#4-22 *TGGTTGCTTCTCAGTTGTGTTGCGGATAGTGCCTTGTTGATGAC3V#3S3AS600233
3V#4-24 *GAGAACTGCTCAACATGACAATAAGCAACAGTATCATCAATGGAGGTCTT3V#3S3DS144144
3V#4-26 *TCGCCAGCACCAACCAATCAGCACAGCACACCAATGAA3V#3S3DS686686
3V#4-27 *GTGACACCAATAGAAGGCAGAAGGAGGAGCATACCGTGGAA3V#3S3AS403403
* indicates primers reported by Li et al. [37]. Bold font means different products’ sizes between D.villsoum#3 and D. villosum#4.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, J.; Tang, S.; Lang, T.; Wang, Y.; Long, H.; Deng, G.; Chen, Q.; Guo, Y.; Xuan, P.; Xiao, J.; et al. Molecular Cytogenetic Identification of the Wheat–Dasypyrum villosum T3DL·3V#3S Translocation Line with Resistance against Stripe Rust. Plants 2022, 11, 1329. https://doi.org/10.3390/plants11101329

AMA Style

Zhang J, Tang S, Lang T, Wang Y, Long H, Deng G, Chen Q, Guo Y, Xuan P, Xiao J, et al. Molecular Cytogenetic Identification of the Wheat–Dasypyrum villosum T3DL·3V#3S Translocation Line with Resistance against Stripe Rust. Plants. 2022; 11(10):1329. https://doi.org/10.3390/plants11101329

Chicago/Turabian Style

Zhang, Jie, Shuyao Tang, Tao Lang, Ying Wang, Hai Long, Guangbing Deng, Qian Chen, Yuanlin Guo, Pu Xuan, Jun Xiao, and et al. 2022. "Molecular Cytogenetic Identification of the Wheat–Dasypyrum villosum T3DL·3V#3S Translocation Line with Resistance against Stripe Rust" Plants 11, no. 10: 1329. https://doi.org/10.3390/plants11101329

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop