Phenotypic and Genotypic Characterization of Newly Isolated Xanthomonas euvesicatoria-Specific Bacteriophages and Evaluation of Their Biocontrol Potential
Abstract
:1. Introduction
2. Results
2.1. Bacteriophage Isolation and Host Range Determination
2.2. Characterization of Newly Isolated Bacteriophages
2.2.1. Determination of Plaque and Virion Morphology
2.2.2. Genome Organization of Phage Isolate BsXeu269p/3
2.3. Determination of Phage Survival at 4 °C and −20 °C
2.4. Determination of Phage Interactions in Soil
2.4.1. Influence of pH on Phage Viability
2.4.2. Measuring the Phage Survival in Soil Samples
2.4.3. Influence of BsXeu269p/3 on Beneficial Rhizosphere Microorganisms
3. Discussion
4. Materials and Methods
4.1. Phytopathogenic Bacteria
4.2. Soil Sample and Bacteriophage Isolation
4.3. Phage Purification and Host Range Determination
4.4. Characterization of Bacteriophages
4.4.1. Determination of Phage Plaque Morphology
4.4.2. Determination of Virion Morphology
4.4.3. Sequencing and Bioinformatic Analyses of the Genome of Phage BsXeu269p/3
4.5. Determination of Phage Survival at Different Storage Temperatures
4.6. Determination of Phage Interactions in Soil
4.6.1. Determination of the Influence of pH on Phage Viability
4.6.2. Measuring the Phage Survival in Soil Samples without Specific Host
4.6.3. Influence of Selected Phage Isolate on Beneficial Rhizosphere Microorganisms
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- An, S.Q.; Potnis, N.; Dow, M.; Vorhölter, F.J.; He, Y.Q.; Becker, A.; Teper, D.; Li, Y.; Wang, N.; Bleris, L.; et al. Mechanistic insights into host adaptation, virulence and epidemiology of the phytopathogen Xanthomonas. FEMS Microbiol. Rev. 2020, 44, 1–32. [Google Scholar] [CrossRef] [Green Version]
- Osdaghi, E.; Jones, J.B.; Sharma, A.; Goss, E.M.; Abrahamian, P.; Newberry, E.A.; Potnis, N.; Carvalho, R.; Choudhary, M.; Paret, M.; et al. A centenary for bacterial spot of tomato and pepper. Mol. Plant Pathol. 2021, 22, 1500–1519. [Google Scholar] [CrossRef] [PubMed]
- Morinière, L.; Burlet, A.; Rosenthal, E.R.; Nesme, X.; Portier, P.; Bull, C.T.; Lavire, C.; Fischer-Le Saux, M.; Bertolla, F. Clarifying the taxonomy of the causal agent of bacterial leaf spot of lettuce through a polyphasic approach reveals that Xanthomonas cynarae Trébaol et al. 2000 emend. Timilsina et al. 2019 is a later heterotypic synonym of Xanthomonas hortorum Vauterin et al. 1995. Syst. Appl. Microbiol. 2020, 43, 126087. [Google Scholar] [CrossRef] [PubMed]
- Kizheva, Y.; Vancheva, T.; Hristova, P.; Stoyanova, M.; Stojanovska, M.; Moncheva, P.; Bogatzevska, N. Identification of Xanthomonas strains from tomato and pepper and their sensitivity to antibiotics and copper. Bulg. J. Agric. Sci. 2013, 19, 80–82. [Google Scholar]
- Stoyanova, M.; Vancheva, T.; Moncheva, P.; Bogatzevska, N. Differentiation of Xanthomonas spp. Causing Bacterial Spot in Bulgaria Based on Biolog System. Int. J. Microbiol. 2014, 2014, 495476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kizheva, Y.; Urshev, Z.; Rasheva, I.; Vancheva, T.; Hristova, P.; Bogatzevska, N.; Moncheva, P. PFGE: A tool for examination of heterogeneity between the bacterial spot-causing xanthomonads of tomato plants in Bulgaria. Z. Naturforsch. C 2018, 73, 257–003264. [Google Scholar] [CrossRef]
- Kizheva, Y.; Vancheva-Ebben, T.; Hristova, P.; Bogatzevska, N.; Moncheva, P. First report of Xanthomonas euvesicatoria on tomato in Bulgaria. C. R. L’acad. Bulg. Sci. 2020, 73, 140–146. [Google Scholar]
- Bogatzevska, N.; Vancheva-Ebben, T.; Vasileva, K.; Kizheva, Y.; Moncheva, P. An overview of the diversity of pathogens causing bacterial spot on tomato and pepper in Bulgaria. Bulg. J. Agric. Sci. 2021, 27, 137–146. [Google Scholar]
- Vancheva, T.; Bogatzevska, N.; Moncheva, P.; Mitrev, S.; Vernière, C.; Koebnik, R. Molecular epidemiology of Xanthomonas euvesicatoria strains from the Balkan peninsula revealed by a new multiple-locus variable-number tandem-repeat analysis scheme. Microorganisms 2021, 9, 536. [Google Scholar] [CrossRef] [PubMed]
- La Torre, A.; Iovino, V.; Caradonia, F. Copper in plant protection. Phytopathol. Mediterr. 2018, 57, 201–236. [Google Scholar] [CrossRef]
- Ignjatov, M.; Gasic, K.; Ivanovic, M.; Sevic, M.; Obradovic, A.; Milosevic, M. Characterization of Xanthomonas euvesicatoria strains pathogens of pepper in Serbia. Pestic. Fitomed. 2010, 25, 139–149. [Google Scholar] [CrossRef]
- Commission Implementing Regulation (EU) 2015/408—of 11 March 2015—on implementing Article 80(7) of Regulation (EC) No 1107/ 2009 of the European Parliament and of the Council concerning the placing of plant protection products on the market and establishing a list of candidates for substitution. Off. J. Eur. Union 2015, 67, 18–22.
- Buttimer, C.; McAuliffe, O.; Ross, R.P.; Hill, C.; O’Mahony, J.; Coffey, A. Bacteriophages and bacterial plant diseases. Front. Microbiol. 2017, 8, 34. [Google Scholar] [CrossRef] [Green Version]
- Czajkowski, R.; Ozymko, Z.; De Jager, V.; Siwinska, J.; Smolarska, A.; Ossowicki, A.; Narajczyk, M.; Lojkowska, E. Genomic, proteomic and morphological characterization of two novel broad host lytic bacteriophages ΦPD10.3 and ΦPD23.1 infecting pectinolytic Pectobacterium spp. and Dickeya spp. PLoS ONE 2015, 10, e0119812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamada, T.; Kawasaki, T.; Nagata, S.; Fujiwara, A.; Usami, S.; Fujie, M. New bacteriophages that infect the phytopathogen Ralstonia solanacearum. Microbiology 2007, 153, 2630–2639. [Google Scholar] [CrossRef] [Green Version]
- Das, M.; Bhowmick, T.S.; Ahern, S.J.; Young, R.; Gonzalez, C.F. Control of Pierce’s Disease by phage. PLoS ONE 2015, 10, e0128902. [Google Scholar] [CrossRef] [Green Version]
- Lang, J.M.; Gent, D.H.; Schwartz, H.F. Management of Xanthomonas leaf blight of onion with bacteriophages and a plant activator. Plant Dis. 2007, 91, 871–878. [Google Scholar] [CrossRef] [Green Version]
- Lim, J.A.; Jee, S.; Lee, D.H.; Roh, E.; Jung, K.; Oh, C.; Heu, S. Biocontrol of Pectobacterium carotovorum subsp. carotovorum using bacteriophage PP1. J. Microbiol. Biotechnol. 2013, 23, 1147–1153. [Google Scholar] [CrossRef] [Green Version]
- Rombouts, S.; Volckaert, A.; Venneman, S.; Declercq, B.; Vandenheuvel, D.; Allonsius, C.N.; Malderghem, C.V.; Jang, H.B.; Briers, Y.; Noben, J.P.; et al. Characterization of novel bacteriophages for biocontrol of bacterial blight in leek caused by Pseudomonas syringae pv. porri. Front. Microbiol. 2016, 7, 279. [Google Scholar] [CrossRef] [Green Version]
- Kolozsváriné Nagy, J.; Schwarczinger, I.; Künstler, A.; Pogány, M.; Király, L. Penetration and translocation of Erwinia amylovora-specific bacteriophages in apple—A possibility of enhanced control of fire blight. Eur. J. Plant Pathol. 2015, 142, 815–827. [Google Scholar] [CrossRef]
- Nakayinga, R.; Makumi, A.; Tumuhaise, V.; Tinzaara, W. Xanthomonas bacteriophages: A review of their biology and biocontrol applications in agriculture. BMC Microbiol. 2021, 21, 291. [Google Scholar] [CrossRef]
- Flaherty, J.E.; Somodi, G.C.; Jones, J.B.; Harbaugh, B.K.; Jackson, L.E. Control of Bacterial Spot on Tomato in the Greenhouse and Field with H-mutant Bacteriophages. HortScience 2000, 35, 882–884. [Google Scholar] [CrossRef]
- Jones, J.B.; Jackson, L.E.; Balogh, B.; Obradovic, A.; Iriarte, F.B.; Momol, M.T. Bacteriophages for Plant Disease Control. Annu. Rev. Phytopathol. 2007, 45, 245–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balogh, B.; Jones, J.B.; Momol, M.T.; Olson, S.M.; Obradovic, A.; King, P.; Jackson, L. Improved Efficacy of Newly Formulated Bacteriophages for Management of Bacterial Spot on Tomato. Plant Dis. 2003, 87, 949–954. [Google Scholar] [CrossRef] [Green Version]
- Gašić, K.; Ivanović, M.M.; Ignjatov, M.; Calić, A.; Obradović, A. Isolation and characterization of Xanthomonas euvesicatoria bacteriophages. J. Plant Pathol. 2011, 93, 415–423. [Google Scholar]
- Gašić, K.; Kuzmanović, N.; Ivanović, M.; Prokić, A.; Šević, M.; Obradović, A. Complete genome of the Xanthomonas euvesicatoria specific bacteriophage KΦ1, its survival and potential in control of pepper bacterial spot. Front. Microbiol. 2018, 9, 2021. [Google Scholar] [CrossRef]
- Solís-Sánchez, G.A.; Quiñones-Aguilar, E.E.; Fraire-Velázquez, S.; Vega-Arreguín, J.; Rincón-Enríquez, G. Complete Genome Sequence of XaF13, a Novel Bacteriophage of Xanthomonas vesicatoria from Mexico. Microbiol. Resour. Announc. 2020, 9, e01371-19. [Google Scholar] [CrossRef] [Green Version]
- Ríos-Sandoval, M.; Quiñones-Aguilar, E.E.; Solís-Sánchez, G.A.; Enríquez-Vara, J.N.; Rincón-Enríquez, G. Complete Genome Sequence of Xanthomonas vesicatoria Bacteriophage ΦXaF18, a Contribution to the Biocontrol of Bacterial Spot of Pepper in Mexico. Microbiol. Resour. Announc. 2020, 9, e00213-20. [Google Scholar] [CrossRef] [Green Version]
- Kizheva, Y.; Eftimova, M.; Rangelov, R.; Micheva, N.; Urshev, Z.; Rasheva, I.; Hristova, P. Broad host range bacteriophages found in rhizosphere soil of a healthy tomato plant in Bulgaria. Heliyon 2021, 7, e07084. [Google Scholar] [CrossRef] [PubMed]
- Balogh, B.; Nga, N.T.T.; Jones, J.B. Relative Level of Bacteriophage Multiplication in vitro or in Phyllosphere May Not Predict in planta Efficacy for Controlling Bacterial Leaf Spot on Tomato Caused by Xanthomonas perforans. Front. Microbiol. 2018, 9, 2176. [Google Scholar] [CrossRef] [Green Version]
- Chae, J.-C.; Hung, N.B.; Yu, S.-M.; Lee, H.K.; Lee, Y.H. Diversity of Bacteriophages Infecting Xanthomonas oryzae pv. oryzae in Paddy Fields and Its Potential to Control Bacterial Leaf Blight of Rice. J. Microbiol. Biotechnol. 2014, 24, 740–747. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujiwara, A.; Fujisawa, M.; Hamasaki, R.; Kawasaki, T.; Fujie, M.; Yamada, T. Biocontrol of Ralstonia solanacearum by Treatment with Lytic Bacteriophages. Appl. Environ. Microbiol. 2011, 77, 4155–4162. [Google Scholar] [CrossRef] [Green Version]
- Obradovic, A.; Jones, J.B.; Momol, M.T.; Balogh, B.; Olson, S.M. Management of Tomato Bacterial Spot in the Field by Foliar Applications of Bacteriophages and SAR Inducers. Plant Dis. 2004, 88, 736–740. [Google Scholar] [CrossRef] [Green Version]
- Iriarte, F.B.; Obradović, A.; Wernsing, M.H.; Jackson, L.E.; Balogh, B.; Hong, J.A.; Momol, M.; Jones, J.; Vallad, G. Soil-based systemic delivery and phyllosphere in vivo propagation of bacteriophages. Bacteriophage 2012, 4, e23530. [Google Scholar] [CrossRef] [Green Version]
- Iriarte, F.B.; Balogh, B.; Momol, M.T.; Smith, L.M.; Wilson, M.; Jones, J.B. Factors affecting survival of bacteriophage on tomato leaf surfaces. Appl. Environ. Microbiol. 2007, 73, 1704–1711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ackermann, H.-W. Bacteriophage Electron Microscopy. In Advances in Virus Research; Academic Press Inc.: Cambridge, MA, USA, 2012; pp. 1–32. [Google Scholar] [CrossRef]
- Bradley, D.E. Ultrastructure of Bacteriophages and Bacteriocins. Bacteriol. Rev. 1967, 31, 230–314. [Google Scholar] [CrossRef] [PubMed]
- Leplae, R.; Lima-Mendez, G.; Toussaint, A. ACLAME: A CLAssification of Mobile genetic Elements, update 2010. Nucleic Acids Res. 2010, 38, D57–D61. [Google Scholar] [CrossRef] [Green Version]
- Hatcher, E.L.; Zhdanov, S.A.; Bao, Y.; Blinkova, O.; Nawrocki, E.P.; Ostapchuck, Y.; Schaffer, A.; Rodney Brister, J. Virus Variation Resource-improved response to emergent viral outbreaks. Nucleic Acids Res. 2017, 45, D482–D490. [Google Scholar] [CrossRef] [PubMed]
- Grudeva, V.; Moncheva, P.; Naumova, S.; Gocheva, B.; Nedeva, T.; Antonova-Nikolova, S. Microbiology Manual; St. Kliment Ohridski University Press: Sofia, Bulgaria, 2006. [Google Scholar]
- Sarathchandra, S.U. Nitrification activities and the changes in the populations of nitrifying bacteria in soil perfused at two different h-ion concentrations. Plant Soil 1978, 50, 99–110. [Google Scholar] [CrossRef]
- Valera, L.; Alexander, M. Nutrition and physiology of denitrifying bacteria. Plant Soil 1961, 15, 268–280. [Google Scholar] [CrossRef]
- Ross, A.; Ward, S.; Hyman, P. More is better: Selecting for broad host range bacteriophages. Front. Microbiol. 2016, 7, 1352. [Google Scholar] [CrossRef] [Green Version]
- Jurczak-Kurek, A.; Gasior, T.; Nejman-Faleńczyk, B.; Bloch, S.; Dydecka, A.; Topka, G.; Necel, A.; Jakubowska-Deredas, M.; Narajczyk, M.; Richert, M.; et al. Biodiversity of bacteriophages: Morphological and biological properties of a large group of phages isolated from urban sewage. Sci. Rep. 2016, 6, 34338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jansson, P.; Kenne, L.; Lindberg, B. Structure of the extracellular polysaccharide from Xanthomonas campestris. Carbohydr. Res. 1975, 45, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.-S.; Geider, K. Characterization of a Viral EPS-Depolymerase, a Potential Tool for Control of Fire Blight. Phytopathology 2000, 90, 1263–1268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartell, P.F.; Lam, G.K.H.; Orr, T.E. Purification and Properties of Polysaccharide Depolymerase Associated with Phage-infected Pseudomonas aeruginosa. J. Biol. Chem. 1968, 243, 2077–2080. [Google Scholar] [CrossRef] [PubMed]
- Sutherland, I.W.; Wilkinson, J.F. Depolymerases for Bacterial Exopolysaccharides obtained from Phage-Infected Bacteria. J. Gen. Microbiol. 1965, 39, 373–383. [Google Scholar] [CrossRef] [Green Version]
- Higashi, S.; Abe, M. Phage Induced Depolymerase for Exopolysaccharide of Rhizobiaceae. J. Gen. Appl. Microbiol. 1978, 24, 143–153. [Google Scholar] [CrossRef] [Green Version]
- King, A.M.K.; Adams, M.J.; Carstens, A.B.; Lefkowitz, A.J. Family Myoviridae. In Virus Taxonomy—Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier Inc.: Amsterdam, The Netherlands, 2012; pp. 46–62. [Google Scholar] [CrossRef]
- Eichman, B.F.; Vargason, J.M.; Mooers, B.H.; Ho, P.S. The Holliday junction in an inverted repeat DNA sequence: Sequence effects on the structure of four-way junctions. Proc. Natl. Acad. Sci. USA 2000, 97, 3971–3976. [Google Scholar] [CrossRef] [Green Version]
- Ackermann, H.-W.; Tremblay, D.; Moineau, S. Long-term bacteriophage preservation. WFCC Newsl. 2004, 38, 35–40. [Google Scholar]
- James, N.; Roslycky, E.B. Specificity of bacterial virus for Xanthomonas trifolii. Can. J. Microbiol. 1956, 2, 6–11. [Google Scholar] [CrossRef]
- Romero-Suarez, S.; Jordan, B.; Heinemann, J.A. Isolation and characterization of bacteriophages infecting Xanthomonas arboricola pv. juglandis, the causal agent of walnut blight disease. World J. Microbiol. Biotechnol. 2012, 28, 1917–1927. [Google Scholar] [CrossRef]
- Rao, Y.P.; Srivastava, D.N. Application of phages in investigation of epidemiology of bacterial blight disease of rice. Proc. Indian Natl. Sci. Acad. Epidemiol. Forecast. Control Plant Dis. 1973, 37, 314–321. [Google Scholar]
- Kizheva, Y.; Vancheva, T.; Stoyanova, M.; Bogatzevska, N.; Moncheva, P.; Hristova, P. 16S-23S ITS rDNA PCR-RFLP approach as a tool for identification and differentiation of bacterial spot-causing xanthomonas. J. Plant Pathol. 2016, 98, 645–649. [Google Scholar] [CrossRef]
- Mazzocco, A.; Waddell, T.E.; Lingohr, E.; Johnson, R.P. Bacteriophages; Humana Press: Totowa, NJ, USA, 2009; Volume 501. [Google Scholar] [CrossRef]
- Msimbira, L.A.; Jaiswal, S.K.; Dakora, F.D. Identification and characterization of phages parasitic on bradyrhizobia nodulating groundnut (Arachis hypogaea L.) in South Africa. Appl. Soil Ecol. 2016, 108, 334–340. [Google Scholar] [CrossRef] [PubMed]
- Borisova, D.; Haladjova, E.; Kyulavska, M.; Petrov, P.; Pispas, S.; Stoitsova, S.; Paunova-Krasteva, T. Application of cationic polymer micelles for the dispersal of bacterial biofilms. Eng. Life Sci. 2018, 18, 943–948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, e1005595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.; Kubal, M.; et al. The RAST Server: Rapid Annotations using Subsystems Technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [Green Version]
Bacterial Strains | Lytic Activity of Phage Isolates on Tested Bacterial Strains | ||||||||
---|---|---|---|---|---|---|---|---|---|
№ | Strain № | Year of Isolation | Pathotype-Race | Host | Region of Isolation | BsXeu269p/3 AN d ON996340 | BsXeu105t/1 | BsXeu105t/2 | BsXeu105t/4 |
Xanthomonas vesicatoria | |||||||||
NBIMCC a 2427 | NA | ND | NA | NA | − | − | − | − | |
1. | 29t | 1995 | P4T3 | tomato | Petrich | − | − | − | − |
2. | 31t | 1997 | T1 | tomato | IG, Sofia b | − | − | − | − |
3. | 1b | 1999 | P6T1 | pepper | Lovech | − | − | − | − |
4. | 32t | 1999 | P4T3 | tomato | IG, Sofia b | − | − | − | − |
5. | 43t | 2006 | P4T2 | tomato | Kostinbrod | − | − | − | − |
6. | 60t | 2007 | T2 | tomato | IG, Sofia b | − | − | − | − |
7. | 68t | 2010 | T3 | tomato | MVCRI, Plovdiv c | − | − | − | − |
8. | 73t | 2012 | T1 | tomato | Topolovgrad | − | − | − | − |
9. | 97t | 2015 | P4T2 | tomato | MVCRI, Plovdiv c | − | − | − | − |
10. | 124t | 2016 | T3 | tomato | MVCRI, Plovdiv c | − | − | − | − |
11. | 130t | 2016 | T2 | tomato | Blagoevgrad | − | − | − | − |
12. | 131t | 2016 | T2 | tomato | Blagoevgrad | − | − | − | − |
13. | 132t | 2016 | P6T1 | tomato | Tyulenovo | − | − | − | − |
14. | 41f | 2017 | T1 | tomato | MVCRI, Plovdiv c | − | − | − | − |
Xanthomonas perforans | |||||||||
NBIMCC a 8729 | NA | ND | NA | NA | − | − | − | − | |
Xanthomonas euvesicatoria | |||||||||
NBIMCC a 8731 | NA | ND | NA | NA | + | + | + | + | |
15. | 67b | 2012 | P6 | pepper | Pavlikeni | + | + | + | + |
16. | 81b | 2012 | P6 | pepper | Shabla | + | + | + | + |
17. | 86b | 2012 | P6 | pepper | Kavarna | + | + | + | + |
18. | 99b | 2013 | P4T3 | pepper | Byala cherkva | + | + | + | + |
19. | 106b | 2013 | P6T1 | pepper | Shabla | + | + | + | + |
20. | 110b | 2013 | P4T2 | pepper | Kavarna | + | + | + | + |
21. | 111b | 2013 | P0T2 | pepper | Kavarna | + | + | + | + |
22. | 105t | 2015 | P4T1 | tomato | Haskovo | + | + | + | + |
23. | 108t | 2015 | P1T2 | tomato | Svilengrad | + | + | + | + |
24. | 269p | 2015 | P4 | pepper | Durankulak | + | + | + | + |
25. | 274p | 2015 | P0 | pepper | Shabla | + | + | + | + |
26. | 116t | 2016 | T1 | tomato | Kostinbrod | + | + | + | + |
27. | 117t | 2016 | T2 | tomato | MVCRI, Plovdiv c | + | + | + | + |
28. | 119t | 2016 | P4T2 | tomato | MVCRI, Plovdiv c | + | + | + | + |
29. | 120t | 2016 | P0T2 | tomato | Sadovo | + | + | + | + |
30. | 136t | 2016 | P0T2 | tomato | Pazardzhik | + | + | + | + |
31. | 137t | 2016 | P0T3 | tomato | Pavlikeni | + | + | + | + |
32. | 306p | 2016 | P5T2 | pepper | Kostinbrod | + | + | + | + |
33. | 308p | 2016 | P1T3 | pepper | Kavarna | + | + | + | + |
34. | 314p | 2016 | P3T2 | pepper | Pavlikeni | + | + | + | + |
35. | 315p | 2016 | P1T3 | pepper | Pavlikeni | + | + | + | + |
36. | 317p | 2016 | P6 | pepper | Durankulak | + | + | + | + |
37. | 318p | 2016 | P1 | pepper | Shabla | + | + | + | + |
38. | 320p | 2016 | P1 | pepper | Tyulenovo | + | + | + | + |
39. | 321p | 2016 | P1T1 | pepper | Kavarna | + | + | + | + |
40. | 326p | 2016 | P6 | pepper | Shabla | + | + | + | + |
41. | 40f | 2017 | P4T2 | tomato | MVCRI, Plovdiv c | + | + | + | + |
42. | 2p3 | 2020 | ND | pepper | Kyustendil | + | + | + | + |
43. | 3t3 | 2020 | ND | tomato | Kyustendil | + | + | + | + |
44. | 3p4 | 2020 | ND | pepper | Kyustendil | + | + | + | + |
45. | 7p2 | 2020 | ND | pepper | Kyustendil | + | + | + | + |
46. | 8p4 | 2020 | ND | pepper | Kyustendil | + | + | + | + |
Xanthomonas gardneri | |||||||||
NBIMCC a 8730 | NA | ND | NA | NA | − | − | − | − | |
47. | 62t | 2009 | P0T1 | tomato | IG, Sofia b | − | − | − | − |
48. | 64t | 2009 | P0T3 | tomato | IG, Sofia b | − | − | − | − |
49. | 77t | 2012 | T3 | tomato | Topolovgrad | − | − | − | − |
Pseudomonas syringae pv. tomato | |||||||||
50. | 32f | 2017 | R0 | tomato | Kostinbrod | − | − | − | − |
NBIMCC a 3374 | NA | ND | NA | NA | − | − | − | − |
Groups of Microorganisms | Media | Enumeration Method | Duration of Cultivation | Bacterial Quantity | Activity of BsXeu269p/3 | |
---|---|---|---|---|---|---|
In the Native Soil Sample | In the Presence of Phage Isolate | |||||
Heterotrophs | Nutrient agar II (NAII) [40] | Aerobic plate count | 28 °C/24 h | 105 CFU/mL | ND a | - |
Nitrogen-fixing microorganisms | Nitrogen free media agar (NFM) [40] | Aerobic plate count | 28 °C/48 h | 105 CFU/mL | ND | - |
Ammonifying bacteria | Nutrient broth II (NB) + phenol red (0.2% water solution) [40] | Most probable number | 28 °C/up to 1 week | 105 MPN/mL | 105 MNP/mL | - |
Nitrifying bacteria | Mineral media broth + phenol red [41] | Most probable number | 28 °C/up to 4 weeks | ND | ND | ND |
Denitrifying bacteria | Giltay’s medium broth + Bromothymol blue [42] | Most probable number | 28 °C/up to 1 week | 104 MPN/mL | 104 MPN/mL | - |
Primers | Target Sequences between Contigs | Sequences 5′–3′ | Phage Sample Type | Amplicon Lengths | Source |
---|---|---|---|---|---|
YK2F2 | 1-2 | GAAGTCGATTAAACCCTCCG | 5-fold diluted phage lysate | 850 bp | This study |
YK2R2 | AACTGACCCTGCTTTAGTTC | This study | |||
YK2F3 | 2-1 | GGGTTGTGAGTGTGGATAAA | 5-fold diluted phage lysate | 350 bp | This study |
YK2R3 | TAGATTCCCCTGATCGTCAA | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kizheva, Y.; Urshev, Z.; Dimitrova, M.; Bogatzevska, N.; Moncheva, P.; Hristova, P. Phenotypic and Genotypic Characterization of Newly Isolated Xanthomonas euvesicatoria-Specific Bacteriophages and Evaluation of Their Biocontrol Potential. Plants 2023, 12, 947. https://doi.org/10.3390/plants12040947
Kizheva Y, Urshev Z, Dimitrova M, Bogatzevska N, Moncheva P, Hristova P. Phenotypic and Genotypic Characterization of Newly Isolated Xanthomonas euvesicatoria-Specific Bacteriophages and Evaluation of Their Biocontrol Potential. Plants. 2023; 12(4):947. https://doi.org/10.3390/plants12040947
Chicago/Turabian StyleKizheva, Yoana, Zoltan Urshev, Melani Dimitrova, Nevena Bogatzevska, Penka Moncheva, and Petya Hristova. 2023. "Phenotypic and Genotypic Characterization of Newly Isolated Xanthomonas euvesicatoria-Specific Bacteriophages and Evaluation of Their Biocontrol Potential" Plants 12, no. 4: 947. https://doi.org/10.3390/plants12040947