Comparative Proteomics Reveals the Difference in Root Cold Resistance between Vitis. riparia × V. labrusca and Cabernet Sauvignon in Response to Freezing Temperature
Abstract
:1. Introduction
2. Results
2.1. Difference in Root Activity
2.2. Analysis of Differentially Expressed Proteins (DEPs)
2.3. Expression Levels of DEPs in Response to Low Temperatures between the Two Varieties
2.4. Relative Expression Levels (RELs) of Genes in Response to Low Temperatures between the Two Varieties
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Measurement of Root Activity
4.3. Protein Extraction, Quantification, and Digestion
4.4. iTRAQ Labeling and Strong Cation Exchange (SCX) Chromatography Fractionation
4.5. Liquid Chromatography (LC)-Electrospray Ionization (ESI) Tandem MS/MS Analysis
4.6. Protein Identification and Function Annotation
4.7. RNA Extraction and qRT-PCR
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Pezzuto, J.M. Grapes and human health: A perspective. J. Agric. Food Chem. 2008, 56, 6777–6784. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Martinson, T.; Liu, R.H. Phytochemical profiles and antioxidant activities of wine grapes. Food Chem. 2009, 116, 332–339. [Google Scholar] [CrossRef]
- Blázovics, A.; Sárdi, É. Chapter 3.45-Wine Grapes (Vitis vinifera) and Wine-Based Food Supplements. In Nonvitamin and Nonmineral Nutritional Supplements; Seyed, M.N., Ana, S.S., Eds.; Academic Press: Cambridge, MA, USA, 2019; pp. 461–465. [Google Scholar]
- Wang, J.; Zhou, G.S. The climatic suitability and climatic impact factors affecting the wine grapes (Vitis vinifera L.) planting distribution in China. Acta Ecol. Sin. 2021, 41, 2418–2427. [Google Scholar]
- Guan, L.; Qi, G.M.; Fang, J.G. A summary of main varieties of grapevine and the adoption of rootstock in the world. Sino-Overseas Grapevine Wine 2019, 1, 64–69. [Google Scholar]
- Cramer, G.R. Abiotic stress and plant responses from the whole vine to the genes. Aust. J. Grape Wine R. 2010, 16, 86–93. [Google Scholar] [CrossRef]
- Londo, J.P.; Kovaleski, A.P. Deconstructing cold hardiness: Variation in supercooling ability and chilling requirements in the wild grapevine Vitis riparia. Aust. J. Grape Wine R. 2019, 25, 276–285. [Google Scholar] [CrossRef]
- Londo, J.P.; Kovaleski, A.P.; Lillis, J.A. Divergence in the transcriptional landscape between low temperature and freeze shock in cultivated grapevine (Vitis vinifera). Hortic. Res. 2018, 5, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Wu, X.; Niu, R.; Liu, Y.; Liu, N.; Xu, W.; Wang, Y. Cold resistance evaluation in 25 wild grape species. Vitis 2012, 51, 153–160. [Google Scholar]
- Xu, H.; Wang, X.D.; Zhou, Y.N.; Du, Z.J.; Zhai, H. Study on the cold resistance of grape rootstocks and wine grape cultivars. Sino-Overseas Grapevine Wine 2003, 6, 20–23. [Google Scholar]
- Ma, Y.Y.; Zhang, Y.L.; Shao, H.; Lu, J. Differential physio-biochemical responses to cold stress of cold-tolerant and non-tolerant Grapes (Vitis L.) from China. J. Agron. Crop. Sci. 2010, 196, 212–219. [Google Scholar] [CrossRef]
- Jiang, H.Y.; Li, W.; He, B.J.; Gao, Y.H.; Lu, J.X. Sucrose metabolism in grape (Vitis vinifera L.) branches under low temperature during overwintering covered with soil. Plant Growth Regul. 2014, 72, 229–238. [Google Scholar] [CrossRef]
- Jiang, H.Y.; Wang, W.T.; Lei, T.X.; He, B.; Zhang, J.L. Effects of exogenous ABA and Ca2+ on sucrose metabolism in grape (Vitis vinifera L.) seedlings under low temperature treatment and recovery. Agric. Res. Arid Areas 2017, 35, 127–133. [Google Scholar]
- Carlow, C.E.; Faultless, J.T.; Lee, C.; Siddiqua, M.; Edge, A.; Nassuth, A. Nuclear localization and transactivation by Vitis CBF transcription factors are regulated by combinations of conserved amino acid domains. Plant Physiol. Biochem. 2017, 118, 306–319. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Zhang, Z.; Ren, J.; Qin, Y.; Huang, J.; Wang, Y.; Cai, B.; Wang, B.; Tao, J. Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco. Plant Physiol. Biochem. 2013, 71, 212–217. [Google Scholar] [CrossRef]
- Licausi, F.; Giorgi, F.M.; Zenoni, S.; Osti, F.; Pezzotti, M.; Perata, P. Genomic and transcriptomic analysis of the AP2/ERF superfamily in Vitis vinifera. BMC Genom. 2010, 11, 719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, B.; Zhang, B.; Ding, L.; Li, P.; Shen, L.; Zhang, J. Physiological change and transcriptome analysis of Chinese wild Vitis amurensis and Vitis vinifera in response to cold stress. Plant Mol. Biol. Rep. 2020, 38, 478–490. [Google Scholar] [CrossRef]
- Kim, S.A.; Ahn, S.Y.; Yun, H.K. Transcriptome analysis of grapevine shoots exposed to chilling temperature for four weeks. Hortic. Environ. Biotechnol. 2016, 57, 161–172. [Google Scholar] [CrossRef]
- Pelett, H. Comparison of cold hardiness levels of root and stem tissue. Can. J. Plant Sci. 1971, 51, 193–195. [Google Scholar] [CrossRef]
- Okamoto, G.; Wang, S.; Hirano, K. Cold resistance in root and cane of own-root ‘Kyoho’ grapevines. Sci. Rep. Fac. Agric. 2000, 89, 23–29. [Google Scholar]
- Taiz, L.; Zeiger, E. Plant physiology. In Chapter 25: Stress Physiology, 5th ed.; Sinauer Associates, Inc.: Sunderland, MA, USA, 2010; pp. 591–623. [Google Scholar]
- Arms, K.; Camp, P.S. Biology, 4th ed.; Saunders College Publishing: Philadelphia, PA, USA, 2010; pp. 912–916. [Google Scholar]
- Zhang, B. Plant root research methods and trends. Agr. Sci. Tech. 2017, 18, 2295–2298. [Google Scholar]
- Rorat, T. Plant dehydrins-tissue location, structure and function. Cell. Mol. Biol. Lett. 2006, 11, 536–556. [Google Scholar] [CrossRef] [PubMed]
- Siddique, M.; Gernhard, S.; von Koskull-Döring, P.; Vierling, E.; Scharf, K.D. The plant sHSP superfamily: Five new members in Arabidopsis thaliana with unexpected properties. Cell Stress Chaperon. 2008, 13, 183–197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nachin, L.; Nannmark, U.; Nystrom, T. Differential roles of the universal stress proteins of Escherichia coli in oxidative stress resistance, adhesion, and motility. J. Bacteriol. 2005, 187, 6265–6272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chi, Y.H.; Koo, S.S.; Oh, H.T.; Lee, E.S.; Park, J.H.; Phan, K.A.T.; Wi, S.D.; Su, B.B.; Paeng, S.K.; Chae, H.B. The physiological functions of universal stress proteins and their molecular mechanism to protect plants from environmental stresses. Front. Plant Sci. 2019, 10, 750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Briat, J.F.; Ravet, K.; Arnaud, N.; Boucherez, J.; Touraine, B.; Cellier, F.; Gaymard, F. New insights into ferritin synthesis and function highlight a link between iron homeostasis and oxidative stress in plants. Ann. Bot. 2010, 105, 811–822. [Google Scholar] [CrossRef] [Green Version]
- Djuika, C.F.; Fiedler, S.; Schnölzer, M.; Sanchez, C.; Lanzer, M.; Deponte, M. Plasmodium falciparum antioxidant protein as a model enzyme for a special class of glutaredoxin/glutathione-dependent peroxiredoxins. Biochim. Et Biophys. Acta 2013, 1830, 4073–4090. [Google Scholar] [CrossRef]
- Arthur, J.R. The glutathione peroxidases. Cell. Mol. Life Sci. 2000, 57, 1825–1835. [Google Scholar] [CrossRef]
- Liu, H.; Yu, C.; Li, H.; Ouyang, B.; Wang, T.; Zhang, J.; Wang, X.; Ye, Z. Overexpression of ShDHN, a dehydrin gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses in tomato. Plant Sci. 2015, 231, 198–211. [Google Scholar] [CrossRef]
- Yu, J.J.; Nou, I.S.; Kang, K.K. Overexpression of Oshsp16.9 gene encoding small heat shock protein enhances tolerance to abiotic stresses in rice. Plant Breed. Biotech. 2014, 2, 370–379. [Google Scholar]
- Melencion, S.M.B.; Chi, Y.H.; Pham, T.T.; Paeng, S.K.; Wi, S.D.; Lee, C.; Ryu, S.W.; Koo, S.S.; Lee, S.Y. RNA chaperone function of a universal stress protein in Arabidopsis confers enhanced cold stress tolerance in plants. Int. J. Mol. Sci. 2017, 18, 2546. [Google Scholar] [CrossRef] [Green Version]
- Zang, X.; Geng, X.; Wang, F.; Liu, Z.; Zhang, L.; Zhao, Y.; Tian, X.; Ni, Z.; Yao, Y.; Xin, M.; et al. Overexpression of wheat ferritin gene TaFER-5B enhances tolerance to heat stress and other abiotic stresses associated with the ROS scavenging. BMC Plant Biol. 2017, 17, 14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, D.; Yu, X.; Ma, L.; Hu, J.; Liang, Y.; Liu, X.; Yin, H.; Liu, H.; He, X.; Li, D. Transcriptomic response of Chinese Yew (Taxus chinensis) to cold stress. Front. Plant Sci. 2017, 8, 468. [Google Scholar] [CrossRef]
- Hunter, T. Protein kinases and phosphatases: The Yin and Yang of protein phosphorylation and signaling. Cell 1995, 80, 225–236. [Google Scholar] [CrossRef] [Green Version]
- Chawla, S.; Marothia, D.; Pati, P.K. Role of serine/threonine phosphatase PP2A class and its regulators in salinity stress tolerance in plants. In Protein Phosphatases and Stress Management in Plants; Pandey, G.K., Ed.; Springer: Cham, Switzerland, 2020; pp. 53–66. [Google Scholar]
- Wade, S.L.; Auble, D.T. The Rad23 ubiquitin receptor, the proteasome and functional specificity in transcriptional control. Transcription 2010, 1, 22–26. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Wu, K.; Gao, P.; Liu, X.; Li, G.; Wu, Z. GsLRPK, a novel cold-activated leucine-rich repeat receptor-like protein kinase from Glycine soja, is a positive regulator to cold stress tolerance. Plant Sci. 2014, 215, 19–28. [Google Scholar] [CrossRef]
- Zhang, Z.; Xiao, W.; Qiu, J.; Xin, Y.; Yan, J.; Liu, Q.; Chen, H.; Fu, Y.; Ma, H.; Chen, W.; et al. Nystose regulates the response of rice roots to cold stress via multiple signaling pathways: A comparative proteomics analysis. PLoS ONE 2020, 15, e0238381. [Google Scholar] [CrossRef]
- Na, W.; Gong, X.; Ma, F. Genome-wide identification of the radiation sensitivity protein-23 (RAD23) family members in apple (Malus x domestica Borkh.) and expression analysis of their stress responsiveness. J. Integr. Agric. 2017, 16, 60345–60347. [Google Scholar]
- Weinhäusel, A.; Griessler, R.; Krebs, A.; Zipper, P.; Haltrich, D.; Kulbe, K.D.; Nidetzky, B. alpha-1,4-D-glucan phosphorylase of gram-positive Corynebacterium callunae: Isolation, biochemical properties and molecular shape of the enzyme from solution X-ray scattering. Biochem. J. 1997, 326, 773–783. [Google Scholar] [CrossRef]
- Lee, C.K.; Le, Q.T.; Kim, Y.H.; Shim, J.H.; Lee, S.J.; Park, J.H.; Lee, K.P.; Song, S.H.; Auh, J.H.; Lee, S.J.; et al. Enzymatic synthesis and properties of highly branched rice starch amylose and amylopectin cluster. J. Agric. Food Chem. 2008, 56, 126–131. [Google Scholar] [CrossRef]
- Tucker, G.; Zhang, J. Expression of polygalacturonase and pectinesterase in normal and transgenic tomatoes. Progr. Biotechnol. 1996, 14, 347–354. [Google Scholar]
- Vijayakumar, A.; Rajasekharan, R. Distinct roles of alpha/beta hydrolase domain containing proteins. Biochem. Mol. Biol. J. 2016, 2, 19. [Google Scholar] [CrossRef]
- Jing, Z.; Feng, H. Studies on the molecular docking and amino acid residues involving in recognition of substrate in proline iminopeptidase by site-directed mutagenesis. Protein J. 2015, 34, 173–180. [Google Scholar] [CrossRef] [PubMed]
- Bouvier-Navé, P.; Husselstein, T.; Desprez, T.; Benveniste, P. Identification of cDNAs encoding sterol methyl-transferases involved in the second methylation step of plant sterol biosynthesis. Eur. J. Biochem. 1997, 246, 518–529. [Google Scholar] [CrossRef]
- Sitnicka, D.; Orzechowski, S. Cold-induced starch degradation in potato leaves-intercultivar differences in the gene expression and activity of key enzymes. Biol. Plant 2014, 58, 659–666. [Google Scholar] [CrossRef]
- Zhao, H.; Liu, B.; Zhang, W.; Cao, J.; Jiang, W. Enhancement of quality and antioxidant metabolism of sweet cherry fruit by near-freezing temperature storage. Postharvest Biol. Tec. 2019, 147, 113–122. [Google Scholar] [CrossRef]
- Trézéguet, V.; Pélosi, L.; Lauquin, G.J.; Brandolin, G. The mitochondrial ADP/ATP carrier: Functional and structural studies in the route of elucidating pathophysiological aspects. J. Bioenerg. Biomembr. 2008, 40, 435–443. [Google Scholar] [CrossRef] [PubMed]
- Mueller-Cajar, O.; Stotz, M.; Wendler, P.; Hartl, F.U.; Bracher, A.; Hayer-Hartl, M. Structure and function of the AAA+ protein CbbX, a red-type Rubisco activase. Nature 2011, 479, 194–199. [Google Scholar] [CrossRef] [PubMed]
- Noctor, G.; Queval, G.; Gakière, B. NAD(P) synthesis and pyridine nucleotide cycling in plants and their potential importance in stress conditions. J. Exp. Bot. 2006, 57, 1603–1620. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, L.; Qin, G.; Kang, D.; Chen, Z.; Gu, H.; Qu, L.J. A nuclear-encoded mitochondrial gene AtCIB22 is essential for plant development in Arabidopsis. J. Genet. Genom. 2010, 37, 667–683. [Google Scholar] [CrossRef]
- Sun, Y.; Wu, Z.; Wang, Y.; Yang, J.; Wei, G.; Minxia, C. Identification of phytocyanin gene family in legume plants and their involvement in nodulation of Medicago truncatula. Plant Cell Physiol. 2019, 4, 900–915. [Google Scholar] [CrossRef] [PubMed]
- Acevedo, R.M.; Maiale, S.J.; Pessino, S.C.; Bottini, R.; Ruiz, O.A.; Sansberro, P.A. A succinate dehydrogenase flavoprotein subunit-like transcript is upregulated in Ilex paraguariensis leaves in response to water deficit and abscisic acid. Plant Physiol. Biochem. 2013, 65, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Decatur, W.A.; Fournier, M.J. rRNA modifications and ribosome function. Trends Biochem. Sci. 2002, 27, 344–351. [Google Scholar] [CrossRef]
- Breiman, A.; Fawcett, T.W.; Ghirardi, M.L.; Mattoo, A.K. Plant organelles contain distinct peptidylprolyl cis, trans-isomerases. J. Biol. Chem. 1992, 267, 21293–21296. [Google Scholar] [CrossRef]
- Cheng, L.B.; Li, S.Y.; Yang, G.X.; Jing, X.M.; He, G.Y.; Mones, N.G. Overexpression of soybean (Glycine max (L.) Meer.) L34 gene leads to reduced survival to cold stress in transgenic Arabidopsis. Plant Mol. Biol. Rep. 2010, 28, 41. [Google Scholar] [CrossRef]
- Zhang, J.; Yuan, H.; Yang, Y.; Fish, T.; Lyi, S.M.; Thannhauser, T.W.; Zhang, L.; Li, L. Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis. J. Exp. Bot. 2016, 67, 2731–2744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoon, D.H.; Lee, S.S.; Park, H.J.; Lyu, J.I.; Chong, W.S.; Liu, J.R.; Kim, B.G.; Ahn, J.C.; Cho, H.S. Overexpression of OsCYP19-4 increases tolerance to cold stress and enhances grain yield in rice (Oryza sativa). J. Exp. Bot. 2016, 67, 69–82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, B.Z.; Jin, J.Z.; Bai, S.; Huang, L.P. Improvement of TTC method determining root activity in corn. Maize Sci. 1994, 2, 44–47. [Google Scholar]
- Sheoran, I.S.; Ross, A.R.; Olson, D.J.; Sawhney, V.K. Compatibility of plant protein extraction methods with mass spectrometry for proteome analysis. Plant Sci. 2009, 176, 99–104. [Google Scholar] [CrossRef]
- Wisniewski, J.R.; Zougman, Q. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef]
- Gao, K.; Deng, X.Y.; Shang, M.K.; Qin, G.X.; Hou, C.X.; Guo, X.J. iTRAQ-based quantitative proteomic analysis of midgut in silkworm infected with Bombyx mori cytoplasmic polyhedrosis virus. J. Proteom. 2017, 152, 300–311. [Google Scholar] [CrossRef] [PubMed]
- Hou, L.B.; Xiu, Y.J.; Wang, J.; Liu, X.; Liu, Y.; Gu, W.; Wang, W.; Meng, Q. iTRAQ-based quantitative proteomic analysis of Macrobrachium rosenbergii hemocytes during Spiroplasma eriocheiris infection. J. Proteom. 2016, 136, 112–122. [Google Scholar] [CrossRef] [PubMed]
- Jeswin, J.; Xie, X.L.; Ji, Q.L.; Wang, K.J.; Liu, H.P. Proteomic analysis by iTRAQ in red claw crayfish, Cherax quadricarinatus, hematopoietic tissue cells post white spot syndrome virus infection. Fish Shellfish. Immunol. 2016, 50, 288–296. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.B.; Fu, H.T.; Sun, S.M.; Jiang, S.F.; Xiong, Y.W.; Gong, Y.S.; Qiao, H.; Zhang, W.Y.; Wu, Y. iTRAQ-based quantitative proteomic analysis of the androgenic glands of the oriental river prawn, Macrobrachium nipponense, during nonreproductive and reproductive seasons. Comp. Biochem. Physiol. Part D Genom. Proteom. 2018, 26, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Yu, Z.F.; Ye, Z.W.; Su, M.S. Multiplex analyses of the changes of aromatic compounds during the development of peach fruit using GC–MS and iTRAQ proteomic techniques. Sci. Hortic. 2018, 236, 96–105. [Google Scholar] [CrossRef]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef] [PubMed]
- Schneider, M.; Tognolli, M.; Bairoch, A. The Swiss-Prot protein knowledgebase and ExPASy: Providing the plant community with high quality proteomic data and tools. Plant Physiol. Biochem. 2004, 42, 1013–1021. [Google Scholar] [CrossRef]
- Conesa, A.; Gotz, S.; Garcia-Gomez, J.M.; Terol, J.; Talon, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, M.F.; Li, J.; Wei, J.H.; Paré, P.W. Transcriptional controls for early bolting and flowering in Angelica sinensis. Plants 2021, 10, 1931. [Google Scholar] [CrossRef]
- Cui, Y.; Yang, M.M.; Dong, J.; Zhao, W.C.; Gao, X. iTRAQ-based quantitative proteome characterization of wheat grains during filling stages. J. Integr. Agric. 2017, 16, 2156–2167. [Google Scholar] [CrossRef]
- Liu, J.Y.; Men, J.L.; Chang, M.C.; Feng, C.P.; Yuan, L.G. iTRAQ-based quantitative proteome revealed metabolic changes of Flammulina velutipes mycelia in response to cold stress. J. Proteom. 2017, 156, 75–84. [Google Scholar] [CrossRef]
- Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real-time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef] [PubMed]
Protein Name (Abbreviation) | SwissProt ID | log2 FC (T2 vs. T1) | log2 FC (T1 vs. T3) |
---|---|---|---|
Stress response (6) | |||
Dehydrin (DHN1) | Q4VT48 | 1.34 | 1.78 |
SHSP domain-containing protein (SHSPCP) | F6HJZ4 | 1.76 | 2.01 |
Usp domain-containing protein (USPCP) | F6H727 | 1.60 | 2.69 |
Ferritin (FER) | A5BV73 | 2.83 | 1.83 |
Glutaredoxin-dependent peroxiredoxin (GluDP) | A5ARL2 | 2.72 | 1.92 |
Glutathione peroxidase (GPX) | D7TW03 | 1.28 | 1.73 |
Bio-signaling (4) | |||
Protein kinase domain-containing protein (PKCP) | A5ALY7 | 1.44 | 1.27 |
Serine/threonine-protein phosphatase (S/TPP) | D7TV73 | 1.98 | 2.92 |
Non-specific serine/threonine protein kinase (nsS/TPK) | F6H1V3 | 1.75 | 2.07 |
Ubiquitin receptor RAD23 (RAD23) | D7T959 | 1.22 | 1.35 |
Metabolism (6) | |||
Alpha-1,4 glucan phosphorylase (GluP) | D7SXJ4 | 2.65 | 1.36 |
1,4-alpha-glucan branching enzyme (GluBE) | E0CQR2 | 0.58 | 1.57 |
Pectinesterase (PE) | F6HZ64 | 0.63 | 2.92 |
Abhydrolase 3 domain-containing protein (ABHD3CP) | F6HQC6 | 0.84 | 1.21 |
Proline iminopeptidase (ProIP) | D7T3J3 | 2.28 | 1.94 |
Methyltransferase (MT) | A5B620 | 2.61 | 1.75 |
Energy (6) | |||
ADP/ATP carrier protein (AAC) | A5BVR2 | 1.63 | 1.61 |
AAA domain-containing protein (AAACP) | D7TZI9 | 1.61 | 1.59 |
NAD(P)-bd dom domain-containing protein (NADCP) | F6HL96 | 1.59 | 2.06 |
NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 (NDUFB7) | A5BAM7 | 1.82 | 2.61 |
Phytocyanin domain-containing protein (PCP) | A5C3C3 | 1.85 | 2.83 |
Succinate dehydrogenase [ubiquinone] flavoprotein subunit (SDHFS) | A5BGN3 | 1.69 | 1.88 |
Translation(3) | |||
Ribosomal protein L14 (rpL14) | B6VJZ7 | 2.61 | 2.80 |
40S ribosomal protein S21 (rpS21) | A5BUA6 | 2.76 | 1.67 |
Peptidylprolyl isomerase (PPI) | D7UDY0 | 1.61 | 2.51 |
Protein Name (Abbreviation) | Sequences (5′ to 3′) | Amplicon Size (bp) | Accession No. |
---|---|---|---|
Actin | Forward: CGCAGAGCACTTCTTTCCCA | 181 | XM_010657947.2 |
Reverse: ATAGTGATGCCGCCTGATCC | |||
Dehydrin (DHN1) | Forward: ACCCAGTCCATCAAACCGAG | 113 | NM_001281292.1 |
Reverse: GGATGAAGAGCTGCCGGATT | |||
Ferritin (FER) | Forward: GGAGCAGGACCAAGACCAAG | 138 | AM472371.2 |
Reverse: GGAGATGGTGGGAAGCTCTG | |||
Glutathione peroxidase (GPX) | Forward: CACCGTTAAGGATGCTGAGG | 153 | XM_002272900.4 |
Reverse: GGCCTTGATCTTTGTACTTCTCG | |||
Serine/threonine-protein phosphatase (S/TPP) | Forward: TCAACTGCCTTCCTGTAGCC | 122 | XM_002277780.3 |
Reverse: TGGTACATCAACAGGGCGAG | |||
Ubiquitin receptor RAD23 (RAD23) | Forward: CAATGGGTTTTGACCGTGCC | 170 | XM_002282316.3 |
Reverse: TGGTTCTAGGGGGATGGAGG | |||
Alpha-1,4 glucan phosphorylase (GluP) | Forward: GAGGCTTTGCGTGAACTTGG | 105 | XM_002279039.3 |
Reverse: CAGAAAGCAGGAAGCAAGCC | |||
Pectinesterase (PE) | Forward: TGCTGATGTTGGTGGGAGAC | 173 | XM_002271629.4 |
Reverse: CACTGCTTGGTGATTGCTCG | |||
Methyltransferase (MT) | Forward: TAGGCGTGAGATGTGTGTGG | 197 | AM447844.2 |
Reverse: GACCTGCCTGCTTCGGTAAG | |||
ADP/ATP carrier protein (AAC) | Forward: CCCTTGGGGCTTTTTCCCAT | 160 | AM472940.2 |
Reverse: GGGCAAAGCATGTCCACTAC | |||
NAD(P)-bd dom domain-containing protein (NADCP) | Forward: TGGTTGGGTCTATGGGAGGA | 174 | XM_010655958.2 |
Reverse: GTAATTCCCGGATGCCACCT | |||
Phytocyanin domain-containing protein (PCP) | Forward: GCCCAGACCATTACGGATAGG | 182 | AM480712.2 |
Reverse: CCACATTGGTCGGCTTTGAG | |||
Ribosomal protein L14 (rpL14) | Forward: CCGCGACTTCGGTCTTTTTC | 134 | FN595512.1 |
Reverse: GCCTTACGTCTGTCTGGAGG | |||
Peptidylprolyl isomerase (PPI) | Forward: TCGGGGGAAACTCACAGATG | 141 | XM_002271020.4 |
Reverse: TTTCGCTTCTCACCCACACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, S.; Su, H.; Xing, H.; Mao, J.; Sun, P.; Li, M. Comparative Proteomics Reveals the Difference in Root Cold Resistance between Vitis. riparia × V. labrusca and Cabernet Sauvignon in Response to Freezing Temperature. Plants 2022, 11, 971. https://doi.org/10.3390/plants11070971
Chen S, Su H, Xing H, Mao J, Sun P, Li M. Comparative Proteomics Reveals the Difference in Root Cold Resistance between Vitis. riparia × V. labrusca and Cabernet Sauvignon in Response to Freezing Temperature. Plants. 2022; 11(7):971. https://doi.org/10.3390/plants11070971
Chicago/Turabian StyleChen, Sijin, Hongyan Su, Hua Xing, Juan Mao, Ping Sun, and Mengfei Li. 2022. "Comparative Proteomics Reveals the Difference in Root Cold Resistance between Vitis. riparia × V. labrusca and Cabernet Sauvignon in Response to Freezing Temperature" Plants 11, no. 7: 971. https://doi.org/10.3390/plants11070971