Biodiesel Production from the Marine Alga Nannochloropsis oceanica Grown on Yeast Wastewater and the Effect on Its Biochemical Composition and Gene Expression
Abstract
:1. Introduction
2. Results
2.1. Evaluation of Dry Weight, Bioactive Components, Biomass, and Lipid Productivity
2.2. Amino Acids Estimation
2.3. Fatty Acids Analysis
2.4. Evaluation of Biodiesel Quality
2.5. The statistical Evaluation of the Different Parameters
2.6. Gene Expression Estimation of Grown N. oceanica on the Yeast Wastewater
3. Discussion
4. Materials and Methods
4.1. Algal Strain and Culture Conditions
4.2. Waste Effluent
4.3. Experimental Design
4.4. Algal Growth and Biomass Assay
4.5. Biomass Productivity
4.6. Biochemical Analysis
4.6.1. Protein
4.6.2. Carbohydrate
4.6.3. Lipid Extraction and Methylation
4.7. Lipid Productivity
4.8. Amino Acids
4.9. Produced Biodiesel Theoretical Features
4.10. RNA Extraction
4.11. RTq PCR
4.12. Enzyme Activity
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Abideen, Z.; Ansari, R.; Hasnain, M.; Flowers, T.J.; Koyro, H.W.; El-Keblawy, A.; Abouleish, M.; Khan, M.A. Potential use of saline resources for biofuel production using halophytes and marine algae: Prospects and pitfalls. Front. Plant Sci. 2023, 14, 1026063. [Google Scholar] [CrossRef] [PubMed]
- Marey, R.S.; Abo-Shady, A.M.; Abd El-Moneim, A.M.; Khairy, H.M. Growth and lipid productivity of a promising candidate Micractinium reisseri (JN169781) under changes in salinity and some carbon sources. Egypt. J. Aquat. Biol. Fish. 2022, 26, 257–278. [Google Scholar] [CrossRef]
- Marey, R.S.; Abo-Shady, A.M.; Khairy, H.M.; Abd El-Moneim, A.M.; Abomohra, A. Enhanced lipid production and essential ω-fatty acids synthesis by the hypersaline biodiesel-promising microalga Tetraselmis elliptica through growth medium optimization. Biomass Convers. Biorefin. 2022, 1–14. [Google Scholar] [CrossRef]
- Wu, X.D.; Ruan, R.; Du, Z.Y.; Liu, Y.H. Current status and prospects of biodiesel production from microalgae. Energies 2012, 5, 2667–2682. [Google Scholar] [CrossRef]
- Santos, F.M.; Gonçalves, A.L.; Pires, J.C. Negative Emission Technologies. In Bioenergy with Carbon Capture and Storage; Magalhães Pires, J.C., Da Cunha Gonçalves, A.L., Eds.; Academic Press: Amsterdam, The Netherlands, 2019; pp. 1–13. [Google Scholar] [CrossRef]
- Mahata, C.; Das, P.; Khan, S.; Thaher, M.I.A.; Abdul Quadir, M.; Annamalai, S.N.; Al Jabri, H. The potential of marine microalgae for the production of food, feed, and fuel (3F). Fermentation 2022, 8, 316. [Google Scholar] [CrossRef]
- Udayan, A.; Pandey, A.K.; Sirohi, R.; Sreekumar, N.; Sang, B.I.; Sim, S.J.; Kim, S.H.; Pandey, A. Production of microalgae with high lipid content and their potential as sources of nutraceuticals. Phytochem. Rev. 2022, 1–28. [Google Scholar] [CrossRef]
- Michels, M.H.A.; Van Der Goot, A.J.; Vermuë, M.H.; Wijffels, R.H. Cultivation of shear stress sensitive and tolerant microalgal species in a tubular photobioreactor equipped with a centrifugal pump. J. Appl. Phycol. 2016, 28, 53–62. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Zhang, L.; Xu, G.; Li, F.; Li, X. A review on biodiesel production from microalgae: Influencing parameters and recent advanced technologies. Front. Microbiol. 2022, 13, 970028. [Google Scholar] [CrossRef]
- He, Q.; Yang, H.; Hu, C. Effects of temperature and its combination with high light intensity on lipid production of Monoraphidium dybowskii Y2 from semi-arid desert areas. Bioresour. Technol. 2018, 265, 407–414. [Google Scholar] [CrossRef]
- Senousy, H.H.; Ellatif, S.A. Mixotrophic cultivation of Coccomyxa subellipsoidea microalga on industrial dairy wastewater as an innovative method for biodiesel lipids production. Jordan J. Biol. Sci. 2020, 13, 47–54. [Google Scholar]
- Ashour, M.; Elshobary, M.; Elshenody, R.; Abomohra, A. Evaluation of a native oleaginous marine microalga Nannochloropsis oceanica for dual use in biodiesel production and aquaculture feed. Biomass Bioenergy 2019, 120, 439–447. [Google Scholar] [CrossRef]
- Chisti, Y. Biodiesel from microalgae. Biotechnol. Adv. 2007, 25, 294–306. [Google Scholar] [CrossRef]
- Hu, Q.; Sommerfeld, M.; Jarvis, E.; Ghirardi, M.; Posewitz, M.; Seibert, M.; Darzins, A. Microalgal triacylglycerols as feed-stocks for biofuel production: Perspectives and advances. Plant J. 2008, 54, 621–639. [Google Scholar] [CrossRef]
- Ismail, M.; Ismail, G.; El-Sheekh, M.M. Potential assessment of some micro and macroalgal species for bioethanol and biodiesel production. Energy Sources Part A Recovery Util. Environ. Eff. 2020, 1–17. [Google Scholar] [CrossRef]
- Komolafe, O.; Velasquez Orta, S.B.; Monje-Ramirez, I.; Yáñez Noguez, I.; Harvey, A.P.; Orta Ledesma, M.T. Biodiesel production from indigenous microalgae grown in wastewater. Bioresour. Technol. 2014, 154, 297–304. [Google Scholar] [CrossRef]
- de Carvalho, J.C.; Molina-Aulestia, D.T.; Martinez-Burgos, W.J.; Karp, S.G.; Manzoki, M.C.; Medeiros, A.B.P.; Rodrigues, C.; Scapini, T.; Vandenberghe, L.P.S.; Vieira, S.; et al. Agro-Industrial Wastewaters for Algal Biomass Production, Bio-Based Products, and Biofuels in a Circular Bioeconomy. Fermentation 2022, 8, 728. [Google Scholar] [CrossRef]
- Polishchuk, A.; Valev, D.; Tarvainen, M.; Mishra, S.; Kinnunen, V.; Antal, T.; Yang, B.; Rintala, J.; Tyystjärvi, E. Cultivation of Nannochloropsis for eicosapentaenoic acid production in wastewaters of pulp and paper industry. Bioresour. Technol. 2015, 193, 469–476. [Google Scholar] [CrossRef]
- Sheehan, J.; Dunahay, T.; Benemann, J.; Roessler, P. A look back at the US Department of Energy’s aquatic species program: Biodiesel from algae. Natl. Renew. Energy Lab. 1998, 328, 1–294. [Google Scholar]
- Li, Y.; Chen, Y.F.; Chen, P.; Min, M.; Zhou, W.; Martinez, B.; Zhu, J.; Ruan, R. Characterization of a microalga Chlorella sp. well adapted to highly concentrated municipal wastewater for nutrient removal and biodiesel production. Bioresour. Technol. 2011, 102, 5138–5144. [Google Scholar] [CrossRef]
- Pittman, J.K.; Dean, A.P.; Osundeko, O. The potential of sustainable algal biofuel production using wastewater resources. Bioresour. Technol. 2011, 102, 17–25. [Google Scholar] [CrossRef]
- Bajpai, R.; Zappi, M.; Dufreche, S.; Subramaniam, R.; Prokop, A. Status of Algae as Vehicles for Commercial Production of Fuels and Chemicals. In Algal Biorefineries; Bajpai, R., Prokop, A., Zappi, M., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; Volume 1, pp. 3–24. [Google Scholar] [CrossRef]
- Xin, L.; Hong-Ying, H.; Ke, G.; Sun, Y.X. Effects of different nitrogen and phosphorus concentrations on the growth, nutrient uptake, and lipid accumulation of a freshwater microalga Scenedesmus sp. Bioresour. Technol. 2010, 101, 5494–5500. [Google Scholar] [CrossRef] [PubMed]
- Dias, C.; Santos, J.; Reis, A.; Lopes da, S.T. The Use of oleaginous yeasts and microalgae grown in brewery wastewater for lipid production and nutrient removal: A Review. Waste Biomass Valoriz. 2023, 14, 1799–1822. [Google Scholar] [CrossRef]
- El-Sheekh, M.M.; Gheda, S.; El-Sayed, A.B.; Abo Shady, A.; El-Sheikh, M.; Schagerl, M. Outdoor cultivation of the green microalga Chlorella vulgaris under culture stress conditions as a feedstock for biofuel. Environ. Sci. Pollut. Res. 2019, 26, 18520–18532. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.Y.; Yeh, K.L.; Aisyah, R.; Lee, D.J.; Chang, J.S. Cultivation, photobioreactor design and harvesting of microalgae for biodiesel production: A critical review. Bioresour. Technol. 2011, 102, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Sydney, E.B.; da Silva, T.E.; Tokarski, A.; Novak, A.C.; de Carvalho, J.C.; Woiciecohwski, A.L.; Larroche, C.; Soccol, C.R. Screening of microalgae with potential for biodiesel production and nutrient removal from treated domestic sewage. Appl. Energy 2011, 88, 3291–3294. [Google Scholar] [CrossRef]
- Abdelfattah, A.; Ali, S.S.; Ramadan, H.; El-Aswar, E.I.; Eltawab, R.; Ho, S.H.; Elsamahy, T.; Li, S.; El-Sheekh, M.M.; Schagerl, M.; et al. Microalgae-based wastewater treatment: Mechanisms, challenges, recent advances, and future prospects. Environ. Sci. Ecotechnol. 2022, 13, 100205. [Google Scholar]
- Park, J.B.; Craggs, R.J.; Shilton, A.N. Wastewater treatment high rate algal ponds for biofuel production. Bioresour. Technol. 2011, 102, 35–42. [Google Scholar] [CrossRef]
- Srimongkol, P.; Sangtanoo, P.; Songserm, P.; Watsuntorn, W.; Karnchanatat, A. Microalgae-based wastewater treatment for developing economic and environmental sustainability: Current status and future prospects. Front. Bioeng. Biotechnol. 2022, 10, 904046. [Google Scholar] [CrossRef]
- Shang, C.; Bi, G.; Qi, W.; Wang, Z.M.; Xie, J. Discovery of genes for production of biofuels through transcriptome sequencing of Dunaliella parva. Algal Res. 2016, 13, 318–326. [Google Scholar] [CrossRef]
- He, Q.; Lin, Y.; Tan, H.; Zhou, Y.; Wen, Y.; Gan, J.; Li, R.; Zhang, Q. Transcriptomic profiles of Dunaliella salina in response to hypersaline stress. BMC Genom. 2020, 21, 115. [Google Scholar] [CrossRef]
- Li, J.; Han, D.; Wang, D.; Ning, K.; Jia, J.; Jing, L.X.; Huang, S.; Chen, J.; Li, Y.; Hu, Q.; et al. Choreography of transcriptomes and lipidomes of Nannochloropsis reveals the mechanisms of oil synthesis in microalgae. Plant Cell 2014, 26, 1645–1665. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.E.; Smith, A.J. A look at diacylglycerol acyltransferases (DGATs) in algae. J. Biotechnol. 2012, 162, 28–39. [Google Scholar] [CrossRef]
- Boyle, N.R.; Page, M.D.; Liu, B.; Blaby, I.K.; Casero, D.; Kropat, J.; Cokus, S.J.; Hong-Hermesdorf, A.; Shaw, J.; Karpowicz, S.J.; et al. Three acyltransferases and nitrogen-responsive regulator are implicated in nitrogen starvation-induced triacylglycerol accumulation in Chlamydomonas. J. Biol. Chem. 2012, 287, 15811–15825. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.; Ning, K.; Li, J.; Hu, J.; Han, D.; Wang, H.; Zeng, X.; Jing, X.; Zhou, Q.; Su, X.; et al. Nannochloropsis genomes reveal evolution of microalgal oleaginous traits. PLoS Genet. 2014, 10, E1004094. [Google Scholar] [CrossRef]
- Mao, X.; Wu, T.; Kou, Y.; Shi, Y.; Zhang, Y.; Liu, J. Characterization of type I and type II diacylglycerol acyltransferases from the emerging model alga Chlorella zofingiensis reveals their functional complementarity and engineering potential. Biotechnol. Biofuels 2019, 12, 28. [Google Scholar] [CrossRef]
- Ma, H.; Wu, X.; Wei, Z.; Zhao, L.; Li, Z.; Liang, Q.; Zheng, J.; Wang, Y.; Li, Y.; Huang, L.; et al. Functional divergence of diacylglycerol acyltransferases in the unicellular green alga Haematococcus pluvialis. J. Exp. Bot. 2021, 72, 510–524. [Google Scholar] [CrossRef]
- Cecchin, M.; Berteotti, S.; Paltrinieri, S.; Vigliante, I.; Iadarola, B.; Giovannone, B.; Maffei, M.E.; Delledonne, M.; Ballottari1, M. Improved lipid productivity in Nannochloropsis gaditana in nitrogen-replete conditions by selection of pale green mutants. Biotechnol. Biofuels 2020, 13, 78. [Google Scholar] [CrossRef]
- Zhuang, X.; Zhang, Y.; Xiao, A.; Zhang, A.; Fang, B. Key enzymes in fatty acid synthesis pathway for bioactive lipids biosynthesis. Front. Nutr. 2022, 9, 851402. [Google Scholar] [CrossRef]
- Shahid, A.; Malik, S.; Zhu, H.; Xu, J.; Nawaz, M.Z.; Nawaz, S.; Alam, A.; Mehmood, M.A. Cultivating microalgae in wastewater for biomass production, pollutant removal, and atmospheric carbon mitigation, a review. Sci. Total Environ. 2020, 704, 135303. [Google Scholar] [CrossRef]
- Nzayisenga, J.C.; Farge, X.; Groll, S.L.; Sellstedt, A. Effects of light intensity on growth and lipid production in microalgae grown in wastewater. Biotechnol. Biofuels 2020, 13, 4. [Google Scholar] [CrossRef] [Green Version]
- Dai, R.; Wang, P.; Jia, P.; Zhang, Y.; Chu, X.; Wang, Y. A review on factors affecting microcystins production by algae in aquatic environments. World J. Microbiol. Biotechnol. 2016, 32, 51. [Google Scholar] [CrossRef] [PubMed]
- Luangpipat, T.; Chisti, Y. Biomass and oil production by Chlorella vulgaris and four other microalgae-effects of salinity and other factors. J. Biotechnol. 2016, 257, 47–57. [Google Scholar] [CrossRef] [PubMed]
- Mata, T.M.; Martins, A.A.; Caetano, N.S. Microalgae for biodiesel production and other applications: A review. Renew. Sustain. Energy Rev. 2010, 14, 217–232. [Google Scholar] [CrossRef] [Green Version]
- Huang, B.; Marchand, J.; Thiriet-Rupert, S.; Carrier, G.; Saint-Jean, B.; Lukomska, E.; Moreau, B.; Morant-Manceau, A.; Bougaran, G.; Mimouni, V. Betaine lipid and neutral lipid production under nitrogen or phosphorus limitation in the marine microalga Tisochrysis lutea (Haptophyta). Algal Res. 2019, 40, 101506. [Google Scholar] [CrossRef]
- Lenton, T.M.; Watson, A.J. Redfield revisited: 1. Regulation of nitrate, phosphate, and oxygen in the ocean. Glob. Biogeochem. Cycles 2000, 14, 225–248. [Google Scholar] [CrossRef]
- Mebane, C.A.; Ray, A.M.; Marcarelli, A.M. Nutrient limitation of algae and macrophytes in streams: Integrating laboratory bioassays, field experiments, and field data. PLoS ONE 2021, 16, e0252904. [Google Scholar]
- Fan, J.; Cui, Y.; Wan, M.; Wang, W.; Li, Y. Lipid accumulation and biosynthesis genes response of the oleaginous Chlorella pyrenoidosa under three nutrition stressors. Biotechnol. Biofuels 2014, 7, 17. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Wen, J.; Chen, W.; Du, H. Physiological effects of nitrogen deficiency and recovery on the macroalga Gracilariopsis lemaneiformis (Rhodophyta). J. Phycol. 2019, 55, 830–839. [Google Scholar] [CrossRef]
- Ördög, V.; Stirk, W.A.; Bálint, P.; van Staden, J.; Lovász, C. Changes in lipid, protein and pigment concentrations in nitrogen-stressed Chlorella minutissima cultures. J. Appl. Phycol. 2012, 24, 907–914. [Google Scholar] [CrossRef]
- Chokshi, K.; Pancha, I.; Ghosh, A.; Mishra, S. Nitrogen starvation-induced cellular crosstalk of ROS-scavenging antioxidants and phytohormone enhanced the biofuel potential of green microalga Acutodesmus dimorphus. Biotechnol. For. Biofuels 2017, 10, 60. [Google Scholar] [CrossRef] [Green Version]
- Millán-Oropeza, A.; Torres-Bustillos, L.G.; Fernández-Linares, L. Simultaneous effect of nitrate (NO3−) concentration, carbon dioxide (CO2) supply and nitrogen limitation on biomass, lipids, carbohydrates and proteins accumulation in Nannochloropsis oculata. Biofuel Res. J. 2015, 2, 215–221. [Google Scholar] [CrossRef]
- Mayers, J.J.; Flynn, K.J.; Shields, R.J. Influence of the N: P supply ratio on biomass productivity and time-resolved changes in elemental and bulk biochemical composition of Nannochloropsis sp. Biores. Technol. 2014, 169, 588–595. [Google Scholar]
- Ikaran, Z.; Suárez-Alvarez, S.; Urreta, I.; Castañón, S. The effect of nitrogen limitation on the physiology and metabolism of Chlorella vulgaris var L3. Algal Res. 2015, 10, 134–144. [Google Scholar] [CrossRef]
- Dorottya, S.; Cazzaniga, W.C.; Steidl, M.; Dechesne, A.; Valverde-Pérez, B.; Plósz, B.G. Optimal influent N-to-P ratio for stable microalgal cultivation in water treatment and nutrient recovery. Chemosphere 2021, 262, 127939. [Google Scholar]
- Li, G.; Zhang, J.; Li, H.; Hu, R.; Yao, X.; Liu, Y.; Zhou, Y.; Lyu, T. Towards high-quality biodiesel production from microalgae using original and anaerobically digested livestock wastewater. Chemosphere 2021, 273, 128578. [Google Scholar] [CrossRef]
- Abugrara, A.M.; El-Sayed, H.S.; Zaki, M.A.; Nour, A.M. Utilization of Nannochloropsis oceanica alga for biodiesel production and the de-lipidated biomass for improving Red tilapia aquaculture. Egypt. J. Aquat. Biol. Fish. 2019, 23, 421–436. [Google Scholar] [CrossRef] [Green Version]
- Guihéneuf, F.; Stengel, D. LC-PUFA-Enriched oil production by microalgae: Accumulation of lipid and triacylglycerols containing n-3 LC-PUFA is triggered by nitrogen limitation and inorganic carbon availability in the marine haptophyte Pavlova lutheri. Mar. Drugs 2013, 11, 4246–4266. [Google Scholar] [CrossRef] [Green Version]
- Shifrin, N.S.; Chisholm, S.W. Phytoplankton lipids: Interspecific differences and effects of nitrate, silicate and light-dark cycles. J. Phycol. 1981, 17, 374–384. [Google Scholar] [CrossRef]
- Lynn, S.G.; Kilham, S.S.; Kreeger, D.A.; Interlandi, S.J. Effect of nutrient availability on the biochemical and elemental stoichiometry in the freshwater diatom Stephanodiscus minutulus (Bacillariophyceae). J. Phycol. 2000, 36, 510–552. [Google Scholar] [CrossRef] [Green Version]
- Darki, B.Z.; Seyfabadi, J.; Fayazi, S. Effect of nutrients on total lipid content and fatty acids profile of Scenedesmus obliquus. Braz. Arch. Biol. Technol. 2017, 60. [Google Scholar]
- Brown, M.R.; Jeffrey, S.W.; Volkman, J.K.; Dunstan, G.A. Nutritional properties of microalgae for mariculture. Aquaculture 1997, 151, 315–331. [Google Scholar] [CrossRef]
- Dou, X.; Lu, X.H.; Lu, M.Z.; Yu, L.S.; Xue, R.; Ji, J.B. The effects of trace elements on the lipid productivity and fatty acid composition of Nannochloropis oculata. J. Renew. Energy 2013, 2013, 671545. [Google Scholar]
- Li, Y.; Han, D.; Hu, G.; Dauvillee, D.; Sommerfeld, M.; Ball, S.; Hu, Q. Chlamydomonas starchless mutant defective in ADP-glucose pyrophosphorylase hyper-accumulates triacylglycerol. Metabol. Eng. 2010, 12, 387–391. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.A.; Magnusson, M.; Brown, R.J.; Ayoko, G.A.; Nabi, M.N.; Heimann, K. Microalgal species selection for biodiesel production based on fuel properties derived from fatty acid profiles. Energies 2013, 6, 5676–5702. [Google Scholar] [CrossRef] [Green Version]
- Knothe, G. Analyzing biodiesel: Standards and other methods. J. Am. Oil Chem. Soc. 2006, 83, 823–833. [Google Scholar] [CrossRef]
- Knothe, G. “Designer” biodiesel: Optimizing fatty ester composition to improve fuel properties. Energy Fuels 2008, 22, 1358–1364. [Google Scholar] [CrossRef]
- Talebi, A.F.; Mohtashami, S.K.; Tabatabaei, M.; Tohidfar, M.; Bagheri Zeinalabedini, M.; Hadavand Mirzaei, H.; Mirzajanzadeh, M.; Shafaroudi, S.M.; Bakhtiari, S. Fatty acids profiling, a selective criterion for screening microalgae strains for biodiesel production. Algal Res. 2013, 2, 258–267. [Google Scholar] [CrossRef]
- Ramos, M.J.; Fernández, C.M.; Casas, A.; Rodríguez, L.; Pérez, A. Influence of fatty acid composition of raw materials on biodiesel properties. Bioresour. Technol. 2009, 100, 261–268. [Google Scholar] [CrossRef]
- Francisco, E.C.; Neves, D.B.; Jacob-Lopes, E.; Franco, T.T. Microalgae as feedstock for biodiesel production: Carbon dioxide sequestration, lipid production and biofuel quality. J. Chem. Technol. Biotechnol. 2010, 85, 395–403. [Google Scholar]
- Gopinath, A.; Puhan, S.; Nagarajan, G. Relating the cetane number of biodiesel fuels to their fatty acid composition: A critical study. J. Automob. Eng. 2009, 223, 565–583. [Google Scholar]
- You, W.; Wei, L.; Gong, Y.; El Hajjami, M.; Xu, J.; Poetsch, A. Integration of proteome and transcriptome refines key molecular processes underlying oil production in Nannochloropsis oceanica. Biotechnol. Biofuels 2020, 13, 109. [Google Scholar] [CrossRef]
- Liang, J.; Wen, F.; Liu, J. Transcriptomic and lipidomic analysis of an EPA-containing Nannochloropsis sp. PJ12 in response to nitrogen deprivation. Sci. Rep. 2019, 9, 4540. [Google Scholar] [CrossRef] [Green Version]
- Zienkiewicz, K.; Zienkiewicz, A.; Poliner, E.; Du, Z.; Vollheyde, K.; Herrfurth, C.; Marmon, S.; Farré, E.M.; Feussner, I.; Benning, C. Nannochloropsis, a rich source of diacylglycerol acyltransferases for engineering of triacylglycerol content in different hosts. Biotechnol. Biofuels 2017, 10, 8. [Google Scholar] [CrossRef] [Green Version]
- Miller, R.; Wu, G.; Deshpande, R.R.; Vieler, A.; Gaertner, K.; Li, X.; Moellering, E.; Zäuner, S.; Cornish, A.; Liu, B.; et al. Changes in transcript abundance in Chlamydomonas reinhardtii following nitrogen deprivation predict diversion of metabolism. Plant Physiol. 2010, 154, 1737–1752. [Google Scholar] [CrossRef] [Green Version]
- Xue, W.B.; Liu, F.; Sun, Z.; Zhou, Z.G. A delta-9 fatty acid desaturase gene in the microalga Myrmecia incisa Reisigl: Cloning and functional analysis. Int. J. Mol. Sci. 2016, 17, 1143. [Google Scholar]
- Barati, B.; Gan, S.Y.; Lim, P.E.; Beardall, J.; Phang, S.M. Green algal molecular responses to temperature stress. Acta Physiol. Plant. 2019, 41, 1–19. [Google Scholar] [CrossRef]
- Gao, B.; Hong, J.; Chen, J.; Zhang, H.; Hu, R.; Zhang, C. The growth, lipid accumulation and adaptation mechanism in response to variation of temperature and nitrogen supply in psychrotrophic filamentous microalga Xanthonema hormidioides (Xanthophyceae). Biotechnol. Biofuels Bioprod. 2023, 16, 1–16. [Google Scholar]
- Zhu, X.; Li, S.; Liu, L.; Li, S.; Luo, Y.; Lv, C.; Wang, B.; Cheng, C.H.K.; Chen, H.; Yang, X. Genome sequencing and analysis of Thraustochytriidae sp. SZU445 provides novel insights into the polyunsaturated fatty acid biosynthesis pathway. Mar. Drugs 2020, 18, 118. [Google Scholar] [CrossRef] [Green Version]
- Meng, Y.; Cao, X.; Yao, C.; Xue, S.; Yang, Q. Identification of the role of polar glycerolipids in lipid metabolism and their acyl attribution for TAG accumulation in Nannochloropsis oceanica. Algal Res. 2017, 24, 122–129. [Google Scholar] [CrossRef]
- Zhang, O.; You, Z.; Miao, X. Variation of fatty acid desaturation in response to different nitrate levels in Auxenochlorella pyrenoidosa. R. Soc. Open Sci. 2018, 5, 181236. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Sun, Z.; Zhong, Y.; Huang, J.; Hu, Q.; Chen, F. Stearoyl-acyl carrier protein desaturase gene from the oleaginous microalga Chlorella zofingiensis: Cloning, characterization and transcriptional analysis. Planta 2012, 236, 1665–1676. [Google Scholar]
- Guillard, R.L.L.; Rhyter, J.H. Studies on marine planktonic diatoms I. Cyclotella nana Hustedt, Detonula confervacea (Cleve) Gran. Can. J. Microbiol. 1962, 8, 229–239. [Google Scholar] [CrossRef] [PubMed]
- Jarošová, M.; Milde, D.; Kuba, M. Elemental analysis of coffee: A comparison of ICP-MS and AAS methods. Czech J. Food Sci. 2014, 32, 354–359. [Google Scholar]
- Abomohra, A.; Wagner, M.; El-Sheekh, M.; Hanelt, D. Lipid and total fatty acid productivity in photoautotrophic freshwater microalgae: Screening studies towards biodiesel production. J. Appl. Phycol. 2013, 25, 931–936. [Google Scholar]
- Lowry, O.H.; Rosebrough, N.J.; Lewis Farr, A.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.T.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Bligh, E.G.; Dyer, W.J. A Rapid Method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef]
- Kaczmarzyk, D.; Fulda, M. Fatty acid activation in cyanobacteria mediated by acyl-acyl carrier protein synthetase enables fatty acid recycling. Plant Physiol. 2010, 152, 1598–1610. [Google Scholar]
- Scharnewski, M.; Pongdontri, P.; Mora, G.; Hoppert, M.; Fulda, M. Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling. FEBS J. 2008, 275, 2765–2778. [Google Scholar]
- Andrade, M.R.; Costa, J.A.V. Mixotrophic cultivation of microalga Spirulina platensis using molasses as organic substrate. Aquaculture 2007, 264, 130–134. [Google Scholar]
- Spackman, D.H.; Stein, E.H.; Moore, S. Chromatography of Amino Acid on Sulphonated Polystyrene Resins. An Improved System. Anal. Chem. 1958, 30, 1191–1194. [Google Scholar]
- Damiani, M.C.; Popovich, C.A.; Constenla, D.; Leonardi, P.I. Lipid analysis in Haematococcus pluvialis to assess its potential use as a biodiesel feedstock. Bioresour. Technol. 2010, 101, 3801–3807. [Google Scholar] [CrossRef] [PubMed]
- Talebi, A.F.; Tabatabae, M.; Chisti, Y. BiodieselAnalyzer: A user-friendly software for predicting the properties of prospective Biodiesel. Biofuel Res. J. 2014, 2, 55–57. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Okada, T.; Furuhashi, N.; Kuromori, Y.; Miyashita, M.; Iwata, F.; Harada, K. Plasma palmitoleic acid content and obesity in children. Am. J. Clin. Nutr. 2005, 82, 747–750. [Google Scholar] [CrossRef] [Green Version]
- Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological Statistics Software Package for Education and Data Analysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
Amino Acids | Control | Y1 | Y2 | Y3 |
---|---|---|---|---|
Essential AA (mg/mL) | ||||
Arginine | 6.74 ± 0.03 | 5.32 ± 0.05 | 5.93 ± 0.05 | 6.14 ± 0.05 |
Histidine | 4.52 ± 0.04 | 2.43 ± 0.04 | 2.9 ± 0.02 | 3.27 ± 0.06 |
Isoleucine | 6.17 ± 0.04 | 4.07 ± 0.04 | 5.67 ± 0.07 | 5.86 ± 0.07 |
Leucine | 7.36 ± 0.08 | 5.93 ± 0.07 | 6.5 ± 0.02 | 6.23 ± 0.04 |
Lysine | 6.78 ± 0.07 | 6.29 ± 0.05 | 9.32 ± 0.03 | 7.76 ± 0.08 |
Methionine | 5.91 ± 0.04 | 3.29 ± 0.04 | 4.3 ± 0.03 | 4.18 ± 0.04 |
Phenylalanine | 5.67 ± 0.07 | 4.19 ± 0.03 | 4.33 ± 0.03 | 5.28 ± 0.06 |
Threonine | 4.83 ± 0.09 | 3.7 ± 0.04 | 3.78 ± 0.03 | 4.89 ± 0.06 |
Tryptophan | 5.82 ± 0.05 | 3.32 ± 0.06 | 2.03 ± 0.06 | 4.75 ± 0.11 |
Valine | 5.27 ± 0.05 | 3.84 ± 0.07 | 5.53 ± 0.09 | 4.72 ± 0.05 |
Total EAA (mg/mL) | 59.07 ± 0.29 a | 42.39 ± 0.21 d | 50.30 ± 0.05 c | 53.07 ± 0.07 b |
Nonessential (mg/mL) | ||||
Alanine | 10.40 ± 0.15 | 4.68 ± 0.05 | 5.45 ± 0.18 | 5.16 ± 0.07 |
Aspartate | 5.62 ± 0.07 | 7.28 ± 0.03 | 6.23 ± 0.12 | 8.18 ± 0.05 |
Cysteine | 4.19 ± 0.03 | 2.8 ± 0.02 | 4.4 ± 0.07 | 3.47 ± 0.04 |
Glutamate | 10.21 ± 0.05 | 8.62 ± 0.06 | 6.62 ± 0.06 | 9.17 ± 0.05 |
Glycine | 5.53 ± 0.06 | 3.61 ± 0.07 | 4.42 ± 0.09 | 4.72 ± 0.06 |
Proline | 9.45 ± 0.08 | 6.36 ± 0.05 | 6.28 ± 0.06 | 7.47 ± 0.14 |
Serine | 4.85 ± 0.08 | 3.83 ± 0.09 | 5.04 ± 0.04 | 4.64 ± 0.05 |
Tyrosine | 2.56 ± 0.05 | 2.26 ± 0.11 | 2.22 ± 0.09 | 2.33 ± 0.07 |
Total NEAA | 52.80 ± 0.26 a | 39.45 ± 0.09 d | 40.66 ± 0.5 c | 45.15 ± 0.22 b |
Total AA | 111.87 ± 0.32 a | 81.84 ± 0.13 d | 90.96 ± 0.5 c | 98.22 ± 0.24 b |
Fatty Acid | C | Y1 | Y2 | Y3 |
---|---|---|---|---|
C14:0 | 1.99 c ± 0.094 | 2.14 c ± 0.055 | 2.92 a ± 0.052 | 2.40 b ± 0.116 |
C15:0 | 0.71 b ± 0.068 | 0.79 ab ± 0.047 | 0.86 a ± 0.004 | 0.82 a ± 0.013 |
C16:0 | 31.81 b ± 0.156 | 31.58 b ± 0.039 | 33.92 a ± 0.04 | 31.19 b ± 0.165 |
C17:0 | 0.40 b ± 0.022 | 0.58 a ± 0.011 | 0.62 a ± 0.018 | 0.63 a ± 0.071 |
C18:0 | 4.78 b ± 0.048 | 4.43 c ± 0.107 | 5.72 a ± 0.11 | 4.77 b ± 0.017 |
C21:0 | 0.90 b ± 0.007 | 1.47 a ± 0.123 | 1.53 a ± 0.060 | 1.50 a ± 0.038 |
C24:0 | 1.86 a ± 0.100 | 1.63 b ± 0.007 | 1.83 a ± 0.053 | 1.84 a ± 0.049 |
% of TSFA | 42.45 b ± 0.378 | 42.62 b ± 0.118 | 47.42 a ± 0.12 | 43.15 b ± 0.212 |
C14:1 | 0.18 a ± 0.009 | 0.17 ab ± 0.005 | 0.14 c ± 0.006 | 0.16 bc ± 0.010 |
C15:1 | 0.10 a ± 0.007 | 0.08 b ± 0.009 | 0.07 c ± 0.003 | 0.08 b ± 0.002 |
C16:1 | 13.43 b ± 0.095 | 13.26 b ± 0.117 | 20.47 a ± 0.12 | 13.97 b ± 0.101 |
C17:1 | 0.61 a ± 0.087 | 0.51 b ± 0.070 | 0.59 a ± 0.041 | 0.53 b ± 0.055 |
C18:1n9 | 3.13 c ± 0.106 | 4.26 b ± 0.073 | 9.14 a ± 0.10 | 5.18 b ± 0.047 |
C20:1 | 2.81 a ± 0.151 | 1.58 c ± 0.068 | 1.78 b ± 0.042 | 1.57 c ± 0.053 |
C22:1 | 0.72 a ± 0.068 | 0.57 b ± 0.068 | 0.78 a ± 0.050 | 0.78 a ± 0.064 |
% of TMUFA | 20.99 c ± 0.248 | 20.44 d ± 0.070 | 32.98 a ± 0.10 | 22.27 b ± 0.184 |
C18:2n6 | 13.52 a ± 0.028 | 13.50 a ± 0.134 | 11.95 b ± 0.033 | 11.61 c ± 0.023 |
C20:2n6 | 1.01 a ± 0.016 | 0.61 c ± 0.031 | 0.69 b ± 0.034 | 0.66 b ± 0.006 |
C18:3n6 | 0.28 a ± 0.022 | 0.14 c ± 0.066 | 0.23 ab ± 0.014 | 0.19 bc ± 0.013 |
C18:3n3 | 1.73 a ± 0.089 | 1.46 b ± 0.049 | 1.86 a ± 0.126 | 1.83 a ± 0.087 |
C20:5n-3 | 17.85 b ± 0.148 | 18.46 a ± 0.035 | 3.53 c ± 0.04 | 17.99 b ± 0.013 |
C22:6n-3 | 2.17 b ± 0.154 | 2.76 a ± 0.066 | 1.29 c ± 0.10 | 2.30 b ± 0.110 |
% of TPUFA | 36.56 b ± 0.197 | 36.93 a ± 0.071 | 19.60 c ± 0.10 | 34.58 b ± 0.042 |
Total TUSFA | 57.54 a ± 0.378 | 57.38 a ± 0.118 | 52.57 b ± 0.12 | 56.85 a ± 0.212 |
Δ9FAD (16 + 18) | 31.15 d ± 0.305 | 32.74 c ± 0.179 | 42.76 a ± 0.180 | 34.75 b ± 0.290 |
Properties | Control | Y1 | Y2 | Y3 | Accepted Range | Standard Ref. |
---|---|---|---|---|---|---|
CNmin | 66.27 | 66.12 | 59.94 | 66.65 | 47 | ASTM D6751-02 |
IVmax | 58.58 | 59.99 | 63.48 | 57.12 | 120 | EN 14214 |
CPmin | 11.74 | 11.62 | 12.89 | 11.41 | −3.12 | ASTM D-6751 |
PP | 5.92 | 5.79 | 7.17 | 5.57 | −15:10 | ASTM D-6751 |
υmm2/s | 2.79 | 2.76 | 3.35 | 2.78 | 1.9:6 | ASTM D6751-02 |
OSmin | 10.18 | 10.40 | 10.99 | 11.24 | 3 | ASTM D-6751 |
Mineral Constituents | g/L | Mineral Constituents | g/L |
---|---|---|---|
Ca(NO3)2 | 0.03 | MnSO4 | 0.50 |
CaCl2 | 0.03 | Na2EDTA | 2.40 |
CoCl2 | 4.70 | Na2MoO4 | 1.48 |
CuSO4 | 9.80 | NaH2PO4 | 3.66 |
FeCl3 | 1.77 | NaNO3 | 36.60 |
KNO3 | 0.03 | NiCl2 | 1.49 |
MgSO4 | 0.04 | ZnCl2 | 1.50 |
MnCl2 | 9.10 | ZnSO4 | 0.10 |
Gene Name | Gene Accession Number | 5′ Forward Primer 3′ | 5′ Reverse Primer 3′ |
---|---|---|---|
Actin | XM_005852283 | ATGGTGGGGATGGACCAGAA | CTCCGTGAGAAGAACGGGAT |
Diacylglycerol acyltransferase DGAT2G | >KX867962.1 | CGAGGCTTCCCTTGAGCAAT | AGGCATTCAAAACGACTGCTG |
Delta 9 desaturase | >KY214449.1 | TTCTGGAACGCCTTTTGGGT | CCTTCTCCGATCGCCACTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Senousy, H.H.; El-Sheekh, M.M.; Khairy, H.M.; El-Sayed, H.S.; Mahmoud, G.A.-E.; Hamed, A.A. Biodiesel Production from the Marine Alga Nannochloropsis oceanica Grown on Yeast Wastewater and the Effect on Its Biochemical Composition and Gene Expression. Plants 2023, 12, 2898. https://doi.org/10.3390/plants12162898
Senousy HH, El-Sheekh MM, Khairy HM, El-Sayed HS, Mahmoud GA-E, Hamed AA. Biodiesel Production from the Marine Alga Nannochloropsis oceanica Grown on Yeast Wastewater and the Effect on Its Biochemical Composition and Gene Expression. Plants. 2023; 12(16):2898. https://doi.org/10.3390/plants12162898
Chicago/Turabian StyleSenousy, Hoda H., Mostafa M. El-Sheekh, Hanan M. Khairy, Heba S. El-Sayed, Ghada Abd-Elmonsef Mahmoud, and Amal A. Hamed. 2023. "Biodiesel Production from the Marine Alga Nannochloropsis oceanica Grown on Yeast Wastewater and the Effect on Its Biochemical Composition and Gene Expression" Plants 12, no. 16: 2898. https://doi.org/10.3390/plants12162898