Spectrum and Density of Gamma and X-ray Induced Mutations in a Non-Model Rice Cultivar
Abstract
1. Introduction
2. Results
2.1. Generation of Mutant Population and Mutant Selection
2.2. Genome Sequencing
2.3. Single Nucleotide and Insertion/Deletion Variants Detected in Rice Mutant Lines
2.4. Structural Variants Detected in Rice Mutant Lines
2.5. Validation of Predicted Mutations
2.6. Predicted Effect of Induced Mutations
3. Discussion
4. Materials and Methods
4.1. Plant Material and Generation of a Mutant Population
4.2. Glasshouse Trials and Agronomic Traits Measurement for Forward Genetics
4.3. DNA Sequencing and Read Mapping
4.4. Detection and Analysis of Point Mutations and Small Indels
4.5. Genomic Variant Detection: Structural Variants
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Purugganan, M.D.; Fuller, D.Q. The nature of selection during plant domestication. Nature 2009, 457, 843–848. [Google Scholar] [CrossRef] [PubMed]
- Joukhadar, R.; Daetwyler, H.D.; Bansal, U.K.; Gendall, A.R.; Hayden, M.J. Genetic Diversity, Population Structure and Ancestral Origin of Australian Wheat. Front. Plant Sci. 2017, 8, 2115. [Google Scholar] [CrossRef] [PubMed]
- Mondal, S.; Rutkoski, J.E.; Velu, G.; Singh, P.K.; Crespo-Herrera, L.A.; Guzmán, C.; Bhavani, S.; Lan, C.; He, X.; Singh, R.P. Harnessing Diversity in Wheat to Enhance Grain Yield, Climate Resilience, Disease and Insect Pest Resistance and Nutrition Through Conventional and Modern Breeding Approaches. Front. Plant Sci. 2016, 7, 991. [Google Scholar] [CrossRef]
- McCouch, S.; Baute, G.J.; Bradeen, J.; Bramel, P.; Bretting, P.K.; Buckler, E.; Burke, J.M.; Charest, D.; Cloutier, S.; Cole, G.; et al. Feeding the future. Nature 2013, 499, 23–24. [Google Scholar] [CrossRef] [PubMed]
- Bailey-Serres, J.; Parker, J.E.; Ainsworth, E.A.; Oldroyd, G.E.D.; Schroeder, J.I. Genetic strategies for improving crop yields. Nature 2019, 575, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Till, B.J.; Datta, S.; Jankowicz-Cieslak, J. TILLING: The Next Generation. In Plant Genetics and Molecular Biology; Varshney, R.K., Pandey, M.K., Chitikineni, A., Eds.; Springer International Publishing: Cham, Switzerland, 2018; pp. 139–160. [Google Scholar]
- Muller, H.J. Artificial Transmutation of the Gene. Science 1927, 66, 84–87. [Google Scholar] [CrossRef] [PubMed]
- Stadler, L.J. Genetic Effects of X-Rays in Maize. Proc. Natl. Acad. Sci. USA 1928, 14, 69–75. [Google Scholar] [CrossRef]
- Edgley, M.L.; Baillie, D.L.; Riddle, D.L.; Rose, A.M. Genetic balancers; WormBook: Pasadena, CA, USA, 2018. [Google Scholar]
- Ghavi-Helm, Y.; Jankowski, A.; Meiers, S.; Viales, R.R.; Korbel, J.O.; Furlong, E.E.M. Highly rearranged chromosomes reveal uncoupling between genome topology and gene expression. Nat. Genet. 2019, 51, 1272–1282. [Google Scholar] [CrossRef]
- Jankowicz-Cieslak, J.; Till, B.J. Forward and Reverse Genetics in Crop Breeding. In Advances in Plant Breeding Strategies: Breeding, Biotechnology and Molecular Tools; Springer International Publishing: Cham, Switzerland, 2015; pp. 215–240. [Google Scholar]
- Jung, C.; Till, B. Mutagenesis and genome editing in crop improvement: Perspectives for the global regulatory landscape. Trends Plant Sci. 2021, 26, 1258–1269. [Google Scholar] [CrossRef]
- Ahloowalia, B.S.; Maluszynski, M.; Nichterlein, K. Global impact of mutation-derived varieties. Euphytica 2004, 135, 187–204. [Google Scholar] [CrossRef]
- Jankowicz-Cieslak, J.; Mba, C.; Till, B.J. Mutagenesis for Crop Breeding and Functional Genomics. In Biotechnologies for Plant Mutation Breeding: Protocols; Jankowicz-Cieslak, J., Tai, T.H., Kumlehn, J., Till, B.J., Eds.; Springer International Publishing: Cham, Switzerland, 2017; pp. 3–18. [Google Scholar]
- Greene, E.A.; Codomo, C.A.; Taylor, N.E.; Henikoff, J.G.; Till, B.J.; Reynolds, S.H.; Enns, L.C.; Burtner, C.; Johnson, J.E.; Odden, A.R.; et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 2003, 164, 731–740. [Google Scholar] [CrossRef] [PubMed]
- Henry, I.M.; Nagalakshmi, U.; Lieberman, M.C.; Ngo, K.J.; Krasileva, K.V.; Vasquez-Gross, H.; Akhunova, A.; Akhunov, E.; Dubcovsky, J.; Tai, T.H.; et al. Efficient Genome-Wide Detection and Cataloging of EMS-Induced Mutations Using Exome Capture and Next-Generation Sequencing. Plant Cell 2014, 26, 1382–1397. [Google Scholar] [CrossRef] [PubMed]
- Yan, W.; Deng, X.W.; Yang, C.; Tang, X. The Genome-Wide EMS Mutagenesis Bias Correlates With Sequence Context and Chromatin Structure in Rice. Front. Plant Sci. 2021, 12, 579675. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Jain, R.; Chern, M.; Pham, N.T.; Martin, J.A.; Wei, T.; Schackwitz, W.S.; Lipzen, A.M.; Duong, P.Q.; Jones, K.C.; et al. The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies. Plant Cell 2017, 29, 1218–1231. [Google Scholar] [CrossRef]
- Li, F.; Shimizu, A.; Nishio, T.; Tsutsumi, N.; Kato, H. Comparison and Characterization of Mutations Induced by Gamma-Ray and Carbon-Ion Irradiation in Rice (Oryza sativa L.) Using Whole-Genome Resequencing. G3 Genes Genomes Genet. 2019, 9, 3743–3751. [Google Scholar]
- Li, S.; Zheng, Y.; Cui, H.; Fu, H.; Shu, Q.; Huang, J. Frequency and type of inheritable mutations induced by γ rays in rice as revealed by whole genome sequencing. J. Zhejiang Univ. Sci. B 2016, 17, 905–915. [Google Scholar] [CrossRef]
- Hwang, S.-G.; Lee, S.C.; Lee, J.; Lee, J.W.; Kim, J.-H.; Choi, S.Y.; Kim, J.B.; Choi, H.I.; Jang, C.S. Resequencing of a Core Rice Mutant Population Induced by Gamma-Ray Irradiation and Its Application in a Genome-Wide Association Study. J. Plant Biol. 2020, 63, 463–472. [Google Scholar] [CrossRef]
- Hefner, E.; Huefner, N.; Britt, A.B. Tissue-specific regulation of cell-cycle responses to DNA damage in Arabidopsis seedlings. DNA Repair 2006, 5, 102–110. [Google Scholar] [CrossRef]
- Song, K.E.; Lee, S.H.; Jung, J.G.; Choi, J.E.; Jun, W.; Chung, J.-W.; Hong, S.H.; Shim, S. Hormesis effects of gamma radiation on growth of quinoa (Chenopodium quinoa). Int. J. Radiat. Biol. 2021, 97, 906–915. [Google Scholar] [CrossRef]
- Komura, S.; Jinno, H.; Sonoda, T.; Oono, Y.; Handa, H.; Takumi, S.; Yoshida, K.; Kobayashi, F. Genome sequencing-based coverage analyses facilitate high-resolution detection of deletions linked to phenotypes of gamma-irradiated wheat mutants. BMC Genomic. 2022, 23, 111. [Google Scholar] [CrossRef]
- Hase, Y.; Satoh, K.; Seito, H.; Oono, Y. Genetic Consequences of Acute/Chronic Gamma and Carbon Ion Irradiation of Arabidopsis thaliana. Front. Plant Sci. 2020, 11, 336. [Google Scholar] [CrossRef] [PubMed]
- Naito, K.; Kusaba, M.; Shikazono, N.; Takano, T.; Tanaka, A.; Tanisaka, T.; Nishimura, M. Transmissible and Nontransmissible Mutations Induced by Irradiating Arabidopsis thaliana Pollen With γ-Rays and Carbon Ions. Genetics 2005, 169, 881–889. [Google Scholar] [CrossRef] [PubMed]
- Spencer-Lopes, M.M.; Forster, B.P.; Jankuloski, L. (Eds.) Manual on Mutation Breeding; FAO: Vienna, Austria; IAEA: Vienna, Austria, 2018. [Google Scholar]
- Monroe, J.G.; Srikant, T.; Carbonell-Bejerano, P.; Becker, C.; Lensink, M.; Exposito-Alonso, M.; Klein, M.; Hildebrandt, J.; Neumann, M.; Kliebenstein, D.; et al. Mutation bias reflects natural selection in Arabidopsis thaliana. Nature 2022, 602, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Cui, J.; Wang, L.; Teng, N.; Zhang, S.; Lam, H.-M.; Zhu, Y.; Xiao, S.; Ke, W.; Lin, J.; et al. Genome-wide DNA mutations in Arabidopsis plants after multigenerational exposure to high temperatures. Genome Biol. 2021, 22, 160. [Google Scholar] [CrossRef] [PubMed]
- Jo, Y.D.; Kim, J.-B. Frequency and Spectrum of Radiation-Induced Mutations Revealed by Whole-Genome Sequencing Analyses of Plants. Quantum Beam Sci. 2019, 3, 7. [Google Scholar] [CrossRef]
- Ramsden, D.A.; Nussenzweig, A. Mechanisms driving chromosomal translocations: Lost in time and space. Oncogene 2021, 40, 4263–4270. [Google Scholar] [CrossRef]
- Liao, Z.; Zhang, X.; Zhang, S.; Lin, Z.; Zhang, X.; Ming, R. Structural variations in papaya genomes. BMC Genomic. 2021, 22, 335. [Google Scholar] [CrossRef]
- Songsomboon, K.; Brenton, Z.; Heuser, J.; Kresovich, S.; Shakoor, N.; Mockler, T.; Cooper, E.A. Genomic patterns of structural variation among diverse genotypes of Sorghum bicolor and a potential role for deletions in local adaptation. G3 Genes Genomes Genet. 2021, 11, jkab154. [Google Scholar] [CrossRef]
- Wang, Y.; Xiong, G.; Hu, J.; Jiang, L.; Yu, H.; Xu, J.; Fang, Y.; Zeng, L.; Xu, E.; Xu, J.; et al. Copy number variation at the GL7 locus contributes to grain size diversity in rice. Nat. Genet. 2015, 47, 944–948. [Google Scholar] [CrossRef]
- Fuentes, R.R.; Chebotarov, D.; Duitama, J.; Smith, S.; De la Hoz, J.F.; Mohiyuddin, M.; Wing, R.A.; McNally, K.L.; Tatarinova, T.; Grigoriev, A.; et al. Structural variants in 3000 rice genomes. Genome Res. 2019, 29, 870–880. [Google Scholar] [CrossRef]
- Krasileva, K.V. The role of transposable elements and DNA damage repair mechanisms in gene duplications and gene fusions in plant genomes. Curr. Opin. Plant Biol. 2019, 48, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Laanen, P.; Saenen, E.; Mysara, M.; Van de Walle, J.; Van Hees, M.; Nauts, R.; van Nieuwerburgh, F.; Voorspoels, S.; Jacobs, G.; Cuypers, A.; et al. Changes in DNA Methylation in Arabidopsis thaliana Plants Exposed Over Multiple Generations to Gamma Radiation. Front. Plant Sci. 2021, 12, 611783. [Google Scholar] [CrossRef] [PubMed]
- West, C.E.; Waterworth, W.M.; Jiang, Q.; Bray, C.M. Arabidopsis DNA ligase IV is induced by gamma-irradiation and interacts with an Arabidopsis homologue of the double strand break repair protein XRCC4. Plant J. 2000, 24, 67–78. [Google Scholar] [CrossRef]
- Knudsen, S.; Wendt, T.; Dockter, C.; Thomsen, H.C.; Rasmussen, M.; Jørgensen, M.E.; Lu, Q.; Voss, C.; Murozuka, E.; Østerberg, J.T.; et al. FIND-IT: Ultrafast mining of genome diversity. bioRxiv 2021, bioRxiv:444969. [Google Scholar] [CrossRef]
- Abe, A.; Kosugi, S.; Yoshida, K.; Natsume, S.; Takagi, H.; Kanzaki, H.; Matsumura, H.; Yoshida, K.; Mitsuoka, C.; Tamiru, M.; et al. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 2012, 30, 174–178. [Google Scholar] [CrossRef]
- Wang, L.; Ji, Y.; Hu, Y.; Hu, H.; Jia, X.; Jiang, M.; Zhang, X.; Zhao, L.; Zhang, Y.; Jia, Y.; et al. The architecture of intra-organism mutation rate variation in plants. PLoS Biol. 2019, 17, e3000191. [Google Scholar] [CrossRef]
- Bado, S.; Forster, B.P.; Nielen, S.; Ali, A.M.; Lagoda, P.J.L.; Till, B.J.; Laimer, M. Plant mutation breeding: Current progress and future assessment. Plant Breed. Rev. 2015, 39, 23–88. [Google Scholar]
- Bado, S.; Forster, B.P.; Ghanim, A.M.A.; Jankowicz-Cieslak, J.; Berthold, G.; Luxiang, L. Protocol for Screening for Salt Tolerance in Rice. In Protocols for Pre-Field Screening of Mutants for Salt Tolerance in Rice, Wheat and Barley; Bado, S., Forster, B.P., Ghanim, A.M.A., Jankowicz-Cieslak, J., Berthold, G., Luxiang, L., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 21–31. [Google Scholar]
- Utilising NIRS for Qualitative and Non-Destructive Identification of Seed Mutants in Large Populations. 2021. Available online: https://www.iaea.org/resources/book/utilising-nirs-for-qualitative-and-non-destructive-identification-of-seed-mutants-in-large-populations (accessed on 23 March 2022).
- FASTQC. A Quality Control Tool for High Throughput Sequence Data. BibSonomy. Available online: https://www.bibsonomy.org/bibtex/f230a919c34360709aa298734d63dca3 (accessed on 17 March 2022).
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Scaling Accurate Genetic Variant Discovery to Tens of Thousands of Samples. bioRxiv. Available online: https://www.biorxiv.org/content/10.1101/201178v3 (accessed on 17 March 2022).
- Alexandrov, N.; Tai, S.; Wang, W.; Mansueto, L.; Palis, K.; Fuentes, R.R.; Ulat, V.J.; Chebotarov, D.; Zhang, G.; Li, Z.; et al. SNP-Seek database of SNPs derived from 3000 rice genomes. Nucleic Acids Res. 2015, 43, D1023–D1027. [Google Scholar] [CrossRef]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Abbott, T.E.; Larson, D.; Chen, K. BreakDancer-Identification of Genomic Structural Variation from Paired-End Read Mapping. Curr. Protoc. Bioinforma. 2014, 45, bi1506s45. [Google Scholar] [CrossRef]
- Layer, R.M.; Chiang, C.; Quinlan, A.R.; Hall, I.M. LUMPY: A probabilistic framework for structural variant discovery. Genome Biol. 2014, 15, R84. [Google Scholar] [CrossRef] [PubMed]
- Henry, I.M.; Zinkgraf, M.S.; Groover, A.T.; Comai, L. A System for Dosage-Based Functional Genomics in Poplar. Plant Cell 2015, 27, 2370–2383. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Schulz-Trieglaff, O.; Shaw, R.; Barnes, B.; Schlesinger, F.; Källberg, M.; Cox, A.J.; Kruglyak, S.; Saunders, C.T. Manta: Rapid detection of structural variants and indels for germline and cancer sequencing applications. Bioinformatics 2016, 32, 1220–1222. [Google Scholar] [CrossRef]




| Treatment | 0 Gy | 75 Gy | 150 Gy | 300 Gy | 450 Gy | 600 Gy |
|---|---|---|---|---|---|---|
| gamma | 74 | 78 | 80 | 76 | 28 | 2 |
| X-ray | 72 | 82 | 70 | 6 | 0 | 0 |
| Sample | Treatment | Days to Flowering | Plant Height | Panicle Length | Total No of Spikelets | Empty Spikelets | Fertile Spikelets | 1000 Seed Weight |
|---|---|---|---|---|---|---|---|---|
| Control | N/A | 117 | 80 | 8 | 26 | 18 | 8 | 27.19 |
| M149 | gamma 150 Gy | 90 | 112 | 14 | 67 | 28 | 40 | 30.07 |
| M153 | gamma 150 Gy | 97 | 125 | 23 | 202 | 75 | 127 | 33.43 |
| M166 | gamma 300 Gy | 103 | 100 | 16 | 49 | 20 | 30 | 31.94 |
| M193 | gamma 450 Gy | 94 | 120 | 14 | 68 | 26 | 42 | 30.8 |
| M225 | X-ray 75 Gy | 107 | 75 | 13 | 38 | 18 | 20 | 25.52 |
| M232 | X-ray 75 Gy | 90 | 72 | 10 | 45 | 19 | 26 | 19.64 |
| M238 | X-ray 75 Gy | 87 | 105 | 17 | 102 | 25 | 76 | 29.64 |
| M242 | X-ray 75 Gy | 108 | 52 | 6 | 19 | 8 | 11 | 21.35 |
| M244 | X-ray 75 Gy | 101 | 75 | 13 | 50 | 26 | 24 | 20.94 |
| M314 | X-ray 150 Gy | 97 | 80 | 12 | 38 | 17 | 21 | 26.22 |
| M317 | X-ray 150 Gy | 89 | 80 | 10 | 25 | 9 | 16 | 24.49 |
| Mutant Line | Treatment Type | Total Mutations * | SNVs | Indels | Total SNV/InDel Mutations | SNV/indel Mutation Frequency (bp/Event) ** | Mutation Frequency All Variants bp/Event) ** | SVs | Large Deletions | Duplications | Inversions | Insertions | Itx *** | Ctx *** | SV Frequency (bp/Event) ** |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 43,801 (control) * | None | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 43,802_control | None | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| M149 | gamma 150 Gy | 7016 | 5205 | 1432 | 6637 | 64,788.31 | 61,288.48 | 379 | 339 | 16 | 7 | 17 | 2 | 5 | 1,134,564.64 |
| M153 | gamma 150 Gy | 7294 | 5054 | 1919 | 6973 | 61,666.43 | 58,952.56 | 321 | 273 | 18 | 10 | 20 | 0 | 0 | 1,339,563.86 |
| M166 | gamma 300 Gy | 7147 | 3924 | 2884 | 6808 | 63,160.99 | 60,165.10 | 339 | 306 | 11 | 7 | 15 | 3 | 2 | 1,268,436.58 |
| M193 | gamma 450 Gy | 8816 | 6328 | 1861 | 8189 | 52,509.46 | 48,774.95 | 627 | 558 | 38 | 13 | 18 | 9 | 30 | 685,805.42 |
| M225 | X-ray 75 Gy | 6158 | 4389 | 1248 | 5637 | 76,281.71 | 69,827.87 | 521 | 460 | 26 | 16 | 19 | 10 | 42 | 825,335.89 |
| M232 | X-ray 75 Gy | 9546 | 6859 | 2188 | 9047 | 47,529.57 | 45,045.05 | 499 | 445 | 30 | 14 | 10 | 10 | 45 | 861,723.45 |
| M238 | X-ray 75 Gy | 8128 | 4378 | 3303 | 7681 | 55,982.29 | 52,903.54 | 447 | 406 | 14 | 13 | 14 | 4 | 51 | 961,968.68 |
| M242 | X-ray 75 Gy | 18,612 | 10,619 | 7652 | 18,271 | 23,534.56 | 23,103.37 | 341 | 285 | 18 | 15 | 23 | 7 | 21 | 1,260,997.07 |
| M244 | X-ray 75 Gy | 9392 | 7172 | 1984 | 9156 | 46,963.74 | 45,783.65 | 236 | 188 | 18 | 12 | 18 | 3 | 34 | 1,822,033.90 |
| M314 | X-ray 150 Gy | 6271 | 4425 | 1357 | 5782 | 74,368.73 | 68,569.61 | 489 | 425 | 24 | 22 | 18 | 7 | 28 | 879,345.60 |
| M317 | X-ray 150 Gy | 6069 | 4216 | 1372 | 5588 | 76,950.61 | 70,851.87 | 481 | 421 | 24 | 16 | 20 | 8 | 33 | 893,970.89 |
| Mutant Line | Mutation Type | Mutation Name | Position Call | Mutation | Type | Sanger Confirmed |
|---|---|---|---|---|---|---|
| M149 | indel | 149_IND1 | 1:23,789,397 | GAT to G | Unique in mutant | Y |
| M153 | indel | 153_IND4 | 4:15,522,985 | C to CTCAGCCG | Unique in mutant | Y |
| M166 | indel | 166_IND1 | 1:18,131,046 | AGCGCATGTGCCATG to A | Unique in mutant | Y |
| M166 | indel | 166_IND3 | 6:5,694,121 | CA to C | Unique in mutant | Y |
| M193 | SNP | 193_SNP1 | 2:32,736,082 | A to ACCAACG | Unique in mutant | Y |
| M193 | SNP | 193_SNP4 | 6:28,952,090 | A to G | Unique in mutant | Y |
| M193 | SNP | 193_SNP5 | 7:10,033,642 | T to C | Unique in mutant | Y |
| M193 | SNP | 193_SNP6 | 12:24,819,926 | C to A | Filtered for allele ratio * | N |
| M193 | indel | 193_IND6 | 12:1,851,681 Identified in IRRI set | AC to A | Unique in mutant | Y |
| M225 | SNP | 225_SNP2 | 3:30,121,299 | T to G | Unique in mutant | Y |
| M225 | SNP | 225_SNP3 | 5:18,773,517 | G to A | Not unique in mutant | Y |
| M232 | indel | 232_IND1 | 1:38,864,179 | AGG to A | Unique in mutant | Y |
| M238 | SNP | 238_SNP4 | 8:24,636,417 | G to A | Unique in mutant | Y |
| M238 | SNP | 238_SNP5 | 9:19,013,812 | G to C | Unique in mutant | Y |
| M238 | indel | 238_IND1 | 1:2,382,470 | CG to C | Unique in mutant | Y |
| M238 | indel | 238_IND2 | 1:3,324.566 | GGTGGT to G | Unique in mutant | Y |
| M238 | indel | 238_IND4 | 6:12,475,810 | C to CAAGT | Unique in mutant | Y |
| M238 | indel | 238_IND5 | 6:16,993,055 | TA to A | Unique in mutant | Y |
| M238 | indel | 238_IND6 | 6:17,139,752 | A to AGATGCTCTAGGACAGTTTGTTGG | Not unique in Mutant | Y |
| M242 | SNP | 242_SNP1 | 1:14,877,967 | G to T | Not unique in mutant | Y |
| M242 | SNP | 242_SNP3 | 3:8,704,769 | G to A | Not unique in mutant | Y |
| M242 | SNP | 242_SNP5 | 8:8,951,950 | G to T | Unique in mutant | Y |
| M242 | indel | 242_IND1 | 1:13,935,043 | A to AT | Low coverage | N |
| M242 | indel | 242_IND4 | 7:29,013,042 | CAAGG to C | Unique in mutant | Y |
| M242 | indel | 242_IND4 | 7:29,013,050 | G to GC | Unique in mutant | Y |
| M244 | SNP | 244_SNP3 | 7:11,432,559 | C to T | Filtered for allele ratio ** | N |
| M244 | SNP | 244_SNP4 | 11:22,433,103 | C to T | Filtered for allele ratio *** | N |
| M244 | indel | 244_IND1 | 8:24,737,886 | A to ACCAACG | Not unique in mutant | Y |
| M314 | SNP | 314_SNP2 | 4:28,342,904 | G to T | Unique in mutant | Y |
| M314 | indel | 314_IND1 | 4:3,682,688 | G to GAT | Unique in mutant | Y |
| M314 | indel | 314_IND1 | 4:3,682,689 | G to GA | Not unique in mutant | Y |
| M314 | indel | 314_IND1 | 4:3,682,697 | GGT to G | Unique in mutant | Y |
| M314 | indel | 314_IND1 | 4:3,682,701 | CAG to C | Unique in mutant | Y |
| M314 | indel | 314_IND2 | 7:15,991,122 | AC to A | Unique in mutant | Y |
| Mutant Line | Mutation Name | Mutation Call | Call Size | Verified Mutation Size | Locus Affected | Function |
|---|---|---|---|---|---|---|
| M149 | 149_DEL3 | 7:42,391–44,131 | 1740 | 1743 bp | LOC_Os07g01070.1 | Membrane transport activity |
| M153 | 153_DEL3 | 2:30,638,481–30,639,067 | 586 | 592 bp | Intron after LOC_Os02g50150 | |
| M232 | 232_DEL3_2 | 3:15,993,208–15,994,132 | 924 | 952 bp | Intron after LOC_Os03g27840 | |
| M242 | 242_DUP3 | 5:1,790,511–1,790,511 | 179 | 179 bp | LOC_Os05g03972.1 | Plant protein, unknown function |
| M317 | 317_DEL2 | 2:30,048,905–30,049,501 | 596 | 603 bp | Intron | |
| M317 | 317_DEL3 | 5:86,454–87,418 | 964 | 960 bp | Intron region bordering upstream of LOC_Os05g01080 | Uncharacterised protein |
| M166 | 166_DEL3 | 3:14,816,703–14,817,352 | 649 | 654 bp | Intron | |
| M225 | 225_DEL3 | 3:14,816,703–14,817,352 | 649 | 654 bp | Intron | |
| M193 | 193_DEL1 | 2:35,131,943–35,132,357 | 414 | 413 bp | Intron after LOC_Os02g57350 | |
| M232 | 232_DEL1 | 2:35,131,943–35,132,357 | 414 | 413 bp | Intron after LOC_Os02g57350 | |
| M238 | 238_DEL2 | 2:35,131,943–35,132,357 | 414 | 413 bp | Intron after LOC_Os02g57350 | |
| M242 | 242_DEL1 | 2:35,131,943–35,132,357 | 414 | 415 bp | Intron after LOC_Os02g57350 | |
| M244 | 244_DEL1 | 2:35,131,943–35,132,357 | 414 | 413 bp | Intron after LOC_Os02g57350 | |
| M225 | 225_DEL2 | 7:606,112–607,134 | 1022 | 1000 bp | LOC_Os07g01990.1 | Uncharacterised |
| M193 | 193_DEL3 | 7:606,112–607,134 | 1022 | 1000 bp | LOC_Os07g01990.1 | Uncharacterised |
| M314 | 314_DEL2 | 7:606,112–607,134 | 1022 | 1022 bp | LOC_Os07g01990.1 | Uncharacterised |
| M149 | 149 DEL2 | 2:34,566,631–34,570,008 | 3377 | Primer pair designed in deletion, WT (1200), MUT (0) | Intron | |
| M149 | 149 DEL3 | 3:34,303,046–34,303,733 | 687 | WT (750), MUT (50) | Intron | |
| M232 | 232 DUP3 | 4:2,243,338–2,244,529 | 1191 | WT (0), MUT (bands at 1200, 550) | LOC_Os04g04660.1 | Expressed protein |
| M238 | 238 DEL3_2 | 5:4,851,233–4,852,248 | 1015 | WT (1000), MUT (100) | Intron | |
| M242 | 242 DEL2 | 6:712,560–713,948 | 1388 | WT (400), MUT (200) | Intron | |
| M242 | 242 DEL3 | 10:23,140,818–23,144,340 | 3522 | WT (4200), MUT (450) | LOC_Os10g42910.1, LOC_Os10g42920.1 LOC_Os10g42930.1 | Transposon protein, conserved hypothetical protein, expressed protein |
| M317 | 317 DEL1_2 | 7:547,127–550,124 | 2534 | WT (600), MUT (2200), Primer pair designed in deletion, expected WT (609), MUT (0) | LOC_Os07g01904.1 | Expressed protein |
| M244 | 244 DUP2 | 3:35,152,931–35,153,261 | 330 | WT (550), MUT (850,550) | LOC_Os03g62040.1 | Retrotransposon protein |
| M232 | 232 DUP2 | 3:35,152,931–35,153,261 | 330 | WT (650), (1100,650) | LOC_Os03g62040.1 | Retrotransposon protein |
| M153 | 153 DEL1_4 | 10:23,131,290–23,139,022 | 7732 | WT (~8000), MUT (220) | LOC_Os10g42900.1; LOC_Os10g42910.1 | Peptide transporter PTR2, transposon protein |
| M314 | 314 DEL3_4 | 10:23,131,290–23,139,022 | 7732 | WT (~8000), MUT (220) | LOC_Os10g42900.1; LOC_Os10g42910.1 | Peptide transporter PTR2, transposon protein |
| Mutant Line | Missense | Nonsense | Silent | High | Low | Moderate | Modifier | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Count | % | Count | % | Count | % | Count | % | Count | % | Count | % | Count | % | |
| M149 | 131 | 60.93% | 1 | 0.465% | 83 | 38.605% | 42 | 0.261% | 91 | 0.565% | 147 | 0.913% | 15,823 | 98.261% |
| M153 | 204 | 55.135% | 3 | 0.811% | 163 | 44.054% | 54 | 0.286% | 209 | 1.108% | 223 | 1.183% | 18,371 | 97.423% |
| M166 | 422 | 57.415% | 4 | 0.544% | 309 | 42.041% | 48 | 0.129% | 374 | 1.006% | 468 | 1.259% | 36,281 | 97.606% |
| M193 | 148 | 56.705% | 1 | 0.383% | 112 | 42.912% | 52 | 0.253% | 141 | 0.685% | 162 | 0.787% | 20,238 | 98.276% |
| M225 | 87 | 55.769% | 0 | 0.00% | 69 | 44.231% | 28 | 0.221% | 82 | 0.646% | 95 | 0.749% | 12,481 | 98.384% |
| M232 | 204 | 58.621% | 4 | 1.149% | 140 | 40.23% | 64 | 0.273% | 164 | 0.7% | 231 | 0.986% | 22,966 | 98.041% |
| M238 | 419 | 60.201% | 4 | 0.575% | 273 | 39.224% | 74 | 0.173% | 353 | 0.827% | 458 | 1.073% | 41,798 | 97.927% |
| M242 | 1363 | 58.198% | 26 | 1.11% | 953 | 40.692% | 264 | 0.245% | 1294 | 1.203% | 1479 | 1.375% | 104,546 | 97.177% |
| M244 | 158 | 55.052% | 5 | 1.742% | 124 | 43.206% | 58 | 0.287% | 159 | 0.787% | 167 | 0.826% | 19,829 | 98.1% |
| M314 | 107 | 52.709% | 2 | 0.985% | 94 | 46.305% | 46 | 0.363% | 107 | 0.845% | 118 | 0.931% | 12,398 | 97.861% |
| M317 | 100 | 49.751% | 4 | 1.99% | 97 | 48.259% | 35 | 0.292% | 111 | 0.925% | 108 | 0.9% | 11,751 | 97.884% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jankowicz-Cieslak, J.; Hofinger, B.J.; Jarc, L.; Junttila, S.; Galik, B.; Gyenesei, A.; Ingelbrecht, I.L.; Till, B.J. Spectrum and Density of Gamma and X-ray Induced Mutations in a Non-Model Rice Cultivar. Plants 2022, 11, 3232. https://doi.org/10.3390/plants11233232
Jankowicz-Cieslak J, Hofinger BJ, Jarc L, Junttila S, Galik B, Gyenesei A, Ingelbrecht IL, Till BJ. Spectrum and Density of Gamma and X-ray Induced Mutations in a Non-Model Rice Cultivar. Plants. 2022; 11(23):3232. https://doi.org/10.3390/plants11233232
Chicago/Turabian StyleJankowicz-Cieslak, Joanna, Bernhard J. Hofinger, Luka Jarc, Sini Junttila, Bence Galik, Attila Gyenesei, Ivan L. Ingelbrecht, and Bradley J. Till. 2022. "Spectrum and Density of Gamma and X-ray Induced Mutations in a Non-Model Rice Cultivar" Plants 11, no. 23: 3232. https://doi.org/10.3390/plants11233232
APA StyleJankowicz-Cieslak, J., Hofinger, B. J., Jarc, L., Junttila, S., Galik, B., Gyenesei, A., Ingelbrecht, I. L., & Till, B. J. (2022). Spectrum and Density of Gamma and X-ray Induced Mutations in a Non-Model Rice Cultivar. Plants, 11(23), 3232. https://doi.org/10.3390/plants11233232

