Assessing Genetic Variation among Strychnos spinosa Lam. Morphotypes Using Simple Sequence Repeat Markers
Abstract
:1. Introduction
2. Results
2.1. Genetic Variability among Strychnos spinosa Morphotypes
2.2. Genetic Distance between Strychnos spinosa Morphotypes Based on Simple Sequence Repeat Markers
2.3. Population Structure among Strychnos spinosa
2.4. Principal Coordinate Analysis
2.5. The Phylogenetic Relationship among Strychnos spinosa Morphotypes
3. Discussion
3.1. Allelic Profile of Simple Sequence Repeats
3.2. Genetic Diversity, Observed and Expected Heterozygosity, and Polymorphic Information Content
3.3. Genetic Distance
3.4. Population Structure
3.5. Principal Coordinate Analysis and Phylogenetic Relationship
4. Materials and Methods
4.1. Plant Material and DNA Isolation
4.2. Genotyping Using Simple Sequence Repeat Markers
4.3. Simple Sequence Repeats Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Omotayo, A.O.; Aremu, A.O. Undervalued Spiny Monkey Orange (Strychnos spinosa Lam.): An Indigenous Fruit for Sustainable Food-Nutrition and Economic Prosperity. Plants 2021, 10, 2785. [Google Scholar] [CrossRef]
- Zhang, H.; Mittal, N.; Leamy, L.J.; Barazani, O.; Song, B.H. Back into the wild—Apply untapped genetic diversity of wild relatives for crop improvement. Evol. Appl. 2017, 10, 5–24. [Google Scholar] [CrossRef] [PubMed]
- Mbhele, Z.; Zharare, G.E.; Zimudzi, C.; Ntuli, N.R. Morphological Variation of Strychnos spinosa Lam. Morphotypes: A Case Study at Bonamanzi Game Reserve, KwaZulu-Natal, South Africa. Diversity 2022, 14, 1094. [Google Scholar] [CrossRef]
- Avramidou, E.V.; Moysiadis, T.; Ganopoulos, I.; Michailidis, M.; Kissoudis, C.; Valasiadis, D.; Kazantzis, K.; Tsaroucha, E.; Tsaftaris, A.; Molassiotis, A.; et al. Phenotypic, Genetic, and Epigenetic Variation among Diverse Sweet Cherry Gene Pools. Agronomy 2021, 11, 680. [Google Scholar] [CrossRef]
- Oluwajuwon, T.V.; Attafuah, R.; Offiah, C.J.; Krabel, D. Genetic Variation in Tropical Tree Species and Plantations: A review. Open J. For. 2022, 12, 350–366. [Google Scholar] [CrossRef]
- Salgotra, R.K.; Chauhan, B.S. Genetic Diversity, Conservation and Utilization of plant Genetic Resources. Genes 2023, 14, 174. [Google Scholar] [CrossRef]
- Panzeri, D.; Nissim, W.G.; Labra, M.; Grassi, F. Revisiting the Domestication Process of African Vigna Species (Fabaceae): Background, Perspectives and Challenges. Plants 2022, 11, 532. [Google Scholar] [CrossRef]
- Cao, L.; Liu, H.; Mulder, H.A.; Henryon, M.; Thomasen, J.R.; Cargo, M.; Sørensen, A.C. Genomic Breeding Programs Realize Larger Benefits by Co-operation in the Presence of Genotype X Environment Interaction than Conventional Breeding Programs. Front. Genet. 2020, 11, 251. [Google Scholar] [CrossRef] [Green Version]
- Tsobeng, A.; Akem, M.; Avana, M.L.; Machugi, A.; Degrande, A.; Tchoundjeu, Z.; Jamnadass, R.; Na’s, F. Tree-to-Tree Variation in Fruits of Three Populations of Trichoscypha acuminata (Engl.) in Cameroon. Sci. Afr. 2020, 7, e00235. [Google Scholar] [CrossRef]
- Petrokas, R.; Kavaliauskas, D. Concept for Genetic Monitoring of Hemiboreal Tree Dynamics in Lithuania. Land 2022, 11, 1249. [Google Scholar] [CrossRef]
- Soriano, J.M. Molecular Marker Technology for Crop Improvement. Agronomy 2020, 10, 1462. [Google Scholar] [CrossRef]
- Liu, Y.; Xiao, X.; Li, G.; Zhu, C.; Yang, K.; Feng, X.; Lou, Y.; Gao, Z. Comprehensive Analyses of Simple Sequence Repeat (SSR) in Bamboo Genomes and Development of SSR Markers with Peroxidase Genes. Genes 2022, 13, 1518. [Google Scholar] [CrossRef]
- Huang, H. Discovery and Domestication of New Fruit Trees in the 21st Century. Plants 2022, 11, 2107. [Google Scholar] [CrossRef]
- Hoveka, L.N.; van der Bank, M.; Bezeng, B.S.; Davies, T.J. Identifying Biodiversity Knowledge Gaps for Conserving South Africa’s Endemic Flora. Biodivers. Conserv. 2020, 29, 2803–2819. [Google Scholar] [CrossRef]
- Xu, R.X.; Wang, Z.; Su, Y.J.; Wang, T. Characterization and Development of Microsatellite Markers in Pseudotaxus chienii (Taxaceae) Based on Transcriptome Sequencing. Front. Genet. 2020, 11, 574304. [Google Scholar] [CrossRef]
- Misganaw, A.; Abera, S. Genetic Diversity Assessment of Guoita abyssinica Using EST Derived Sample Sequence Repeats (SSRs) Markers. Afr. J. Plant Sci. 2017, 11, 79–85. [Google Scholar] [CrossRef] [Green Version]
- Dida, G. Molecular Markers in Breeding of Crops: Recent Progress and Advancements. J. Microbiol. Biotechnol. 2022, 7, 4. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Poczai, P.; Etminan, A.; Jadidi, O.; Kianersi, F.; Shooshtari, L. An Analysis of Genetic Variability and Population Structure in Wheat Germplasm Using Microsatellite and Gene Based Markers. Plants 2022, 11, 1205. [Google Scholar] [CrossRef]
- Song, Y.-G.; Wang, T.-R.; Lu, Z.-J.; Ge, B.-J.; Zhong, X.; Li, X.-C.; Jin, D.-M.; Yuan, Q.; Li, Y.; Kang, Y.-X.; et al. Population Survey Combined with Genomic-Wide Genetic Variation Unravels the Endangered Status of Quercus gilva. Diversity 2023, 15, 230. [Google Scholar] [CrossRef]
- Kumar, C.; Kumar, R.; Singh, S.K.; Goswami, A.K.; Nagaraja, A.; Paliwal, R.; Singh, R. Development of Novel g-SSR Markers in Guava (Psidium guajava L.) cv. Allahabad safeda and their Application in Genetic Diversity, Population Structure and Cross Species Transferability Studies. PLoS ONE 2020, 15, 8. [Google Scholar] [CrossRef]
- Chepkoech, E.; Rotich, F.; Alkomoi, B. Assessment of Genetic Variability of Passion Fruit using Simple Sequence Repeat (SSR) Markers. J. Agric. Sci. Pract. 2020, 5, 5. [Google Scholar]
- Bhardwaj, V.; Kumar, A.; Sharma, S.; Singh, B.; Poonam; Sood, S.; Dipta, B.; Singh, R.; Siddappa, S.; Thakur, A.K.; et al. Analysis of Genetic Diversity, Population Structure and Association Mappingfor Late Blight Resistance in Potato (Solanum tuberosum L.) Accessions Using SSR Markers. Agronomy 2023, 13, 294. [Google Scholar] [CrossRef]
- Lebedev, V.G.; Subbotina, N.M.; Maluchenko, O.P.; Krutovsky, K.V.; Shestibratov, K.A. Assessment of Genetic Diversity in Differently Coloured Raspberry Cultivars using SSR Markers Located in Flavonoid Biosynthesis Genes. Agronomy 2019, 9, 518. [Google Scholar] [CrossRef] [Green Version]
- Owati, A.; Agindotan, B.; Burrows, M. First Microsatellite Markers Developed and Applied for the Genetic Diversity Study and Population Structure of Didymella pisi Associated with Ascochyta Blight of Dry Pea in Montana. Fungal Biol. 2019, 123, 384–392. [Google Scholar] [CrossRef] [PubMed]
- Villanueva-Gutierrez, E.E.; Johansson, E.; Prieto-Linde, M.L.; Quezada, A.C.; Olsson, M.E.; Geleta, M. Simple Sequence Repeat Markers Reveal Genetic Diversity and Population Structure of Bolivian Wild and Cultivated Tomatoes (Solanum lycopersicum L.). Genes 2022, 13, 1505. [Google Scholar] [CrossRef] [PubMed]
- Juma, I.; Geleta, M.; Hovmalm, H.P.; Nyomora, A.; Saripella, G.V.; Carlsson, A.S.; Fatih, M.; Ortiz, R.O. Comparison of Morphological and Genetic Characteristics of Avocados Grown in Tanzania. Genes 2021, 12, 63. [Google Scholar] [CrossRef]
- Lu, W.; Arnold, R.J.; Zhang, L.; Luo, J. Genetic Diversity and Structure through Three Cycles of a Eucalyptus urophylla S.T.Blake Breeding Program. Forests 2018, 9, 372. [Google Scholar] [CrossRef] [Green Version]
- Garnier-Géré, P.; Chikhi, L. Population subdivision, Hardy–Weinberg equilibrium and the Wahlund effect. In eLS; John Wiley and Sons: Hoboken, NJ, USA, 2013. [Google Scholar]
- Evans, S.A.; Whigham, D.F.; Hartvig, I.; McCormick, M.K. Hybridization in the Fringed Orchids: An Analysis of Species Boundaries in the Face of Gene Flow. Diversity 2023, 15, 384. [Google Scholar] [CrossRef]
- Ngadze, R.T.; Verkerk, R.; Nyanga, L.K.; Fogliano, V.; Linnemann, A.R. Improvement of Traditional Processing of Local Monkey Orange (Strychnos spp.) Fruits to Enhance Nutrition Security in Zimbabwe. Food Secur. 2017, 9, 621–633. [Google Scholar] [CrossRef] [Green Version]
- Gumede, M.T.; Gerrano, A.S.; Modi, A.T.; Thungo, Z. Influence of Genotype and Environment on Grain Yield among Cowpea (Vigna unguiculata (L.) Walp) Genotypes under Dry Land Farming System. Acta Agric. Scand. Sect. B Soil Plant Sci. 2022, 72, 709–719. [Google Scholar] [CrossRef]
- Reddy, M.T.; Babu, K.H.; Ganesh, M.; Begum, H.; Dilipbabu, J.; Reddy, R.S.K. Gene Action and Combining Ability of Yield and its Components for Late Kharif Season in Okra (Abelmoschus esculentus (L.) Moench). Chil. J. Agric. Res. 2013, 73, 9–16. [Google Scholar] [CrossRef] [Green Version]
- He, Z.; Yao, Z.; Wang, K.; Li, Y.; Liu, Y. Genetic Structure and Differentiation of Endangered Cycas Species Indicate a Southward Migration Associated with Historical Cooling Events. Diversity 2023, 15, 643. [Google Scholar] [CrossRef]
- Schierenbeck, K.A. Population-Level Genetic Variation and Climate Change in Biodiversity Hotspot. Ann. Bot. 2017, 119, 215–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kahilainen, A.; Puurtinen, M.; Kotiaho, J.S. Conservation Implications of Species–Genetic Diversity Correlations. Glob. Ecol. Conserv. 2014, 2, 315–323. [Google Scholar] [CrossRef] [Green Version]
- Rehman, A.u.; Dang, T.; Qamar, S.; Ilyas, A.; Fatema, R.; Kafle, M.; Hussain, Z.; Masood, S.; Iqbal, S.; Shahzad, K. Revisiting Plant Heterosis—From Field Scale to Molecules. Genes 2021, 12, 1688. [Google Scholar] [CrossRef]
- Singh, H.; Sekhon, B.S.; Kumar, P.; Dhall, R.K.; Devi, R.; Dhillon, T.S.; Sharma, S.; Khar, A.; Yadav, R.K.; Tomar, B.S.; et al. Genetic Mechanisms for Hybrid Breeding in Vegetable Crops. Plants 2023, 12, 2294. [Google Scholar] [CrossRef]
- Ha, Y.-H.; Oh, S.-H.; Lee, S.-R. Genetic Admixture in the Population of Wild Apple (Malus sieversii) from the Tien Shan Mountains, Kazakhstan. Genes 2021, 12, 104. [Google Scholar] [CrossRef]
- Lin, X.; Liu, X.; Chen, M.; Gao, H.; Zhu, Z.; Ding, Z.; Zhou, Z. Assessment of Genetic Diversity and Discovery of Molecular Markers in Durian (Durio zibethinus L.) in China. Diversity 2022, 14, 769. [Google Scholar] [CrossRef]
- Ong, P.W.; Lin, Y.P.; Chen, H.W.; Lo, C.Y.; Burlyaeva, M.; Noble, T.; Nair, R.M.; Schafleitner, R.; Vishnyakova, M.; Bishop-von-Wettberg, E.; et al. Environment as a Limiting Factor of the Historical Global Spread of Mungbean. eLife 2023, 12, e85725. [Google Scholar] [CrossRef]
- Raffard, A.; Santoul, F.; Cucherousset, J.; Blanchet, S. The Community and Ecosystem Consequences of Intraspecific Diversity: A Meta-Analysis. Biol. Rev. 2019, 94, 648–661. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using software Structure: A Simulation Study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Green Version]
- Earl, D.; Vonholdt, B. Sructure Harvester: A Website and Program for Visualizing Structure Output and Implementing the Evanno Method. Conserv. Genet. Resour. 2011, 4, 359–361. [Google Scholar] [CrossRef]
Marker | Dye Used | Primer Sequences (5′-3′) | SSR Sequence | AS c | S d | AN e | MAF f | GD g | H0 h | He i | PIC j |
---|---|---|---|---|---|---|---|---|---|---|---|
Ssp_1_F a | FAM | TGATGCAATGGATGTGTGCTAT | (ATTT)^6 | 144 | 32 | 4 | 0.76 | 0.40 | 0.36 | 0.35 | 0.39 |
Ssp_1_R b | FAM | TGAAGACGGCAATGCGAACC | 32 | 2 | 0.85 | 0.26 | 0.22 | ||||
Ssp_2_F | ATTO532 | TCGGAATACTACGGGCCACC | (AAAT)^5 | 199 | 32 | 4 | 0.58 | 0.58 | 0.31 | 0.34 | 0.52 |
Ssp_2_R | ATTO532 | TCCCTTCCAACCCTTCAATAAC | 32 | 4 | 0.61 | 0.55 | 0.49 | ||||
Ssp_6_F | FAM | GCCAGACAAGTTTCCCTCGG | (ATTT)^6 | 239 | 32 | 12 | 0.27 | 0.86 | 0.73 | 0.82 | 0.84 |
Ssp_6_R | FAM | CCCGCGCTCAATGCTCTTAC | 32 | 9 | 0.52 | 0.69 | 0.67 | ||||
Ssp_7_F | FAM | TCTTTGCTTTCTTCCTCGAAAGG | (ATTT)^5 | 281 | 32 | 6 | 0.27 | 0.78 | 0.26 | 0.76 | 0.74 |
Ssp_7_R | FAM | GTATGATAGGTTCCACACGGC | 32 | 5 | 0.24 | 0.77 | 0.74 | ||||
Ssp_8_F | ATTO532 | GCCTATGGCAAGCAATGTATTC | (AACT)^7 | 285 | 32 | 4 | 0.45 | 0.63 | 0.49 | 0.72 | 0.55 |
Ssp_8_R | ATTO532 | CCTTGAGTTCCAAGCTGCAC | 32 | 7 | 0.42 | 0.75 | 0.72 | ||||
Ssp_9_F | ATTO550 | CTGGACTGTCTTCTCGGGTTC | (AAAT)^5 | 288 | 32 | 6 | 0.76 | 0.41 | 0.50 | 0.51 | 0.40 |
Ssp_9_R | ATTO550 | CAATTGCCAGTAACCGTGTAGG | 32 | 4 | 0.52 | 0.55 | 0.46 | ||||
Ssp_10_F | ATTO550 | GACATACAAATAGAAGCACTGG | (ATTT)^5 | 181 | 32 | 5 | 0.70 | 0.49 | 0.34 | 0.59 | 0.46 |
Ssp_10_R | ATTO550 | CATGAGGGAAACCCACCCTG | 32 | 7 | 0.48 | 0.68 | 0.64 | ||||
Ssp_11_F | ATTO565 | ATTCTGGTCCCGTCACTGCC | (ATGC)^5 | 314 | 32 | 6 | 0.45 | 0.66 | 0.88 | 0.82 | 0.61 |
Ssp_11_R | ATTO565 | CTTCGGGTGCCAAAGTTCAC | 32 | 7 | 0.30 | 0.78 | 0.75 | ||||
Ssp_12_F a | FAM | TGCCTACTAACTAGCGTGAGG | (AAAT)^7 | 355 | 32 | 7 | 0.27 | 0.75 | 0.24 | 0.73 | 0.71 |
Ssp_12_R b | FAM | AGCCAGCGAATTGTGTTATCC | 32 | 9 | 0.33 | 0.74 | 0.70 | ||||
Ssp_13_F | ATTO550 | TCTATGTTGGAAATGCGCACG | (AATT)^5 | 140 | 32 | 4 | 0.64 | 0.53 | 0.00 | 0.28 | 0.47 |
Ssp_13_R | ATTO550 | CATTGCACACAAAGCTACCTG | 32 | 4 | 0.64 | 0.53 | 0.47 | ||||
Ssp_14_F | ATTO550 | GTTGGGGGTTAAACATTCAGC | (ATTT)^5 | 248 | 32 | 5 | 0.30 | 0.57 | 0.07 | 0.43 | 0.51 |
Ssp_14_R | ATTO550 | CACTTTTATGCTCCCGTGTCC | 32 | 4 | 0.33 | 0.55 | 0.48 | ||||
Ssp_15_F | FAM | CAAGGTTTCGCCGAGCTGC | (AAAT)^6 | 377 | 32 | 5 | 0.36 | 0.72 | 0.29 | 0.73 | 0.68 |
Ssp_15_R | FAM | CTTGGAGTCCCAAGAAGCCG | 32 | 5 | 0.36 | 0.74 | 0.69 | ||||
Ssp_18_F | ATTO565 | CAAAGCCCGAGGCATCAACC | (AAAT)^5 | 407 | 32 | 9 | 0.27 | 0.82 | 0.81 | 0.81 | 0.79 |
Ssp_18_R | ATTO565 | GAAACCTGGTACGGGCAGC | 32 | 6 | 0.42 | 0.71 | 0.67 | ||||
Ssp_19_F | ATTO532 | GATGGAGAGCCCAATGCAAG | (ATTT)^6 | 330 | 32 | 4 | 0.60 | 0.52 | 0.47 | 0.44 | 0.44 |
Ssp_19_R | ATTO532 | GCTGTGAATTGTTAAAGGTCAAC | 32 | 5 | 0.82 | 0.32 | 0.30 | ||||
Mean | 270.57 | 32 | 5.68 | 0.51 | 0.62 | 0.43 | 0.60 | 0.57 |
Morphotype | Fruit Colour | Fruit Texture | Fruit Shape | Fully Grown Leaf Colour | Leaf Shape | Leaf Form |
---|---|---|---|---|---|---|
GRP-dGEF | Green | Rough | Pyriform | Dark green | Elongated | Folded |
GRP-GEF | Green | Rough | Pyriform | Green | Elongated | Folded |
GRP-dGEO | Green | Rough | Pyriform | Dark green | Elongated | Open |
GRP-GEO | Green | Rough | Pyriform | Green | Elongated | Open |
GRP-dGRO | Green | Rough | Pyriform | Dark green | Roundish | Open |
GRP-GRO | Green | Rough | Pyriform | Green | Roundish | Open |
GRR-dGEO | Green | Rough | Roundish | Dark green | Elongated | Open |
GRR-GEO | Green | Rough | Roundish | Green | Elongated | Open |
GRR-dGRO | Green | Rough | Roundish | Dark green | Roundish | Open |
GRR-GRO | Green | Rough | Roundish | Green | Roundish | Open |
GRR-GEF | Green | Rough | Roundish | Green | Elongated | Folded |
GRxCP-dGEF | Green | Rough and corrugated | Pyriform | Dark green | Elongated | Folded |
GRxCP-GEF | Green | Rough and corrugated | Pyriform | Green | Elongated | Folded |
GRxCP-GEO | Green | Rough and corrugated | Pyriform | Green | Elongated | Open |
GRxCR-dGEF | Green | Rough and corrugated | Roundish | Dark green | Elongated | Folded |
GRxCR-GEF | Green | Rough and corrugated | Roundish | Green | Elongated | Folded |
GRxCR-dGEO | Green | Rough and corrugated | Roundish | Dark green | Elongated | Open |
GRxCR-dGRO | Green | Rough and corrugated | Roundish | Dark green | Roundish | Open |
GSR-dGRF | Green | Smooth | Roundish | Dark green | Roundish | Folded |
GSR-GEF | Green | Smooth | Roundish | Green | Elongated | Folded |
GSR-GEO | Green | Smooth | Roundish | Green | Elongated | Open |
GSR-GRO | Green | Smooth | Roundish | Green | Roundish | Open |
GSxCR-dGRF | Green | Smooth and corrugated | Roundish | Dark green | Roundish | Folded |
GvRR-dGEO | Green | Very rough | Roundish | Dark green | Elongated | Open |
GvRR-dGRO | Green | Very rough | Roundish | Dark green | Roundish | Open |
GvRR-GRO | Green | Very rough | Roundish | Green | Roundish | Open |
GvRxCR-GEF | Green | Very rough | Roundish | Green | Elongated | Folded |
PRR-dGRF | Purple | Rough | Roundish | Dark green | Roundish | Folded |
PRR-dGEF | Purple | Rough | Roundish | Dark green | Elongated | Folded |
PRR-dGRO | Purple | Rough | Roundish | Dark green | Roundish | Open |
PRxCP-dGEO | Purple | Rough | Pyriform | Dark green | Elongated | Open |
PRxCP-GEO | Purple | Rough | Pyriform | Green | Elongated | Open |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mbhele, Z.; Zharare, G.E.; Zimudzi, C.; Ntuli, N.R. Assessing Genetic Variation among Strychnos spinosa Lam. Morphotypes Using Simple Sequence Repeat Markers. Plants 2023, 12, 2810. https://doi.org/10.3390/plants12152810
Mbhele Z, Zharare GE, Zimudzi C, Ntuli NR. Assessing Genetic Variation among Strychnos spinosa Lam. Morphotypes Using Simple Sequence Repeat Markers. Plants. 2023; 12(15):2810. https://doi.org/10.3390/plants12152810
Chicago/Turabian StyleMbhele, Zoliswa, Godfrey Elijah Zharare, Clemence Zimudzi, and Nontuthuko Rosemary Ntuli. 2023. "Assessing Genetic Variation among Strychnos spinosa Lam. Morphotypes Using Simple Sequence Repeat Markers" Plants 12, no. 15: 2810. https://doi.org/10.3390/plants12152810