A Pipeline NanoTRF as a New Tool for De Novo Satellite DNA Identification in the Raw Nanopore Sequencing Reads of Plant Genomes
Abstract
:1. Introduction
2. Results
2.1. Description of NanoTRF
2.2. TR Abundancy Calculated from Long (NanoTRF) and Short (TAREAN) Reads Are Well Correlated
2.3. NanoTRF Data for Clustered and Dispersed TRs
2.4. Cluster Annotation Showed an Association between TR and Transposable Elements
3. Discussion
4. Materials and Methods
4.1. Overview of NanoTRF
4.2. Plant Material and DNA Isolation
4.3. Library Preparation and Nanopore Sequencing
4.4. Search of TRs in Illumina Data by TAREAN Software
4.5. Fluorescence in Situ Hybridization
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Garrido-Ramos, M.A. Satellite DNA: An evolving topic. Genes 2017, 8, 230. [Google Scholar]
- Shatskikh, A.S.; Kotov, A.A.; Adashev, V.E.; Bazylev, S.S.; Olenina, L.V. Functional Significance of Satellite DNAs: Insights from Drosophila. Front. Cell Dev. Biol. 2020, 8, 312. [Google Scholar] [CrossRef]
- Plohl, M.; Meštrović, N.; Mravinac, B. Satellite DNA evolution. Genome Dyn. 2012, 7, 126–152. [Google Scholar]
- Plohl, M.; Meštrović, N.; Mravinac, B. Centromere identity from the DNA point of view. Chromosoma 2014, 123, 313–325. [Google Scholar]
- Hartley, G.; O’Neill, R.J. Centromere Repeats: Hidden Gems of the Genome. Genes 2019, 10, 223. [Google Scholar]
- Talbert, P.B.; Henikoff, S. What Makes a Centromere? Exp. Cell Res. 2020, 389, 111895. [Google Scholar]
- Ferree, P.M.; Barbash, D.A. Species-Specific Heterochromatin Prevents Mitotic Chromosome Segregation to Cause Hybrid Lethality in Drosophila. PLoS Biol. 2009, 7, e1000234. [Google Scholar] [CrossRef]
- Nadachowska-Brzyska, K.; Burri, R.; Olason, P.I.; Kawakami, T.; Smeds, L.; Ellegren, H. Demographic Divergence History of Pied Flycatcher and Collared Flycatcher Inferred from Whole-Genome Re-Sequencing Data. PLoS Genet. 2013, 9, e1003942. [Google Scholar] [CrossRef]
- Amosova, A.V.; Yurkevich, O.Y.; Bolsheva, N.L.; Samatadze, T.E.; Zoshchuk, S.A.; Muravenko, O.V. Repeatome Analyses and Satellite DNA Chromosome Patterns in Deschampsia sukatschewii, D. cespitosa, and D. antarctica (Poaceae). Genes 2022, 13, 762. [Google Scholar] [CrossRef]
- Saint-Oyant, L.H.; Ruttink, T.; Hamama, L.; Kirov, I.; Lakhwani, D.; Zhou, N.-N.; Bourke, P.; Daccord, N.; Leus, L.; Schulz, D. A High-Quality Genome Sequence of Rosa Chinensis to Elucidate Ornamental Traits. Nat. Plants 2018, 4, 473–484. [Google Scholar]
- Divashuk, M.G.; Alexandrov, O.S.; Razumova, O.V.; Kirov, I.V.; Karlov, G.I. Molecular Cytogenetic Characterization of the Dioecious Cannabis Sativa with an XY Chromosome Sex Determination System. PLoS ONE 2014, 9, e85118. [Google Scholar] [CrossRef]
- Kirov, I.; Gilyok, M.; Knyazev, A.; Fesenko, I. Pilot Satellitome Analysis of the Model Plant, Physcomitrella patens, Revealed a Transcribed and High-Copy IGS Related Tandem Repeat. Comp. Cytogenet. 2018, 12, 493. [Google Scholar]
- Kirov, I.V.; Kiseleva, A.V.; Laere, K.V.; Roy, N.V.; Khrustaleva, L.I. Tandem Repeats of Allium Fistulosum Associated with Major Chromosomal Landmarks. Mol. Genet. Genom. 2017, 292, 453–464. [Google Scholar]
- Vondrak, T.; Robledillo, L.Á.; Novák, P.; Koblížková, A.; Neumann, P.; Macas, J. Characterization of Repeat Arrays in Ultra-Long Nanopore Reads Reveals Frequent Origin of Satellite DNA from Retrotransposon-Derived Tandem Repeats. Plant J. 2020, 101, 484–500. [Google Scholar] [CrossRef]
- Macas, J.; Navrátilová, A.; Koblížková, A. Sequence Homogenization and Chromosomal Localization of VicTR-B Satellites Differ between Closely Related Vicia Species. Chromosoma 2006, 115, 437–447. [Google Scholar]
- Amosova, A.V.; Ghukasyan, L.; Yurkevich, O.Y.; Bolsheva, N.L.; Samatadze, T.E.; Zoshchuk, S.A.; Muravenko, O.V. Cytogenomics of Deschampsia P. Beauv. (Poaceae) Species Based on Sequence Analyses and FISH Mapping of CON/COM Satellite DNA Families. Plants 2021, 10, 1105. [Google Scholar] [CrossRef]
- Hobza, R.; Lengerova, M.; Svoboda, J.; Kubekova, H.; Kejnovsky, E.; Vyskot. An Accumulation of Tandem DNA Repeats on the Y Chromosome in Silene Latifolia during Early Stages of Sex Chromosome Evolution. Chromosoma 2006, 115, 376. [Google Scholar]
- Kato, A.; Vega, J.M.; Han, F.; Lamb, J.C.; Birchler, J.A. Advances in Plant Chromosome Identification and Cytogenetic Techniques. Curr. Opin. Plant Biol. 2005, 8, 148–154. [Google Scholar]
- Tang, S.; Tang, Z.; Qiu, L.; Yang, Z.; Li, G.; Lang, T.; Zhu, W.; Zhang, J.; Fu, S. Developing New Oligo Probes to Distinguish Specific Chromosomal Segments and the A, B, D Genomes of Wheat (Triticum aestivum L.) Using ND-FISH. Front. Plant Sci. 2018, 9, 1104. [Google Scholar]
- Xi, W.; Tang, S.; Du, H.; Luo, J.; Tang, Z.; Fu, S. ND-FISH-Positive Oligonucleotide Probes for Detecting Specific Segments of Rye (Secale cereale L.) Chromosomes and New Tandem Repeats in Rye. Crop J. 2020, 8, 171–181. [Google Scholar]
- Xiao, Z.; Tang, S.; Qiu, L.; Tang, Z.; Fu, S. Oligonucleotides and ND-FISH Displaying Different Arrangements of Tandem Repeats and Identification of Dasypyrum Villosum Chromosomes in Wheat Backgrounds. Molecules 2017, 22, 973. [Google Scholar]
- Zhu, M.; Du, P.; Zhuang, L.; Chu, C.; Zhao, H.; Qi, Z. A Simple and Efficient Non-Denaturing FISH Method for Maize Chromosome Differentiation Using Single-Strand Oligonucleotide Probes. Genome 2017, 60, 657–664. [Google Scholar]
- Kit, S. Equilibrium Sedimentation in Density Gradients of DNA Preparations from Animal Tissues. J. Mol. Biol. 1961, 3, 711-IN2. [Google Scholar]
- Alix, K.; Baurens, F.-C.; Paulet, F.; Glaszmann, J.-C.; D’Hont, A. Isolation and Characterization of a Satellite DNA Family in the Saccharum Complex. Genome 1998, 41, 854–864. [Google Scholar]
- Waye, J.S.; Willard, H.F. Human Beta Satellite DNA: Genomic Organization and Sequence Definition of a Class of Highly Repetitive Tandem DNA. Proc. Natl. Acad. Sci. USA 1989, 86, 6250–6254. [Google Scholar]
- Divashuk, M.; Alexandrov, O.; Kroupin, P.Y.; Karlov, G. Molecular Cytogenetic Mapping of Humulus Lupulus Sex Chromosomes. Cytogenet. Genome Res. 2011, 134, 213–219. [Google Scholar]
- Benson, G. Tandem Repeats Finder: A Program to Analyze DNA Sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar]
- Sharma, D.; Issac, B.; Raghava, G.P.; Ramaswamy, R. Spectral Repeat Finder (SRF): Identification of Repetitive Sequences Using Fourier Transformation. Bioinformatics 2004, 20, 1405–1412. [Google Scholar] [CrossRef]
- Yadav, Y.; Sharma, S.N.; Shakya, D.K. Detection of Tandem Repeats in DNA Sequences Using Short-Time Ramanujan Fourier Transform. In Transactions on Computational Biology and Bioinformatics; IEEE/ACM: New York, NY, USA, 2021; pp. 1583–1591. [Google Scholar] [CrossRef]
- Peona, V.; Weissensteiner, M.H.; Suh, A. How Complete Are “Complete” Genome Assemblies?—An Avian Perspective. Mol. Ecol. Resour. 2018, 18, 1188–1195. [Google Scholar]
- Tørresen, O.K.; Star, B.; Mier, P.; Andrade-Navarro, M.A.; Bateman, A.; Jarnot, P.; Gruca, A.; Grynberg, M.; Kajava, A.V.; Promponas, V.J.; et al. Tandem Repeats Lead to Sequence Assembly Errors and Impose Multi-Level Challenges for Genome and Protein Databases. Nucleic Acids Res. 2019, 47, 10994–11006. [Google Scholar] [CrossRef]
- Novak, P.; Neumann, P.; Pech, J.; Steinhaisl, J.; Macas, J. RepeatExplorer: A Galaxy-Based Web Server for Genome-Wide Characterization of Eukaryotic Repetitive Elements from next-Generation Sequence Reads. Bioinformatics 2013, 29, 792–793. [Google Scholar]
- Novák, P.; Ávila Robledillo, L.; Koblížková, A.; Vrbová, I.; Neumann, P.; Macas, J. TAREAN: A Computational Tool for Identification and Characterization of Satellite DNA from Unassembled Short Reads. Nucleic Acids Res. 2017, 45, e111. [Google Scholar] [CrossRef]
- Lower, S.S.; McGurk, M.P.; Clark, A.G.; Barbash, D.A. Satellite DNA Evolution: Old Ideas, New Approaches. Curr. Opin. Genet. Dev. 2018, 49, 70–78. [Google Scholar]
- Peška, V.; Mandáková, T.; Ihradská, V.; Fajkus, J. Comparative Dissection of Three Giant Genomes: Allium Cepa, Allium Sativum, and Allium Ursinum. Int. J. Mol. Sci. 2019, 20, 733. [Google Scholar]
- Kreplak, J.; Madoui, M.-A.; Cápal, P.; Novák, P.; Labadie, K.; Aubert, G.; Bayer, P.E.; Gali, K.K.; Syme, R.A.; Main, D. A Reference Genome for Pea Provides Insight into Legume Genome Evolution. Nat. Genet. 2019, 51, 1411–1422. [Google Scholar]
- González, M.L.; Chiapella, J.O.; Urdampilleta, J.D. Characterization of Some Satellite DNA Families in Deschampsia antarctica (Poaceae). Polar Biol. 2018, 41, 457–468. [Google Scholar]
- González, M.L.; Chiapella, J.; Topalian, J.; Urdampilleta, J.D. Genomic Differentiation of Deschampsia antarctica and D. cespitosa (Poaceae) Based on Satellite DNA. Bot. J. Linn. Soc. 2020, 194, 326–341. [Google Scholar] [CrossRef]
- Dvorkina, T.; Bzikadze, A.V.; Pevzner, P.A. The String Decomposition Problem and Its Applications to Centromere Analysis and Assembly. Bioinformatics 2020, 36, i93–i101. [Google Scholar] [CrossRef]
- Miga, K.H.; Koren, S.; Rhie, A.; Vollger, M.R.; Gershman, A.; Bzikadze, A.; Brooks, S.; Howe, E.; Porubsky, D.; Logsdon, G.A.; et al. Telomere-to-Telomere Assembly of a Complete Human X Chromosome. Nature 2020, 585, 79–84. [Google Scholar] [CrossRef]
- Gao, Y.; Liu, B.; Wang, Y.; Xing, Y. TideHunter: Efficient and Sensitive Tandem Repeat Detection from Noisy Long-Reads Using Seed-and-Chain. Bioinformatics 2019, 35, i200–i207. [Google Scholar] [CrossRef]
- Harris, R.S.; Cechova, M.; Makova, K.D. Noise-Cancelling Repeat Finder: Uncovering Tandem Repeats in Error-Prone Long-Read Sequencing Data. Bioinformatics 2019, 35, 4809–4811. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Huang, X.; Madan, A. CAP3: A DNA Sequence Assembly Program. Genome Res. 1999, 9, 868–877. [Google Scholar] [CrossRef]
- Lee, H.-R.; Zhang, W.; Langdon, T.; Jin, W.; Yan, H.; Cheng, Z.; Jiang, J. Chromatin Immunoprecipitation Cloning Reveals Rapid Evolutionary Patterns of Centromeric DNA in Oryza Species. Proc. Natl. Acad. Sci. USA 2005, 102, 11793–11798. [Google Scholar]
- Talbert, P.B.; Kasinathan, S.; Henikoff, S. Simple and Complex Centromeric Satellites in Drosophila Sibling Species. Genetics 2018, 208, 977–990. [Google Scholar] [CrossRef]
- Wang, B.; Yang, X.; Jia, Y.; Xu, Y.; Jia, P.; Dang, N.; Wang, S.; Xu, T.; Zhao, X.; Gao, S.; et al. High-quality Arabidopsis thaliana genome assembly with nanopore and HiFi long reads. Genom. Proteom. Bioinform. 2021. [Google Scholar] [CrossRef]
- Naish, M.; Alonge, M.; Wlodzimierz, P.; Tock, A.J.; Abramson, B.W.; Schmücker, A.; Mandáková, T.; Jamge, B.; Lambing, C.; Kuo, P.; et al. The genetic and epigenetic landscape of the Arabidopsis centromeres. Science 2021, 374, eabi7489. [Google Scholar]
- Buchfink, B.; Xie, C.; Huson, D.H. Fast and Sensitive Protein Alignment Using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef]
- Neumann, P.; Novák, P.; Hoštáková, N.; Macas, J. Systematic Survey of Plant LTR-Retrotransposons Elucidates Phylogenetic Relationships of Their Polyprotein Domains and Provides a Reference for Element Classification. Mob. DNA (UK) 2019, 10, 1. [Google Scholar] [CrossRef]
- Cock, P.J.A.; Antao, T.; Chang, J.T.; Chapman, B.A.; Cox, C.J.; Dalke, A.; Friedberg, I.; Hamelryck, T.; Kauff, F.; Wilczynski, B.; et al. Biopython: Freely Available Python Tools for Computational Molecular Biology and Bioinformatics. Bioinformatics 2009, 25, 1422–1423. [Google Scholar] [CrossRef]
- Hagberg, A.; Swart, P.; Chult, D.S. Exploring Network Structure, Dynamics, and Function Using NetworkX. In Proceedings of the 7th Python in Science Conference, Pasadena, CA, USA, 1 January 2008. [Google Scholar]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics (Oxf. Engl.) 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Gerlach, W.L.; Bedbrook, J.R. Cloning and Characterization of Ribosomal RNA Genes from Wheat and Barley. Nucleic Acids Res. 1979, 7, 1869–1885. [Google Scholar] [CrossRef]
Tandem Repeat/Genome Proportion, % | Length, bp | Sequence |
---|---|---|
Da 97/0.21 | 342 | CCCACGGGCTAGGGTTTCGCTGGAAAAGTACCGCCGGAGCGCCGGAATCCCACGAAAACTTGCGTGTGGCCCTAGCATGCATGCACAAGTGTGGTGGAAGGTTCCTAGATGCAATACGTAGCTCCCGGGTGCGATCCTGTTCGCGCGCATGCGATAACACTTAGAAAACTGCTGGACCTCTGGGAGGAATCTCCCGCTACGGGTCAAACGGAGGGCAACCGGTGGAATCATGGGCCCAACCTTGGTTTTCCATGTAGATATGCCCTAAACAAACCCAAACCAACAAAAAAGTACATTGGTCAACCCTCGTACGGAGAATGCTAGGGGGCTAGACCTGCGGGT |
Da 238/0.042 | 379 | GCCTAACACCCTATCGTAGACACCCATGGGTTGGGGCGCAGTGCACGTAATACTATACGGATCCAGCGTTCCATCGAATTTTGAGTTTTTACTGCAGAAACTTCCATTTTTCCTAGACTTGTGAGCACTTTTTGAGGCCCTAAAAAGGCTTTTTTGGGGTCGAGATGGTCCGCACGCGTGCTGGGGTGTGTGCACGTATGTAAAATCATCCGGATTGCAAAAATTAGAAGTCCTTTTATC CTAGTTCTCCGAGATCTTTCTAACGCCTTCGAAACCGCCTCAATCGGAGCTCGTTCTCATTCGCGTCGTTAGTATTAACAAAGTTCCTCCGTACGATGATCCTTTGCTTTCAACGGTCACCGTTTCTTCTCAGGCGTGA |
Da 322/0.013 | 342 | GGTCTAGGGTTTCCCCGGATACAGACCACCGGAGCGTCGGAATCGCTGGAAAACTTGCATGTGTCCCTAACATATGTGTACAAGTGTGATGTAAGGTTGGTAGATGGCATATCTAGGTCCCAGGCGTGACGCTGTTCGCAGACATGGGCTAACACTTGGTAAAATCCTGGATCTGTATGTGGAAACTCCCGCTACGGGTCAACCGGAGCCTATTTTATGGTAAAGTAGGCCCAACCTCTGCTTTCCATGTACATATGTCCTAAACAAACCAAAACAAGGAAAAAACTCCATTGGTAAACCCTCGTACGGAGAAAGCTATAGGGGTAGATCTGCGGGGTCCCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kirov, I.; Kolganova, E.; Dudnikov, M.; Yurkevich, O.Y.; Amosova, A.V.; Muravenko, O.V. A Pipeline NanoTRF as a New Tool for De Novo Satellite DNA Identification in the Raw Nanopore Sequencing Reads of Plant Genomes. Plants 2022, 11, 2103. https://doi.org/10.3390/plants11162103
Kirov I, Kolganova E, Dudnikov M, Yurkevich OY, Amosova AV, Muravenko OV. A Pipeline NanoTRF as a New Tool for De Novo Satellite DNA Identification in the Raw Nanopore Sequencing Reads of Plant Genomes. Plants. 2022; 11(16):2103. https://doi.org/10.3390/plants11162103
Chicago/Turabian StyleKirov, Ilya, Elizaveta Kolganova, Maxim Dudnikov, Olga Yu. Yurkevich, Alexandra V. Amosova, and Olga V. Muravenko. 2022. "A Pipeline NanoTRF as a New Tool for De Novo Satellite DNA Identification in the Raw Nanopore Sequencing Reads of Plant Genomes" Plants 11, no. 16: 2103. https://doi.org/10.3390/plants11162103