DNA Free CRISPR/DCAS9 Based Transcriptional Activation System for UGT76G1 Gene in Stevia rebaudiana Bertoni Protoplasts
Abstract
:1. Introduction
2. Results
2.1. Optimized sgRNAs Designing and Selection of Efficient sgRNAs
2.2. Assessment of the Effect of Enzyme Solutions on Releasing of Living Protoplast from Stevia
2.3. Assessment of Yield and Viability of Protoplasts Isolated from Leaf Mesophyll and Callus of Stevia by Using Different Enzyme Solutions
2.4. PEG-Mediated Transfection of Protoplast with dCas9-TADs RNP
2.5. Quality and Concentrations of RNAs Isolated from Transfected Protoplasts of Stevia and cDNAs
2.6. Impact of Different sgRNA Positions on the Transcriptional Activation Level of UGT76G1 in Stevia Protoplast Transfected with Different RNP Complexes
2.7. Effect on the Expression Level of Other Key UGTs Involved in SG Biosynthesis Pathway by Transcriptional Activation of UGT76G1 in Stevia Protoplasts
3. Discussion
4. Materials and Methods
4.1. PCR Amplification of UGT76G1 and Sequencing
4.2. Finding and Retrieving Promoter Sequence from Sequenced Data of the UGT76G1 for Potential CRISPR Targets and Designing of Single Guide RNA (sgRNA)
4.3. Designing of Single Guide RNA-DNA Template
4.4. Designing of Forward and Reverse Oligonucleotides for PCR Assembly
4.5. PCR Assembly and In Vitro Transcription of Single Guide RNAs (sgRNAs)
4.6. Designing of CRISPR/dCas9- Based Transcriptional Activator (dCas9-VP64)
4.7. Plasmid Purification, Synthesis, and Construction of CRISPR/dCas9-Based Transcriptional Activators
4.8. Recombinant Protein Expression of pET-dCas9-TADs-6xHis Transcriptional Activators
4.8.1. Transformation of pET-dCas9-TADs-6xHis Plasmids
4.8.2. Expression of pET-dCas9-TADs-6xHis Proteins
4.8.3. Isolation of pET-dCas9-TADs-6His Proteins
4.8.4. Purification, Desalting, and Concentrating of pET-dCas9-TADs-6His Proteins
4.9. Enzymes for protoplast isolation
4.9.1. Enzyme Solution (Digestion Solution)
4.9.2. W5 Solution
4.9.3. MMG Solution
4.9.4. WI Solution
4.9.5. PEG-Calcium Transfection Solution
4.9.6. FDA Solution
4.10. Protoplast Isolation from Leaf Mesophyll and Callus Tissue
4.11. Assessment of Protoplast Yield and Viability
4.12. Ribonucleoprotein (RNP) Complexes Preparation
4.13. PEG-Mediated Transfection of Protoplasts with dCas9-TADs RNP Complexes
4.14. RNA Extraction from Transfected Protoplasts and cDNA Synthesis
4.15. qPCR Analysis
4.16. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sreedhar, R.V.; Venkatachalam, L.; Thimmaraju, R.; Bhagyalakshmi, N.; Narayan, M.S.; Ravishankar, G.A. Direct Organogenesis from Leaf Explants of Stevia rebaudiana and Cultivation in Bioreactor. Biol. Plant 2008, 52, 355–360. [Google Scholar] [CrossRef]
- Ghaheri, M.; Kahrizi, D.; Bahrami, G.; Mohammadi-Motlagh, H.R. Study of Gene Expression and Steviol Glycosides Accumulation in Stevia rebaudiana Bertoni under Various Mannitol Concentrations. Mol. Biol. Rep. 2019, 46, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Ceunen, S.; Geuns, J.M.C. Steviol Glycosides: Chemical Diversity, Metabolism, and Function. J. Nat. Prod. 2013, 76, 1201–1228. [Google Scholar] [CrossRef] [PubMed]
- Kazmi, A.; Khan, M.A.; Mohammad, S.; Ali, A.; Kamil, A.; Arif, M.; Ali, H. Elicitation Directed Growth and Production of Steviol Glycosides in the Adventitious Roots of Stevia rebaudiana Bertoni. Ind. Crops Prod. 2019, 139, 111530. [Google Scholar] [CrossRef]
- Hashem, M.M.; AbdelHamid, R.I.; AbuelMaaty, S.; Elassal, S.S.; ElDoliefy, A.E.F.A. Differential UGT76G1 and Start Codon-Based Characterization of Six Stevia Germlines in Egypt. Biocatal. Agric. Biotechnol. 2021, 33, 33101981. [Google Scholar] [CrossRef]
- Esmaeili, F.; Kahrizi, D.; Mansouri, M.; Yari, K.; Kazemi, N.; Ghaheri, M. Cell Dedifferentiation in Stevia Rebauiana as a Pharmaceutical and Medicinal Plant. J. Rep. Pharm. Sci. 2016, 5, 12–17. [Google Scholar]
- Esmaeili, F.; Ghaheri, M.; Kahrizi, D.; Mansouri, M.; Safavi, S.M.; Ghorbani, T.; Muhammadi, S.; Rahmanian, E.; Vaziri, S. Effects of Various Glutamine Concentrations on Gene Expression and Steviol Glycosides Accumulation in Stevia rebaudiana Bertoni. Cell Mol. Biol. 2018, 64, 1–5. [Google Scholar] [CrossRef]
- Gupta, E.; Purwar, S.; Sundaram, S.; Tripathi, P.; Rai, G. Stevioside and Rebaudioside a—Predominant Ent-Kaurene Diterpene Glycosides of Terapeutic Potential: A Review. Czech J. Food Sci. 2016, 34, 281–299. [Google Scholar] [CrossRef]
- Richman, A.; Swanson, A.; Humphrey, T.; Chapman, R.; McGarvey, B.; Pocs, R.; Brandle, J. Functional Genomics Uncovers Three Glucosyltransferases Involved in the Synthesis of the Major Sweet Glucosides of Stevia rebaudiana. Plant J. 2005, 41, 56–67. [Google Scholar] [CrossRef]
- Yadav, S.K.; Guleria, P. Steviol Glycosides from Stevia: Biosynthesis Pathway Review and Their Application in Foods and Medicine. Crit. Rev. Food Sci. Nutr. 2012, 52, 988–998. [Google Scholar] [CrossRef]
- Behroozi, P.; Baghizadeh, A.; Saei, A.; Kharazmi, S. Quantitative Analysis of Uridine Diphosphate Glycosyltransferase UGT85C2, UGT74G1 and UGT76G1 Genes Expression in Stevia rebaudiana under Different Irrigations. Russ. J. Plant Physiol. 2017, 64, 67–72. [Google Scholar] [CrossRef]
- Cao, J.; Yao, D.; Lin, F.; Jiang, M. PEG-Mediated Transient Gene Expression and Silencing System in Maize Mesophyll Protoplasts: A Valuable Tool for Signal Transduction Study in Maize. Acta Physiol. Plant 2014, 36, 1271–1281. [Google Scholar] [CrossRef]
- Bart, R.; Chern, M.; Park, C.J.; Bartley, L.; Ronald, P.C. A Novel System for Gene Silencing Using SiRNAs in Rice Leaf and Stem-Derived Protoplasts. Plant Methods 2006, 2, 1–9. [Google Scholar] [CrossRef]
- Tang, X.; Zheng, X.; Qi, Y.; Zhang, D.; Cheng, Y.; Tang, A.; Voytas, D.F.; Zhang, Y. A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol. Plant 2016, 9, 1088–1091. [Google Scholar] [CrossRef]
- Lin, C.S.; Hsu, C.T.; Yang, L.H.; Lee, L.Y.; Fu, J.Y.; Cheng, Q.W.; Wu, F.H.; Hsiao, H.C.W.; Zhang, Y.; Zhang, R.; et al. Application of Protoplast Technology to CRISPR/Cas9 Mutagenesis: From Single-Cell Mutation Detection to Mutant Plant Regeneration. Plant Biotechnol. J. 2018, 16, 1295–1310. [Google Scholar] [CrossRef]
- Davey, M.R.; Anthony, P.; Power, J.B.; Lowe, K.C. Plant Protoplast Technology: Current Status. Acta Physiol. Plant. 2005, 27, 117–130. [Google Scholar] [CrossRef]
- Xuan, L.T.; Menczel, L. Improved Protoplast Culture and Plant Regeneration from Protoplast-Derived Callus in Arabidopsis Thaliana. Z. Pflanzenphysiol. 1980, 96, 77–80. [Google Scholar] [CrossRef]
- Nagata, T.; Takebe, I. Plating of Isolated Tobacco Mesophyll Protoplasts on Agar Medium. Planta 1971, 99, 12–20. [Google Scholar] [CrossRef]
- Mazarei, M.; Al-Ahmad, H.; Rudis, M.R.; Stewart, C.N. Protoplast Isolation and Transient Gene Expression in Switchgrass, Panicum Virgatum L. Biotechnol. J. 2008, 3, 354–359. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, L.; He, C.; Luo, H. An Efficient Transient Mesophyll Protoplast System for Investigation of the Innate Immunity Responses in the Rubber Tree (Hevea brasiliensis). Plant Cell Tissue Organ Cult. 2016, 126, 281–290. [Google Scholar] [CrossRef]
- Masani, M.Y.A.; Noll, G.A.; Parveez, G.K.A.; Sambanthamurthi, R.; Prüfer, D. Efficient Transformation of Oil Palm Protoplasts by PEG-Mediated Transfection and DNA Microinjection. PLoS ONE 2014, 9, e96831. [Google Scholar] [CrossRef] [Green Version]
- Shen, Y.; Meng, D.; McGrouther, K.; Zhang, J.; Cheng, L. Efficient Isolation of Magnolia Protoplasts and the Application to Subcellular Localization of MdeHSF1. Plant Methods 2017, 13, 44. [Google Scholar] [CrossRef]
- Nanjareddy, K.; Arthikala, M.K.; Blanco, L.; Arellano, E.S.; Lara, M. Protoplast Isolation, Transient Transformation of Leaf Mesophyll Protoplasts and Improved Agrobacterium-Mediated Leaf Disc Infiltration of Phaseolus vulgaris: Tools for Rapid Gene Expression Analysis. BMC Biotechnol. 2016, 16, 53. [Google Scholar] [CrossRef]
- Lopez-Arellano, M.; Dhir, S.; Albino, N.; Santiago, A.; Morris, T.; Dhir, S. Somatic Embryogenesis and Plantlet Regeneration from Protoplast Culture of Stevia rebaudiana. Br. Biotechnol. J. 2015, 5, 1–12. [Google Scholar] [CrossRef]
- Rezazadeh, R.; Niedz, R.P. Protoplast Isolation and Plant Regeneration of Guava (Psidium Guajava L.) Using Experiments in Mixture-Amount Design. Plant Cell Tissue Organ Cult. 2015, 122, 585–604. [Google Scholar] [CrossRef]
- Jiang, W.; Zhou, H.; Bi, H.; Fromm, M.; Yang, B.; Weeks, D.P. Demonstration of CRISPR/Cas9/SgRNA-Mediated Targeted Gene Modification in Arabidopsis, Tobacco, Sorghum and Rice. Nucleic Acids Res. 2013, 41, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Dlugosz, E.M.; Lenaghan, S.C.; Stewart, C.N. A Robotic Platform for High-Throughput Protoplast Isolation and Transformation. J. Vis. Exp. 2016, 2016, 2–9. [Google Scholar] [CrossRef] [PubMed]
- Baltes, N.J.; Gil-Humanes, J.; Voytas, D.F. Genome Engineering and Agriculture: Opportunities and Challenges, 1st ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2017; Volume 149. [Google Scholar] [CrossRef]
- Voytas, D.F.; Gao, C. Precision Genome Engineering and Agriculture: Opportunities and Regulatory Challenges. PLoS Biol. 2014, 12, 1001877. [Google Scholar] [CrossRef]
- Sun, B.; Zheng, A.; Jiang, M.; Xue, S.; Yuan, Q.; Jiang, L.; Chen, Q.; Li, M.; Wang, Y.; Zhang, Y.; et al. CRISPR/Cas9-Mediated Mutagenesis of Homologous Genes in Chinese Kale. Sci. Rep. 2018, 8, 16786. [Google Scholar] [CrossRef]
- Liang, Z.; Chen, K.; Zhang, Y.; Liu, J.; Yin, K.; Qiu, J.L.; Gao, C. Genome Editing of Bread Wheat Using Biolistic Delivery of CRISPR/Cas9 in vitro Transcripts or Ribonucleoproteins. Nat. Protoc. 2018, 13, 413–430. [Google Scholar] [CrossRef]
- Murovec, J.; Guček, K.; Bohanec, B.; Avbelj, M.; Jerala, R. DNA-Free Genome Editing of Brassica oleracea and B. rapa Protoplasts Using CRISPR-Cas9 Ribonucleoprotein Complexes. Front. Plant Sci. 2018, 9, 1594. [Google Scholar] [CrossRef]
- Montecillo, J.A.V.; Chu, L.L.; Bae, H. CRISPR-Cas9 System for Plant Genome Editing: Current Approaches and Emerging Developments. Agronomy 2020, 10, 1033. [Google Scholar] [CrossRef]
- Zetsche, B.; Gootenberg, J.S.; Abudayyeh, O.O.; Slaymaker, I.M.; Makarova, K.S.; Essletzbichler, P.; Volz, S.E.; Joung, J.; Van Der Oost, J.; Regev, A.; et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 2015, 163, 759–771. [Google Scholar] [CrossRef]
- Schellenberger, V.; Wang, C.W.; Geething, N.C.; Spink, B.J.; Campbell, A.; To, W.; Scholle, M.D.; Yin, Y.; Yao, Y.; Bogin, O.; et al. A Recombinant Polypeptide Extends the in Vivo Half-Life of Peptides and Proteins in a Tunable Manner. Nat. Biotechnol. 2009, 27, 1186–1190. [Google Scholar] [CrossRef]
- Ryu, J.; Kim, H.; Park, H.H.; Lee, H.J.; Park, J.H.; Rhee, W.J.; Park, T.H. Protein-Stabilizing and Cell-Penetrating Properties of α-Helix Domain of 30Kc19 Protein. Biotechnol. J. 2016, 11, 1443–1451. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, D.; Xiong, X.; Yan, B.; Xie, W.; Sheen, J.; Li, J.F. A Potent Cas9-Derived Gene Activator for Plant and Mammalian Cells. Nat. Plants 2017, 3, 930–936. [Google Scholar] [CrossRef]
- Woo, J.W.; Kim, J.; Kwon, S.I.; Corvalán, C.; Cho, S.W.; Kim, H.; Kim, S.G.; Kim, S.T.; Choe, S.; Kim, J.S. DNA-Free Genome Editing in Plants with Preassembled CRISPR-Cas9 Ribonucleoproteins. Nat. Biotechnol. 2015, 33, 1162–1164. [Google Scholar] [CrossRef]
- Svitashev, S.; Schwartz, C.; Lenderts, B.; Young, J.K.; Mark Cigan, A. Genome Editing in Maize Directed by CRISPR-Cas9 Ribonucleoprotein Complexes. Nat. Commun. 2016, 7, 1–7. [Google Scholar] [CrossRef]
- Andersson, M.; Turesson, H.; Olsson, N.; Fält, A.S.; Ohlsson, P.; Gonzalez, M.N.; Samuelsson, M.; Hofvander, P. Genome Editing in Potato via CRISPR-Cas9 Ribonucleoprotein Delivery. Physiol. Plant 2018, 164, 378–384. [Google Scholar] [CrossRef]
- Subburaj, S.; Chung, S.J.; Lee, C.; Ryu, S.M.; Kim, D.H.; Kim, J.S.; Bae, S.; Lee, G.J. Site-Directed Mutagenesis in Petunia × hybrida Protoplast System Using Direct Delivery of Purified Recombinant Cas9 Ribonucleoproteins. Plant Cell Rep. 2016, 35, 1535–1544. [Google Scholar] [CrossRef]
- Malnoy, M.; Viola, R.; Jung, M.H.; Koo, O.J.; Kim, S.; Kim, J.S.; Velasco, R.; Kanchiswamy, C.N. DNA-Free Genetically Edited Grapevine and Apple Protoplast Using CRISPR/Cas9 Ribonucleoproteins. Front. Plant Sci. 2016, 7, 1904. [Google Scholar] [CrossRef] [PubMed]
- Page, M.T.; Parry, M.A.J.; Carmo-Silva, E. A High-Throughput Transient Expression System for Rice. Plant Cell Environ. 2019, 42, 2057–2064. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Kim, S.T.; Ryu, J.; Kang, B.C.; Kim, J.S.; Kim, S.G. CRISPR/Cpf1-Mediated DNA-Free Plant Genome Editing. Nat. Commun. 2017, 8, 14406. [Google Scholar] [CrossRef]
- Liang, Z.; Chen, K.; Li, T.; Zhang, Y.; Wang, Y.; Zhao, Q.; Liu, J.; Zhang, H.; Liu, C.; Ran, Y.; et al. Efficient DNA-Free Genome Editing of Bread Wheat Using CRISPR/Cas9 Ribonucleoprotein Complexes. Nat. Commun. 2017, 8, 577–580. [Google Scholar] [CrossRef] [PubMed]
- Jones, H.D. Regulatory Uncertainty over Genome Editing. Nat. Plants 2015, 1, 14011. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Cheng, X.; Shan, Q.; Zhang, Y.; Liu, J.; Gao, C.; Qiu, J.L. Simultaneous Editing of Three Homoeoalleles in Hexaploid Bread Wheat Confers Heritable Resistance to Powdery Mildew. Nat. Biotechnol. 2014, 32, 947–951. [Google Scholar] [CrossRef]
- Haun, W.; Coffman, A.; Clasen, B.M.; Demorest, Z.L.; Lowy, A.; Ray, E.; Retterath, A.; Stoddard, T.; Juillerat, A.; Cedrone, F.; et al. Improved Soybean Oil Quality by Targeted Mutagenesis of the Fatty Acid Desaturase 2 Gene Family. Plant Biotechnol. J. 2014, 12, 934–940. [Google Scholar] [CrossRef]
- Clasen, B.M.; Stoddard, T.J.; Luo, S.; Demorest, Z.L.; Li, J.; Cedrone, F.; Tibebu, R.; Davison, S.; Ray, E.E.; Daulhac, A.; et al. Improving Cold Storage and Processing Traits in Potato through Targeted Gene Knockout. Plant Biotechnol. J. 2016, 14, 169–176. [Google Scholar] [CrossRef]
- Yang, Y.H.; Yang, Y.-H.; Huang, S.-Z.; Han, Y.-L.; Yuan, H.-Y.; Gu, C.-S.; Zhao, Y.-H. Base Substitution Mutations in Uridinediphosphate-Dependent Glycosyltransferase 76G1 Gene of Stevia rebaudiana Causes the Low Levels of Rebaudioside A: Mutations in UGT76G1, A Key Gene of Steviol Glycosides Synthesis. Plant Physiol. Biochem. 2014, 80, 220–225. [Google Scholar] [CrossRef]
- Fu, Y.; Sander, J.D.; Reyon, D.; Cascio, V.M.; Joung, J.K. Improving CRISPR-Cas Nuclease Specificity Using Truncated Guide RNAs. Nat. Biotechnol. 2014, 32, 279–284. [Google Scholar] [CrossRef] [Green Version]
- Liang, G.; Zhang, H.; Lou, D.; Yu, D. Selection of Highly Efficient SgRNAs for CRISPR/Cas9-Based Plant Genome Editing. Sci. Rep. 2016, 6, 21451. [Google Scholar] [CrossRef] [PubMed]
- Hofacker, I.L. Vienna RNA Secondary Structure Server. Nucleic Acids Res. 2003, 31, 3429–3431. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.Y.; Chen, J.C.; Fang, S.C. A Protoplast Transient Expression System to Enable Molecular, Cellular, and Functional Studies in Phalaenopsis orchids. Front. Plant Sci. 2018, 9, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Ren, R.; Gao, J.; Lu, C.; Wei, Y.; Jin, J.; Wong, S.M.; Zhu, G.; Yang, F. Highly Efficient Protoplast Isolation and Transient Expression System for Functional Characterization of Flowering Related Genes in Cymbidium rchids. Int. J. Mol. Sci. 2020, 21, 2264. [Google Scholar] [CrossRef]
- Wu, F.H.; Shen, S.C.; Lee, L.Y.; Lee, S.H.; Chan, M.T.; Lin, C.S. Tape-Arabidopsis Sandwich—A Simpler Arabidopsis Protoplast Isolation Method. Plant Methods 2009, 5, 16. [Google Scholar] [CrossRef]
- Zhang, Y.; Su, J.; Duan, S.; Ao, Y.; Dai, J.; Liu, J.; Wang, P.; Li, Y.; Liu, B.; Feng, D.; et al. A Highly Efficient Rice Green Tissue Protoplast System for Transient Gene Expression and Studying Light/Chloroplast-Related Processes. Plant Methods 2011, 7, 30. [Google Scholar] [CrossRef]
- Zhao, W.; Yang, W.; Wei, C.; Sun, G. A Simple and Efficient Method for Isolation of Pineapple Protoplasts. Biotechnol. Biotechnol. Equip. 2011, 25, 2464–2467. [Google Scholar] [CrossRef]
- Kang, H.H.; Naing, A.H.; Kim, C.K. Protoplast Isolation and Shoot Regeneration from Protoplast-Derived Callus of Petunia hybrida Cv. Mirage Rose. Biology 2020, 9, 228. [Google Scholar] [CrossRef]
- Lin, Y.C.; Li, W.; Chen, H.; Li, Q.; Sun, Y.H.; Shi, R.; Lin, C.Y.; Wang, J.P.; Chen, H.C.; Chuang, L.; et al. A Simple Improved-Throughput Xylem Protoplast System for Studying Wood Formation. Nat. Protoc. 2014, 9, 2194–2205. [Google Scholar] [CrossRef]
- Guo, J.; Morrell-Falvey, J.L.; Labbé, J.L.; Muchero, W.; Kalluri, U.C.; Tuskan, G.A.; Chen, J.G. Highly Efficient Isolation of Populus Mesophyll Protoplasts and Its Application in Transient Expression Assays. PLoS ONE 2012, 7, e44908. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.; Han, N.; Wu, J.; Yang, Y.; Wang, J.; Zhu, M.; Bian, H. A Transient Gene Expression System Using Barley Protoplasts to Evaluate MicroRNAs for Post-Transcriptional Regulation of Their Target Genes. Plant Cell Tissue Organ Cult. 2014, 119, 211–219. [Google Scholar] [CrossRef]
- Jia, X.; Zhang, X.; Qu, J.; Han, R. Optimization Conditions of Wheat Mesophyll Protoplast Isolation. Agric. Sci. 2016, 7, 850–858. [Google Scholar] [CrossRef]
- Li, J.; Liao, X.; Zhou, S.; Liu, S.; Jiang, L.; Wang, G. Efficient Protoplast Isolation and Transient Gene Expression System for Phalaenopsis hybrid Cultivar ‘Ruili Beauty’. Vitr. Cell Dev. Biol.—Plant 2018, 54, 87–93. [Google Scholar] [CrossRef]
- Cheng, N.; Nakata, P.A. Development of a Rapid and Efficient Protoplast Isolation and Transfection Method for Chickpea (Cicer arietinum). MethodsX 2020, 7, 101025. [Google Scholar] [CrossRef]
- Priyadarshani, S.V.G.N.; Hu, B.; Li, W.; Ali, H.; Jia, H.; Zhao, L.; Ojolo, S.P.; Azam, S.M.; Xiong, J.; Yan, M.; et al. Simple Protoplast Isolation System for Gene Expression and Protein Interaction Studies in Pineapple (Ananas comosus L.). Plant Methods 2018, 14, 95. [Google Scholar] [CrossRef]
- Yoo, S.D.; Cho, Y.H.; Sheen, J. Arabidopsis Mesophyll Protoplasts: A Versatile Cell System for Transient Gene Expression Analysis. Nat. Protoc. 2007, 2, 1565–1572. [Google Scholar] [CrossRef]
- Kantharajah, A.S.; Dodd, W.A. Factors That Influence the Yield and Viability of Cucumber (Cucumis Sativus L) Cotyledon Protoplasts. Aust. J. Bot. 1990, 38, 169–175. [Google Scholar] [CrossRef]
- Moradpour, M.; Abdulah, S.N.A. CRISPR/DCas9 Platforms in Plants: Strategies and Applications beyond Genome Editing. Plant Biotechnol. J. 2020, 18, 32–44. [Google Scholar] [CrossRef]
- Polstein, L.R.; Gersbach, C.A. A Light-Inducible CRISPR-Cas9 System for Control of Endogenous Gene Activation. Nat. Chem. Biol. 2015, 11, 198–200. [Google Scholar] [CrossRef]
- Lowder, L.G.; Zhou, J.; Zhang, Y.; Malzahn, A.; Zhong, Z.; Hsieh, T.F.; Voytas, D.F.; Zhang, Y.; Qi, Y. Robust Transcriptional Activation in Plants Using Multiplexed CRISPR-Act2.0 and MTALE-Act Systems. Mol. Plant 2018, 11, 245–256. [Google Scholar] [CrossRef] [Green Version]
- Piatek, A.; Ali, Z.; Baazim, H.; Li, L.; Abulfaraj, A.; Al-Shareef, S.; Aouida, M.; Mahfouz, M.M. RNA-Guided Transcriptional Regulation in Planta via Synthetic DCas9-Based Transcription Factors. Plant Biotechnol. J. 2015, 13, 578–589. [Google Scholar] [CrossRef]
- Pan, C.; Wu, X.; Markel, K.; Malzahn, A.A.; Kundagrami, N.; Sretenovic, S.; Zhang, Y.; Cheng, Y.; Shih, P.M.; Qi, Y. CRISPR–Act3.0 for Highly Efficient Multiplexed Gene Activation in Plants. Nat. Plants 2021, 7, 942–953. [Google Scholar] [CrossRef] [PubMed]
- Moreno-giménez, E.; Selma, S.; Calvache, C.; Orzáez, D. GB _ SynP: A Modular DCas9-Regulated Synthetic Promoter Collection for Fine-Tuned Recombinant Gene Expression in Plants. bioRxiv 2022, 1–22. [Google Scholar] [CrossRef]
- Subhasis, S.; Thakur, J.K. Characterization of Mediator Complex and Its Associated Proteins from Rice. Plant Gene Regul. Netw. 2017, 1629, 283–295. [Google Scholar] [CrossRef]
- Nishitani, C.; Hirai, N.; Komori, S.; Wada, M.; Okada, K.; Osakabe, K.; Yamamoto, T.; Osakabe, Y. Efficient Genome Editing in Apple Using a CRISPR/Cas9 System. Sci. Rep. 2016, 6, 31481. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Ding, Y.; Zhou, Y.; Jin, W.; Xie, K.; Chen, L.L. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Mol. Plant 2017, 10, 530–532. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Wang, T.; Guan, C.; Liu, B.; Luo, C.; Xie, Z.; Zhang, C.; Xing, X.H. Improved SgRNA Design in Bacteria via Genome-Wide Activity Profiling. Nucleic Acids Res. 2018, 46, 7052–7069. [Google Scholar] [CrossRef] [PubMed]
- Yoneda, Y.; Shimizu, H.; Nakashima, H.; Miyasaka, J.; Ohdoi, K. Effects of Light Intensity and Photoperiod on Improving Steviol Glycosides Content in Stevia Rebaudiana (Bertoni) Bertoni While Conserving Light Energy Consumption. J. Appl. Res. Med. Aromat. Plants 2017, 7, 64–73. [Google Scholar] [CrossRef]
- Moon, J.H.; Lee, K.; Lee, J.H.; Lee, P.C. Redesign and Reconstruction of a Steviol-Biosynthetic Pathway for Enhanced Production of Steviol in Escherichia coli. Microb. Cell Fact. 2020, 19, 1–13. [Google Scholar] [CrossRef]
- Madhav, H.; Bhasker, S.; Chinnamma, M. Functional and Structural Variation of Uridine Diphosphate Glycosyltransferase (UGT) Gene of Stevia Rebaudiana-UGTSr Involved in the Synthesis of Rebaudioside A. Plant Physiol. Biochem. 2013, 63, 245–253. [Google Scholar] [CrossRef]
- Brandle, J.E.; Telmer, P.G. Steviol Glycoside Biosynthesis. Phytochemistry 2007, 68, 1855–1863. [Google Scholar] [CrossRef]
- Kim, M.J.; Zheng, J.; Liao, M.H.; Jang, I.C. Overexpression of SrUGT76G1 in Stevia Alters Major Steviol Glycosides Composition towards Improved Quality. Plant Biotechnol. J. 2019, 17, 1037–1047. [Google Scholar] [CrossRef]
- Mohamed, A.A.A.; Ceunen, S.; Geuns, J.M.C.; Van den Ende, W.; De Ley, M. UDP-Dependent Glycosyltransferases Involved in the Biosynthesis of Steviol Glycosides. J. Plant Physiol. 2011, 168, 1136–1141. [Google Scholar] [CrossRef]
- Yoneda, Y.; Shimizu, H.; Nakashima, H.; Miyasaka, J.; Ohdoi, K. Effect of Treatment with Gibberellin, Gibberellin Biosynthesis Inhibitor, and Auxin on Steviol Glycoside Content in Stevia Rebaudiana Bertoni. Sugar Tech. 2018, 20, 482–491. [Google Scholar] [CrossRef]
- Arif, I.A.; Bakir, M.A.; Khan, H.A.; Ahamed, A.; Al Farhan, A.H.; Al Homaidan, A.A.; Al Sadoon, M.; Bahkali, A.H.; Shobrak, M. A Simple Method for DNA Extraction from Mature Date Palm Leaves: Impact of Sand Grinding and Composition of Lysis Buffer. Int. J. Mol. Sci. 2010, 11, 3149–3157. [Google Scholar] [CrossRef]
- Yang, Y.; Huang, S.; Han, Y.; Yuan, H.; Gu, C.; Wang, Z. Environmental Cues Induce Changes of Steviol Glycosides Contents and Transcription of Corresponding Biosynthetic Genes in Stevia Rebaudiana. Plant Physiol. Biochem. 2015, 86, 174–180. [Google Scholar] [CrossRef]
- Tora, L.; Timmers, H.T.M. The TATA Box Regulates TATA-Binding Protein (TBP) Dynamics in vivo. Trends Biochem. Sci. 2010, 35, 309–314. [Google Scholar] [CrossRef]
- Srivastava, A.K.; Lu, Y.; Zinta, G.; Lang, Z.; Zhu, J.K. UTR-Dependent Control of Gene Expression in Plants. Trends Plant Sci. 2018, 23, 248–259. [Google Scholar] [CrossRef]
- Ran, F.A.; Hsu, P.D.; Lin, C.Y.; Gootenberg, J.S.; Konermann, S.; Trevino, A.E.; Scott, D.A.; Inoue, A.; Matoba, S.; Zhang, Y.; et al. XDouble Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Cell 2013, 154, 1380–1389. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
sgRNA | Strand | Secondary Structure (Vienna Format) | TSL | CBP | TBP | IBP |
---|---|---|---|---|---|---|
4 | + | UGGAAAAUGCACAUCUUGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ..((.((((.((.((((((.........((((....))))........))))))...)).)))).)).((((....))))(((((((...)))))))... | 5 | 6 | 14 | 0 |
13 | − | UUAUGGGGAACUUUUUUGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU .........(((((((((.((((....(((..((..((((.............)))).)).)))...)))))))))))))(((((((...)))))))... | 4 | 9 | 10 | 0 |
18 | − | AACUAAGGUAGUAAGGCAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU .((((...))))..(((...(((((((.((((....))))...)))))))...)))............((((....))))(((((((...)))))))... | 3 | 4 | 7 | 4 |
25 | + | AUUGUUGAACUCGAUUAGGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ...(((((...(((((((..(((((((.((((....))))...)))))))....))))).))...)))))..........(((((((...)))))))... | 4 | 7 | 12 | 0 |
26 | + | CUCGAUUAGGGCGGCCCAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ...(((..((((((((....(((((((.((((....))))...)))))))..)))).))))...))).((((....))))(((((((...)))))))... | 4 | 8 | 11 | 0 |
29 | + | UUAGGGCGGCCCAAGAGGUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ...((((((((.........(((((((.((((....))))...)))))))..)))).)))).......((((....))))(((((((...)))))))... | 3 | 8 | 8 | 0 |
30 | − | GGGGCCUAAAGCACAAGCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU .((((....(((.....((((((((((.((((....))))...))))))))))))).)))).......((((....))))(((((((...)))))))... | 3 | 4 | 10 | 0 |
33 | − | AAGGGGGCUGUAUAGAAGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU .((.(((((....((.....(((((((.((((....))))...)))))))....))))))).))....((((....))))(((((((...)))))))... | 4 | 6 | 10 | 0 |
34 | − | AAAGGGGGCUGUAUAGAAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ..((.(((((....((...((((((((.((((....))))...))))))))...))))))).))....((((....))))(((((((...)))))))... | 4 | 5 | 10 | 0 |
35 | − | AAAAGGGGGCUGUAUAGAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ...((.(((((((.......(((((((.((((....))))...)))))))...)).))))).))....((((....))))(((((((...)))))))... | 3 | 7 | 9 | 0 |
RNA | Before DNAse I Treatment | After DNAse I Treatment | ||
---|---|---|---|---|
Yield (ng/µL) | Purity (A260/A280) | Yield (ng/µL) | Purity (A260/A280) | |
Control | 59.6 | 1.62 | 44.7 | 1.77 |
RNP18 | 12.2 | 1.72 | 11.1 | 1.72 |
RNP30 | 15.4 | 1.77 | 14.2 | 1.77 |
RNP33 | 12.2 | 1.79 | 10.8 | 1.80 |
RNP34 | 14.4 | 1.79 | 12.5 | 1.80 |
Enzyme Solution | Cellulase R-10 (%) | Macerozyme R-10 (%) |
---|---|---|
ES1 | 1.00 | 0.50 |
ES2 | 1.00 | 0.75 |
ES3 | 1.00 | 1.00 |
ES4 | 1.25 | 0.50 |
ES5 | 1.25 | 0.75 |
ES6 | 1.25 | 1.00 |
ES7 | 1.50 | 0.50 |
ES8 | 1.50 | 0.75 |
ES9 | 1.50 | 1.00 |
Name (Accession No.) | Forward (F)/ Reverse (R) | Sequence (5′—3′) | Amplicon Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|
Actin (AF548026.1) | F | CTGAGAACTGAGGGCTAGGG | 187 | 70.5 |
R | AACCCAGCCTTGACCATTCC | |||
Aquaporin (DQ269455.1) | F | GGAGCCGCCGTAATCTACAA | 86 | 80 |
R | GCAATCGCCGCACCAATAAA | |||
Calmodulin (AF474074.1) | F | ATCCGCTCACCGACGATCA | 142 | 65 |
R | TGCAGTTCAGCTTCTGTTGG | |||
UGT76G1(KM206772.1) | F | CTGCCAATGCCACCGTTATT | 94 | 52 |
R | TCATAAACCGTCTGACGCAGG | |||
UGT74G1(AY345982.1) | F | TTCCAGTGCTTCAACGGTGG | 124 | 61 |
R | GTGAAGACCCAACGTGCTTG | |||
UGT85C2(AY345978.1) | F | CGTTCGATGAGTTGGAGCCT | 181 | 61 |
R | AGCCACTGGAAACACTCTGG |
Step | Temperature | Duration | Cycle (s) |
---|---|---|---|
Initial activation | 95 °C | 2 Min. | 1 |
Denaturation | 95 °C | 05 S | 40 |
Annealing | * 52–80 °C | 10 S | |
Extention | 72 °C | 15 S | |
Melt curve | 65–95 °C | 5 S for every increment of 0.5 °C |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghose, A.K.; Abdullah, S.N.A.; Md Hatta, M.A.; Megat Wahab, P.E. DNA Free CRISPR/DCAS9 Based Transcriptional Activation System for UGT76G1 Gene in Stevia rebaudiana Bertoni Protoplasts. Plants 2022, 11, 2393. https://doi.org/10.3390/plants11182393
Ghose AK, Abdullah SNA, Md Hatta MA, Megat Wahab PE. DNA Free CRISPR/DCAS9 Based Transcriptional Activation System for UGT76G1 Gene in Stevia rebaudiana Bertoni Protoplasts. Plants. 2022; 11(18):2393. https://doi.org/10.3390/plants11182393
Chicago/Turabian StyleGhose, Asish Kumar, Siti Nor Akmar Abdullah, Muhammad Asyraf Md Hatta, and Puteri Edaroyati Megat Wahab. 2022. "DNA Free CRISPR/DCAS9 Based Transcriptional Activation System for UGT76G1 Gene in Stevia rebaudiana Bertoni Protoplasts" Plants 11, no. 18: 2393. https://doi.org/10.3390/plants11182393