Flavonoid Biosynthesis Pathway May Indirectly Affect Outcrossing Rate of Cytoplasmic Male–Sterile Lines of Soybean
Abstract
:1. Introduction
2. Results
2.1. Transcriptomic Analysis between HL and LL
2.1.1. High–Throughput Sequencing Results
2.1.2. Screening for DEGs in the HL vs. LL
2.1.3. KEGG and GO Enrichment Analyses
2.2. Metabolomic Analysis between HL and LL
2.3. Combined Analysis of the Transcriptomes and Phenol Metabolomes
2.4. Verification of Key DEGs with qRT–PCR
2.5. Compared CDS Regions between HL and LL
2.6. Development of Molecular Markers
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. RNA–seq Analysis
4.2.1. RNA Extraction and Library Construction
4.2.2. Quality Control and Functional Annotation
4.2.3. Functional Annotation of Differentially Expressed Genes (DEGs)
4.3. Targeted Phenol Metabolomic Analysis
4.3.1. Chemicals
4.3.2. Flavonoid Polyphenol Extraction
4.3.3. LC–MS Analysis
4.3.4. Qualitative and Quantitative Analyses
4.4. Combined Analysis of the Soybean Flower Bud Transcriptome and Metabolome
- (1)
- Criteria for screening significant DEGs: |log2(fold–change)| > 1.5 or ˂ 0.67 and p ˂ 0.05.
- (2)
- Criteria for screening significant differentially abundant target metabolites: VIP > 1, |log2(fold–change)| > 1.2 or < 0.833, and p < 0.05.
- (3)
- The venny2.1.0 online software (https://bioinfogp.cnb.csic.es/tools/venny/) (accessed on 13 August 2021) was used to analyze the common significantly different metabolic pathways identified on the basis of the flower bud transcriptome and floral metabolome.
- (4)
- The KEGG enrichment results for the transcriptome and metabolome were compared to detect common pathways. The gene IDs and metabolites associated with the enriched KEGG pathways were compared with the significant DEGs and differentially abundant metabolites. Finally, the significant DEGs and differentially abundant metabolites were confirmed.
4.5. Analysis of DEG Expression with qRT–PCR
4.6. Gene Cloning
4.7. Molecular Marker Development
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
CMS | Cytoplasmic male sterility |
qRT−PCR | Quantitative reverse transcription PCR |
SNP | Single nucleotide polymorphism |
DEG | Different expression gene |
FLS | Flavonol synthase |
SUS | Sucrose synthase |
UGT | UDP−glucosyl transferase |
F3H | Flavanone 3−hydroxylase |
DFR | Bifunctional dihydroflavonol 4−reductase |
HCT | O−hydroxycinnamoyltransferase |
ANS | Leucoanthocyanidin dioxygenase |
CHS | Chalcone synthase |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
References
- Fenta, B.A.; Beebe, S.E.; Kunert, K.J.; Burridge, J.D.; Barlow, K.M.; Lynch, J.P.; Foyer, C.H. Field phenotyping of soybean roots for drought stress tolerance. Agronomy 2014, 4, 418–435. [Google Scholar] [CrossRef]
- Davis, W.H. Route to Hybrid Soybean Production. U.S. Patent US 4545146, 8 October 1985. [Google Scholar]
- Sun, H.; Zhao, L.; Huang, M. Studies on cytoplasmic–nuclear male sterile soybean. Chin. Sci. Bull. 1994, 39, 175–176. [Google Scholar]
- Zhang, L.; Dai, O.; Huang, Z.; Li, J. Selection of soybean male sterile line of nucleo–cytoplasmic interaction and its fertility. Sci. Agric. Sin. 1999, 32, 34–38. [Google Scholar]
- Zhao, L.; Sun, H.; Wang, S.; Wang, Y.; Hang, M.; Li, J. Breeding of hybrid soybean HybSoy1. Chin. J. Oil Crop Sci. 2004, 26, 15–17. [Google Scholar]
- Fang, X.; Sun, Y.; Li, J.; Li, M.; Zhang, C. Male sterility and hybrid breeding in soybean. Mol. Breed. 2023, 43, 47. [Google Scholar] [CrossRef] [PubMed]
- Ortiz–Perez, E.; Wiley, H.; Horner, H.T.; Davis, W.H.; Palmer, R.G. Insect–mediated cross–pollination in soybean [Glycine max (L.) Merrill]: II. Phenotypic recurrent selection. Euphytica 2008, 162, 269–280. [Google Scholar] [CrossRef]
- Delaplane, K.S.; Mayer, D.F. Benefits of bee pollination. In Crop Pollination by Bees; CABI International: Wallingford, UK, 2000; pp. 1–7. ISBN 978−0−85199−783−4344. [Google Scholar]
- Margarita, M.L.-U. Crop Pollination by Bees, Volume 1: Evolution, Ecology, Conservation, and Management, American Entomologist. Am. Entomol. 2022, 68, 61–62. [Google Scholar]
- Li, J.; Zhao, J.; Li, Y.; Gao, Y.; Hua, S.; Nadeem, M.; Sun, G.; Zhang, W.; Hou, J.; Wang, X.; et al. Identification of a novel seed size associated locus SW9–1 in soybean. Crop J. 2019, 7, 548–559. [Google Scholar] [CrossRef]
- Weber, C.R.; Empig, L.T.; Thorne, J.C. Heterotic performance and combining ability of two–way F1 Soybean Hybrids. Crop Sci. 1970, 10, 159–160. [Google Scholar] [CrossRef]
- Dai, J.; Zhang, R.; Wei, B.; Nie, Z.; Xing, G.; Zhao, T.; Yang, S.; Gai, J. Key biological factors related to outcrossing–productivity of cytoplasmic–nuclear male–sterile lines in soybean [Glycine max (L.) Merr.]. Euphytica 2017, 213, 266. [Google Scholar] [CrossRef]
- Wang, S.; Wang, Y.; Li, J.; Li, M.; Sun, H.; Zhao, L.; Zhang, B. Insect–mediated cross–pollination in soybean CMS lines under artificial conditions. Crops 2010, 3, 113–117. [Google Scholar]
- De Luna, S.L.; Ramírez–Garza, R.E.; Saldívar, S.O.S. Environmentally friendly methods for flavonoid extraction from plant material: Impact of their operating conditions on yield and antioxidant properties. Sci. World J. 2020, 2020, 6792069. [Google Scholar]
- Dias, M.C.; Pinto, D.; Silva, A.M.S. Plant flavonoids: Chemical characteristics and biological activity. Molecules 2021, 26, 5377. [Google Scholar] [CrossRef]
- Ding, X.; Guo, J.; Lv, M.; Wang, H.; Sheng, Y.; Liu, Y.; Gai, J.; Yang, S. The miR156b–GmSPL2b module mediates male fertility regulation of cytoplasmic male sterility–based restorer line under high–temperature stress in soybean. Plant Biotechnol. J. 2023, 21, 1542–1559. [Google Scholar] [CrossRef]
- Wang, H.; Liu, S.; Wang, T.; Liu, H.; Xu, X.; Chen, K.; Zhang, P. The moss flavone synthase I positively regulates the tolerance of plants to drought stress and UV–B radiation. Plant Sci. 2020, 298, 110591. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, H.; Moser, M.; Klahre, U.; Esfeld, K.; Dellolivo, A.; Mandel, T.; Metzger, S.; Vandenbussche, M.; Freitas, L.; Kuhlemeier, C. MYB–FL controls gain and loss of floral UV absorbance, a key trait affecting pollinator preference and reproductive isolation. Nat. Genet. 2016, 48, 159–166. [Google Scholar] [CrossRef]
- Yuan, Y.; Rebocho, A.B.; Sagawa, J.M.; Stanley, L.E.; Bradshaw, H.D. Competition between anthocyanin and flavonol biosynthesis produces spatial pattern variation of floral pigments between Mimulus species. Proc. Natl. Acad. Sci. USA 2016, 113, 2448–2453. [Google Scholar] [CrossRef]
- Dyer, A.G.; Jentsch, A.; Burd, M.; Garcia, J.E.; Giejsztowt, J.; Camargo, M.G.G.; Tjørve, E.; Tjørve, K.M.C.; White, P.; Shrestha, M. Fragmentary blue: Resolving the rarity paradox in flower colors. Front. Plant Sci. 2021, 11, 618203. [Google Scholar] [CrossRef]
- Dudek, B.; Schneider, B.; Hilger, H.H.; Stavenga, D.G.; Martinez–Harms, J. Highly different flavonol content explains geographic variations in the UV reflecting properties of flowers of the corn poppy, Papaver rhoeas(Papaveraceae). Phytochemistry 2020, 178, 112457. [Google Scholar] [CrossRef]
- Schiestl, F.P. The evolution of floral scent and insect chemical communication. Ecol. Lett. 2010, 13, 643–656. [Google Scholar] [CrossRef]
- Zuker, A.; Tzfira, T.; Ben–Meir, H.; Ovadis, M.; Shklarman, E.; Itzhaki, H.; Forkmann, G.; Martens, S.; Neta–Sharir, I.; Weiss, D.; et al. Modification of flower color and fragrance by antisense suppression of the flavanone 3–hydroxylase gene. Mol. Breed. 2002, 9, 3–41. [Google Scholar] [CrossRef]
- Chen, W.; Yao, J.; Li, Y.; Zhu, S.; Guo, Y.; Fang, S.; Zhao, L.; Wang, J.; Yuan, L.; Lu, Y.; et al. Open–bud duplicate loci are identified as MML10s, orthologs of MIXTA–Like genes on homologous chromosomes of allotetraploid cotton. Front Plant Sci. 2020, 11, 81. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Gou, Y.; Heng, Y.; Ding, W.; Li, Y.; Zhou, D.; Li, X.; Liang, C.; Wu, C.; Wang, H.; et al. Targeted manipulation of grain shape genes effectively improves outcrossing rate and hybrid seed production in rice. Plant Biotechnol. J. 2023, 21, 381–390. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Zhang, J.; Zhang, C.; Peng, B.; Zhang, W.; Wang, P.; Ding, X.; Liu, B.; Feng, X.; Zhao, L. Genetic effects and plant architecture influences on outcrossing rate in soybean. J. Integr. Agric. 2019, 18, 1971–1979. [Google Scholar] [CrossRef]
- Li, R.; Lin, C.; Peng, B.; Ding, X.; Li, Y.; Zhao, G.; Zhao, L.; Zhang, C. Transcriptomic analysis of soybean cytoplasmic male sterile lines with different outcrossing rate. Chin. J. Oil Crop. Sci. 2019, 41, 696–704. [Google Scholar]
- Zhao, L.; Sun, H.; Wang, S.; Wang, Y.; Peng, B.; Cheng, Y.; Huan, M. The soybean pollen flow in nature. Soybean Sci. 2006, 25, 84–86. [Google Scholar]
- Yu, W.; Li, L.; Li, Z.; Xu, Z.; Chang, R.; Qiu, L.; Wang, M.; Wang, M.; Ma, T. Studies on hybridseed production of cytoplasmic male sterile lines in soybean I. Seed production of male sterile lines. Chin. J. Oil Crop. Sci. 2001, 23, 11–13. [Google Scholar]
- Robacker, D.C.; Erickson, E.H. A bioassay for comparing attractiveness of plants to honeybees. J. Apic. Res. 1984, 23, 199–203. [Google Scholar] [CrossRef]
- Arnold, S.E.; Dudenhöffer, J.; Fountain, M.T.; James, K.L.; Hall, D.; Farman, D.I.; Wäckers, F.L.; Stevenson, P.C. Bumble bees show an induced preference for flowers when primed with caffeinated nectar and a target floral odor. Curr. Biol. 2021, 31, 4127–4131.e4. [Google Scholar] [CrossRef]
- Cokus, S.J.; Feng, S.; Zhang, X.; Chen, Z.; Merriman, B.; Haudenschild, C.D.; Pradhan, S.; Nelson, S.F.; Pellegrini, M.; Jacobsen, S.E. Shotgun bisulphite sequencing of the Arabidopsis genome reveals DNA methylation patterning. Nature 2008, 452, 215–219. [Google Scholar] [CrossRef]
- Dai, M.; Kang, X.; Wang, Y.; Huang, S.; Guo, Y.; Wang, R.; Chao, N.; Liu, L. Functional Characterization of Flavanone 3–Hydroxylase (F3H) and its role in anthocyanin and flavonoid biosynthesis in mulberry. Molecules 2022, 27, 3341. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Sun, H.; Zhao, L.; Zhang, C.; Yan, H.; Peng, B.; Li, W. Nectar secretion of RN–type cytoplasmic male sterility three lines in soybean [Glycine max (L.) Merr.]. J. Integr. Agric. 2018, 17, 1085–1092. [Google Scholar] [CrossRef]
- Zhang, J. Analysis of the Traits Associated with Outcrossing and Method for Identifying Outcrossing Rate in Cytoplasmic Male Sterile Soybean. Ph.D. Thesis, Northeast Agriculture University, Harbin, China, 2018. [Google Scholar]
- Kingston, R.E.; Chomczynski, P.; Sacchi, N. Guanidine methods for total RNA preparation. Curr. Protoc. Mol. Biol. 2001, 36, 4.2.1–4.2.9. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Baren, M.J.V.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA–seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Haynes, W. Benjamini–Hochberg Method. In Encyclopedia of Systems Biology, 1st ed.; Dubitzky, W., Wolkenhauer, O., Cho, K.H., Yokota, H., Eds.; Springer: New York, NY, USA, 2013; p. 78. [Google Scholar]
- Trapnell, C.; Roberts, A.; Goff, L.; Pertea, G.; Kim, D.; Kelley, D.R.; Pimentel, H.; Salzberg, S.L.; Rinn, J.L.; Pachter, L. Differential gene and transcriptexpression analysis of RNA–seq experiments with TopHat and Cufflinks. Nat. Protoc. 2012, 7, 562–578. [Google Scholar] [CrossRef] [PubMed]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA–SEQ: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA–seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real–time quantitative PCR and the 2(–Delta Delta C (T) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Kidwell, K.K.; Osborn, T.C. Simple plant DNA isolation procedures. In Plant Genomes: Methods for Genetic and Physical Mapping, 1st ed.; Beckmann, J.S., Osborn, T.C., Eds.; Springer: Dordrecht, The Netherlands, 1992; Volume 85, pp. 1–13. [Google Scholar]
Samples | Raw Reads | Clean Reads | Clean Base (G) | Q30 | GC | Total Map Reads | Total Map Rate |
---|---|---|---|---|---|---|---|
(%) | (%) | (%) | |||||
LL–1 | 49,522,714 | 49,284,716 | 7.39 | 94.57 | 45.00 | 45,185,981 | 91.68 |
LL–2 | 50,578,378 | 50,327,018 | 7.55 | 94.71 | 44.63 | 47,697,562 | 94.78 |
LL–3 | 57,316,408 | 57,061,498 | 8.56 | 94.15 | 44.54 | 54,336,757 | 95.22 |
HL–1 | 51,070,112 | 50,849,114 | 7.63 | 95.04 | 45.15 | 42,589,746 | 83.76 |
HL–2 | 58,457,102 | 58,255,318 | 8.74 | 94.12 | 44.31 | 54,765,807 | 94.01 |
HL–3 | 55,662,622 | 55,402,332 | 8.31 | 94.53 | 44.68 | 50,317,913 | 90.82 |
SNP Location | Base to Base | HL | LL | Amino Acid |
---|---|---|---|---|
(HL to LL) | (HL to LL) | |||
502 bp | G–C | G | C | Gly–Gly |
510 bp | G–T | G | G&T | Trp–Leu&Trp |
512 bp | G–C | G | C | Glu–Gln |
611 bp | C–T | C | T | Pro–Ser |
665 bp | G–T | G | T | Gly–Trp |
899 bp | G–A | G | A | Asp–Asn |
1004 bp | C–T | C | T | Gys–Arg |
Name | Primer (5′–3′) | Enzyme | Product (bp) |
---|---|---|---|
Forward (F) | LL/HL | ||
Reverse (R) | |||
SNP1 | ACAGCGACAAAGTAATGGGTCAAGC(F) | HindIII | 302, 279,23/302 |
TCTCCAAGATTGACGACGAAGG(R) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, C.; Duan, Y.; Li, R.; Wang, P.; Sun, Y.; Ding, X.; Zhang, J.; Yan, H.; Zhang, W.; Peng, B.; et al. Flavonoid Biosynthesis Pathway May Indirectly Affect Outcrossing Rate of Cytoplasmic Male–Sterile Lines of Soybean. Plants 2023, 12, 3461. https://doi.org/10.3390/plants12193461
Lin C, Duan Y, Li R, Wang P, Sun Y, Ding X, Zhang J, Yan H, Zhang W, Peng B, et al. Flavonoid Biosynthesis Pathway May Indirectly Affect Outcrossing Rate of Cytoplasmic Male–Sterile Lines of Soybean. Plants. 2023; 12(19):3461. https://doi.org/10.3390/plants12193461
Chicago/Turabian StyleLin, Chunjing, Yuetong Duan, Rong Li, Pengnian Wang, Yanyan Sun, Xiaoyang Ding, Jingyong Zhang, Hao Yan, Wei Zhang, Bao Peng, and et al. 2023. "Flavonoid Biosynthesis Pathway May Indirectly Affect Outcrossing Rate of Cytoplasmic Male–Sterile Lines of Soybean" Plants 12, no. 19: 3461. https://doi.org/10.3390/plants12193461