Next Article in Journal
Enhancing Urban Wastewater Treatment through Isolated Chlorella Strain-Based Phytoremediation in Centrate Stream: An Analysis of Algae Morpho-Physiology and Nutrients Removal Efficiency
Previous Article in Journal
Seed Germination of Three Milk Thistle (Silybum marianum (L.) Gaertn.) Populations of Greek Origin: Temperature, Duration, and Storage Conditions Effects
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 5
10.3390/plants12051026
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of MbEGS1 and MbEGS2 in Methyleugenol Biosynthesis by Melaleuca bracteata

by
Yongsheng Lin
1,2,
Ziwen Qiu
1,2,
Xiaojie Lin
1,2,
Yingxiang Wu
3,
Xianqian Niu
4,
Guanwen Yin
1,2,
Dandan Shao
1,2,
Xuwen Xiang
1,2,
Yongyu Li
1,2,* and
Chao Yang
1,2,*
1
College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Institute of Natural Products of Horticultural Plants, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
Qingyuan Agricultural Science and Technology Extension Service Center, Qingyuan 511518, China
4
Fujian Institute of Tropical Crops, Zhangzhou 363001, China
*
Authors to whom correspondence should be addressed.
Plants 2023, 12(5), 1026; https://doi.org/10.3390/plants12051026
Submission received: 7 January 2023 / Revised: 22 February 2023 / Accepted: 22 February 2023 / Published: 24 February 2023
(This article belongs to the Section Horticultural Science and Ornamental Plants)
Browse Figures
Versions Notes

Abstract

:
Many aromatic plant volatile compounds contain methyleugenol, which is an attractant for insect pollination and has antibacterial, antioxidant, and other properties. The essential oil of Melaleuca bracteata leaves contains 90.46% methyleugenol, which is an ideal material for studying the biosynthetic pathway of methyleugenol. Eugenol synthase (EGS) is one of the key enzymes involved in the synthesis of methyleugenol. We recently reported two eugenol synthase genes (MbEGS1 and MbEGS2) present in M. bracteata, where MbEGS1 and MbEGS2 were mainly expressed in flowers, followed by leaves, and had the lowest expression levels in stems. In this study, the functions of MbEGS1 and MbEGS2 in the biosynthesis of methyleugenol were investigated using transient gene expression technology and virus-induced gene silencing (VIGS) technology in M. bracteata. Here, in the MbEGSs genes overexpression group, the transcription levels of the MbEGS1 gene and MbEGS2 gene were increased 13.46 times and 12.47 times, respectively, while the methyleugenol levels increased 18.68% and 16.48%. We further verified the function of the MbEGSs genes by using VIGS, as the transcript levels of the MbEGS1 and MbEGS2 genes were downregulated by 79.48% and 90.35%, respectively, and the methyleugenol content in M. bracteata decreased by 28.04% and 19.45%, respectively. The results indicated that the MbEGS1 and MbEGS2 genes were involved in the biosynthesis of methyleugenol, and the transcript levels of the MbEGS1 and MbEGS2 genes correlated with the methyleugenol content in M. bracteata.

1. Introduction

Phenylpropenes, such as eugenol, isoeugenol, chavicol, and their derivatives, are secondary metabolites in a wide range of plants [1,2]. Some phenylpropene compounds are toxic to animals and microorganisms, and a number of plants synthesize phenylpropenes in their organs to attract insects for pollination or to protect them from herbivores and microorganisms [3,4]. Interestingly, Clarkia breweri emits a volatile mixture containing eugenol, isoeugenol, and their methyl derivatives [5]. Ocimum basilicum synthesizes and releases high levels of eugenol in the glands on the leaves and flower surfaces [1,6]. The flowers of Petunia hybrida emit a volatile mixture containing high levels of isoeugenol and low levels of eugenol [7]. Among them, eugenol has been demonstrated to act as an herbivory inhibitor, nematicide, and fungicide [8,9,10], while methyleugenol is a significant insect pollinator attractant for many flowers, particularly for pollinating moths and beetles, as well as a female pheromone mimic for several kinds of fruit flies [11]. Additionally, phenylpropene has a pleasant aroma and flavor, and humans have used plant materials containing phenylpropene as flavorings, preservatives, perfumes, and for the extraction of plant essential oils [3]. Consequently, it is very important to study the mechanisms that regulate the biosynthesis of phenylpropene compounds in different plants to gain a better understanding of how phenylpropene compounds are synthesized as well as the secondary metabolism of plants.
The biosynthesis pathways of phenylpropenes have been clearly defined; they are derived from the biosynthesis pathways of phenylpropanoids/benzenoids and are the second largest aromatic compounds found in plants [12,13]. The biosynthesis originates from the shikimic acid pathway [14]. In the biosynthesis pathway of phenylpropenes, phenylalanine ammonia-lyase (PAL) uses phenylalanine as substrate to form trans-cinnamic acid. Next, the 4-hydroxycinnamic acid (C4H) converts trans-cinnamic acid to 4-coumarate [15,16,17,18] (Figure 1). It is the key step in the biosynthesis of the phenylpropanoids/benzenoids before entering different metabolic pathways. Subsequently, different metabolic pathways are further modified under the catalysis of various enzymes to form intermediates, such as lignin, defensive substances, and pigments [19,20]. Among them, some intermediates undergo hydroxylation, methylation, and acylation to produce volatile compounds such as aldehydes, alcohols, alkanes, alkenes, ethers, and esters [21,22].
Melaleuca bracteata is an evergreen tree belonging to the Melaleuca genus of Myrtaceae. It is an aromatic tree species with high ornamental value, commonly known as the black tea-tree/river tea-tree or mock olive [23]. M. bracteata leaves are rich in essential oils and have antioxidant, antibacterial, antimicrobial, anticancer, and anti-inflammatory effects [24,25,26]. According to anti-quorum sensing evaluation, the main bioactive component of M. bracteata essential oil has been isolated and identified as methyleugenol, and the relative content can be as high as 90.46% [27,28]. Therefore, M. bracteata is a good material for studying the biosynthetic pathway of methyleugenol. The biosynthesis of methyleugenol is one of the branches of biosynthesis in the phenylpropanoids/benzenoids pathway. This branch uses coniferyl alcohol as the starting substrate (Figure 1). Coniferyl alcohol acyltransferase (CFAT) uses coniferyl alcohol as substrate to form coniferyl acetate. Next, eugenol synthetase (EGS) converts coniferyl alcohol to eugenol. Finally, eugenol-O-methyltransferase (EOMT) converts eugenol to methyleugenol. It is only through the conversion of coniferyl alcohol into enough eugenol by EGS that methyleugenol can be effectively synthesized. According to previous studies, despite a large amount of methyleugenol being detected in the essential oil of M. bracteata leaves, eugenol, isoeugenol, and methylisoeugenol were rarely detected [27,29,30,31]. Therefore, elucidating the mechanism of EGS genes in the metabolic pathway of methyleugenol in M. bracteata is of great importance for understanding the efficient synthesis of methyleugenol in M. bracteata.
EGS is a member of the PIP gene family and is NADPH dependent and has reductase activity. The PIP gene family is named after three members, pinoresinollariciresinol reductase (PLR), isoflavone reductase (IFR), and phenylcoumaran benzylic ether reductase (PCBER), which were discovered originally. The PIP gene family plays important roles in secondary metabolism, growth regulation, and the response to environmental stress in plants [18,32,33,34]. In our previous study, we successfully cloned two eugenol synthase genes (MbEGS1 and MbEGS2) from M. bracteate. We found that MbEGS1 and MbEGS2 are duplicate genes, encoding 320 and 323 amino acids, respectively. MbEGS1 and MbEGS2 share 72.43% amino acid sequence similarity. Meanwhile, we also performed heterologous transient overexpression experiments on Fragaria vesca fruits. The results showed that overexpression of MbEGS1 and MbEGS2 in Fragaria vesca fruits could positively regulate the synthesis of eugenol [35]. To further explore whether the efficient generation of methyleugenol in M. bracteata is related to MbEGS1 and MbEGS2, we used a homologous transient overexpression technique and a virus-induced gene silencing technique (VIGS) to analyze the overexpression and silencing of the MbEGS1 and MbEGS2 genes in M. bracteata. We used GC/MS and qRT-PCR techniques to analyze the changes in eugenol and methyleugenol content and genes expression level in the leaves of M. bracteata to investigate the roles of MbEGS1 and MbEGS2 in the methyleugenol biosynthesis pathway in plants.

2. Results

2.1. Verification of Recombinant M. bracteata

Using the untreated M. bracteata leaf cDNA as the control template (CK), the GUS gene in the overexpression treatment groups and the TRV virus in the VIGS treatment groups were detected by PCR. The results were detected by a 1.0% agarose gel. The results clearly showed that the GUS reporter gene and TRV virus were not detected in the control group (CK), whereas GUS was detected in the pNC-Cam1304-MCS35S-Control, pNC-Cam1304-MCS35S-MbEGS1, and pNC-Cam1304-MCS35S-MbEGS2 groups (Figure 2a), and the TRV virus was detected in the pNC-TRV2-Control, pNC-TRV2-MbEGS1, and pNC-TRV2-MbEGS2 groups (Figure 2b). Based on these results, it is clear that recombinant pNC-Cam1304-MCS35S-EGSs and viral vector pTRV2-EGSs can be efficiently replicated and transmitted in M. bracteata plants.

2.2. Overexpression of MbEGSs in M. bracteata

At 48 h after infection, the transcription level of MbEGSs was measured using qRT-PCR in leaves inoculated with pNC-Cam1304-MCS35S-MbEGSs to determine whether MbEGSs were overexpressed. Additionally, GC-MS was used to detect whether changes in the transcription level of MbEGSs genes affected the contents of eugenol and methyleugenol in leaves.
The qRT-PCR results showed that the relative expression levels of the MbEGS1 and MbEGS2 genes in leaves increased significantly after transient transformation of the MbEGS1 and MbEGS2 overexpression vectors compared to the pNC-Cam1304-MCS35S-Control group. The transcription level of MbEGS1 was increased 13.46 times in the pNC-Cam1304-MCS35S-MbEGS1 group. In the pNC-Cam1304-MCS35S-MbEGS2 group, the transcription level of MbEGS2 was increased 12.47 times (Figure 3a). The GC-MS results showed that as the transcription levels of the MbEGS1 and MbEGS2 genes increased, and the methyleugenol content in leaves significantly increased by 18.68% and 16.48%, respectively (Figure 3b). After comparing the GC-MS total ion chromatograms of the overexpression treatment groups with the NIST 2011 mass spectrometry database, we found that the matching degree for eugenol was all below 700. Therefore, it cannot be accurately identified and the eugenol content cannot be calculated.

2.3. VIGS of MbEGSs in M. bracteata

To further clarify the role of MbEGSs genes in methyleugenol biosynthesis by M. bracteata, we used VIGS technology to silence MbEGSs. The transcription level of MbEGSs and MbEOMTs were measured using qRT-PCR in leaves inoculated with pNC-TRV2-MbEGSs. At 30 d after infection, the qRT-PCR results showed that the MbEGS1 gene transcript level was decreased by 79.48% and the MbEGS2 gene transcript level was increased 30.94 times in the pNC-TRV2-MbEGS1 group in comparison to the pNC-TRV2-Control group. In the pNC-TRV2-MbEGS2 group, the transcription level of MbEGS2 decreased 90.35% and the transcription level of MbEGS1 increased 3.11 times (Figure 4a). In addition, the transcription level of MbEOMT1 and MbEOMT2 also showed significant changes in different silencing groups (Figure 4b). The results showed that the transcription levels of MbEOMT1 and MbEOMT2 were increased 8.81 and 16.87 times in the MbEGS1 silencing group. In the MbEGS2 silencing group, the transcription levels of MbEOMT1 and MbEOMT2 were increased 6.56 and 8.69 times.
As a result of silencing MbEGS1 and MbEGS2, the amount of methyleugenol in leaves significantly decreased compared to the pNC-TRV2-Control group, in the pNC-TRV2-MbEGS1 group, the methyleugenol content decreased by 28.04%, and in the pNC-TRV2-MbEGS2 group, it decreased by 19.45% (Figure 4c). In the VIGS treatment groups, no eugenol was detected in the total ion chromatogram of GC-MS (Supplemental Figure S1).
Collectively, these results indicated that MbEGS1 and MbEGS2 expression levels are correlated with methyleugenol content. The transcription levels of MbEGS1 and MbEGS2 directly affect the accumulation of methyleugenol in M. bracteata.

3. Discussion

Plant essential oils are aromatic, volatile liquids obtained from various plant parts and contain secondary metabolites from plants [36,37]. They are synthesized and stored in all plant organs, such as secretory cells, lumens, tubes, epidermal cells, and glandular hairs [38]. M. bracteata leaves contain significant amounts of essential oils, are acaricidal and attract fruit fly insects, and are a source of natural antibiotics and antioxidants [26,39]. M. bracteata essential oil has not only antibacterial and antioxidant properties but also apparent inhibitory effects on Bacillus subtilis, Bacillus cereus, Phanerochaete chrysosporium, and Aspergillus flavus [31]. In addition, the isolated methyleugenol, the principal active component of M. bracteata essential oil, exhibited a wide range of inhibition processes targeting the C. violaceum QS system [28]. Studies have shown that 29 components were identified from the essential oil of M. bracteata leaves, accounting for 96.49% of the total content, of which methyleugenol accounted for 90.46%. However, eugenol is not included in these 29 main components [27]. In addition, 25 main components were identified in the essential oil of M. bracteata leaves from different seasons in India, among which the relative content of methyleugenol was 87.2–89.5%, while eugenol was only detected in leaves in winter at 0.1% [29]. It can be seen that although M. bracteata leaves contain a large amount of methyleugenol, the content of eugenol is very low. After silencing MbEGSs separately, the content of eugenol in M. bracteata decreased, and the expression levels of MbEOMT1 and MbEOMT2 genes were significantly up-regulated, which may result in the complete conversion of eugenol to methyleugenol. Meanwhile, the content of eugenol could also be related to the tree age of M. bracteata. It may be for these reason that we could not identify eugenol accurately in the NIST 2011 mass spectrometry database.
According to previous studies, some EGS have very strict substrate specificity in substrate selection, while others can utilize different substrates. For example, ObEGS1 in Ocimum basilicum [10], CbEGS1 and CbEGS2 in Clarkia breweri [6], FaEGS1a and FaEGS1b in Fragaria × ananassa [40], GoEGS in Gymnadenia odoratissima, and GcEGS in Gymnadenia conopsea [41] can only catalyze the formation of a single eugenol from coniferyl acetate. Additionally, EGS in some plants can catalyze coniferyl acetate to produce eugenol and smaller isoeugenol, as demonstrated in the case of FaEGS2 in Fragaria × ananassa [40], GdEGS in Gymnadenia densiflora [41] and DcE(I) GS1 in Daucus carota subsp. sativus [42]. However, EGS of different species of Ocimum(O. gratissimum L.; O. tenuiflorum L. and O. kilimandscharicum) can catalyze coniferyl acetate and coumaryl acetate to generate eugenol and chavicol. When both substrates were used together, eugenol was predominantly detected while chavicol was present in trace amounts in the assays [13]. Thus, EGS in plants is primarily used to produce eugenol. In the analysis of the M. bracteata essential oil composition, methyleugenol was extremely high and isoeugenol was extremely low, while chavicol was not traced [27,29,30]. According to research, the transcription levels of EGS genes are directly related to eugenol content, whereas the transcription levels of EOMT genes are mainly related to methyleugenol content [43,44]. To verify whether the MbEGSs gene in M. bracteata can catalyze the formation of eugenol, during the initial stages of our research, we overexpressed the M. bracteata MbEGSs genes in Fragaria vesca fruits. We found that overexpression of MbEGS1 and MbEGS2 promoted the synthesis of eugenol [35]. It provides preliminary evidence that MbEGS1 and MbEGS2 can catalyze the synthesis of eugenol. However, we did not trace the concentrations of eugenol, isoeugenol, and chavicol in this study. Whether MbEGS catalyzes the formation of eugenol only by coniferyl acetate, which in turn produces methyleugenol remains to be further investigated.
EGS plays a key role in the production of eugenol and methyleugenol, but its regulation is unclear in M. bracteata methyleugenol biosynthesis. In order to further verify whether the MbEGS1 and MbEGS2 genes can regulate the biosynthesis of eugenol and methyleugenol in M. bracteate, we constructed overexpression vectors and VIGS vectors of MbEGSs genes and used agrobacterium-mediated and vacuum infiltration methods to infect M. bracteata. Based on the research results, the content of methyleugenol in the leaves of M. bracteata was significantly correlated with the transcription levels of MbEGSs. When the transcription levels of the MbEGS1 and MbEGS2 genes increased, the content of methyleugenol in the leaves of M. bracteata increased significantly. In contrast, silencing the MbEGS1 and MbEGS2 genes resulted in a significant decrease in the methyleugenol content. We also noted that silencing of MbEGSs resulted in a significant increase in the transcription of MbEOMT1 and MbEOMT2. It may be that the silencing of MbEGS genes resulted in the reduction of eugenol content in M. bracteata. This triggers stress response in plants and causes them produce more methyleugenol by increasing transcription levels of the MbEOMT genes. However, even with increased MbEOMTs transcription levels, the content of methyleugenol in M. bracteata was still downregulated by 28.04% and 19.45% after silencing MbEGS1 and MbEGS2. At the same time, MbEGS1 gene silencing resulted in the up-regulation of MbEGS2 gene transcription level by 30.94 times, while MbEGS1 gene silencing resulted in the up-regulation of MbEGS1 gene transcription level by 3.11 times. This indicated that the function of MbEGS1 gene was stronger than that of MbEGS2 gene, and MbEGSs are not redundant functions in M. bracteata. This study showed that the MbEGS1 and MbEGS2 genes were critical to the biosynthesis of methyleugenol in M. bracteata and were the key genes involved in this pathway. The GC-MS results of the overexpression and VIGS groups were compared with the NIST 2011 mass spectrometry database and showed that the matching degree of eugenol in the overexpression groups was less than 700, whereas it was not detected in the VIGS groups. In the biosynthesis of methyleugenol, eugenol is the only precursor. Yunxiang (Rosa × hybrida) flowers contained both eugenol and methyleugenol, and its relative eugenol content was higher than methyleugenol. While Yunxiang (Rosa × hybrida) flowers have a lower relative content of methyleugenol than M. bracteata leaves [45]. Thus, we speculate that both MbEGS1 and MbEGS2 are capable of catalyzing the conversion of coniferyl acetate into eugenol. However, due to the high transcription level of the EOMT gene in M. bracteata, eugenol is completely methylated by EOMT, producing a high quantity of methyleugenol. As a result, M. bracteata contains a relatively low amount of eugenol. Regarding the reasons for the efficient generation of methyleugenol in M. bracteata, it is necessary to investigate the in vitro enzymatic reactions, homology modeling, and site-directed mutagenesis of MbEGS and to conduct a functional investigation of the coupled reaction between MbEGS and MbEOMT.

4. Materials and Methods

4.1. Plant Materials

Transient expression technology can only be used to explore changes in gene expression levels for a short period of time. According to our pre-experiment results, the gene overexpression effect was the most effective at 48 h. Therefore, the materials used in the MbEGSs genes overexpression experiments were obtained from ten-year-old M. bracteata plants at Fujian Agriculture and Forestry University (Fuzhou, China). Test materials were the annual branches of M. bracteata with robust growth and a length of approximately 25 cm. Isolated branches were inserted into tissue culture flasks with clean water in a greenhouse with a 16 h light/8 h dark cycle at 25 °C for 5 d. A total of ten branches were taken from each treatment group and repeated three times. After 48 h of overexpression treatment, leaves were collected, snap-frozen in liquid nitrogen, and stored at −80 °C.
For the MbEGSs genes silencing experiments, our pre-experiment found that silence after 30 d of infection was most effective. Therefore, two-year-old M bracteata cutting seedlings with roots were selected for the VIGS experiments, and cutting seedling lengths were 20–25 cm. M. bracteata cutting seedlings were purchased from Melaleuca bracteata Nursery (Chengdu, China). Cutting seedlings were planted in the experimental greenhouse with a 16 h light/8 h dark cycle at 25 °C of the Institute of Horticultural Plants and Natural Products, Fujian Agriculture and Forestry University, and were used for infection experiments after 30 d of cultivation. A total of thirty cutting seedlings were taken from each treatment group and repeated three times. After VIGS infection, continue cultivation for 30 d, leaves were collected, quick-frozen in liquid nitrogen, and stored at −80 °C.

4.2. Total RNA Isolation and cDNA Synthesis

Total RNA was extracted from the M. bracteata leaves using the polysaccharide polyphenol plant Total RNA Extraction Kit (TianGen Biotech, Beijing, China) according to the manufacturer’s instructions. The concentration, purity (A260/280 = 1.8–2.1) and integrity of total RNA were measured using a Nano-400A Ultramicro nucleic acid analyzer (AllSheng Company, Hangzhou, China) and 1.0% agarose gel electrophoresis, respectively. First-strand cDNA was synthesized using One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (TransGen Biotech, Beijing, China) following the kit’s instructions.

4.3. Target Fragment Amplification

Based on Iso-seq of the M. bracteata obtained by our laboratory, specific primers were designed using Primer Premier 5.0 software (Table 1). The synthetic first-strand cDNAs were diluted ten-fold for the first round of PCR amplification. The complete open reading frames (ORFs) and partial sequences of MbEGS1 and MbEGS2 were amplified by PCR Thermal Cycler (Bio-Rad company, Hercules, California, USA) according to 2×Taq Plus Master Mix II Kit (Vazyme, Nanking, China). The PCR reaction was performed in a 50 μL volume using the following conditions: pre-denaturation at 95 °C for 3 min, 35 thermal cycles (95 °C/15 s; 60 °C/20 s; 72 °C/60 s), and a final extension at 72 °C for 5 min. After the first round of PCR, the target fragment was recovered and purified using a TIANgel Purification Kit (TianGen Biotech, Beijing, China) after the PCR product was detected by 1% agarose gel electrophoresis. Next, primers containing Nimble cloning universal joints were used to conduct a second round of PCR, primers containing Nimble cloning universal joints are shown in Table 1. First-round PCR products were used as the templates, and PCR reaction procedure as above. After the second round of PCR amplification, the target amplified fragment containing Nimble cloning universal joints were obtained through a TIANgel Purification Kit (TianGen Biotech, Beijing, China).

4.4. Vector Construction

The overexpression vector containing the GUS reporter gene (pNC-Cam1304-MCS35S) and the VIGS expression vector (TRV1 and pNC-TRV2) were provided by the Chinese Academy of Tropical Agricultural Sciences (Haikou, China).

4.4.1. Construction of Overexpression Vectors

The coding sequences of MbEGS1 (GenBank: MW579500.1) and MbEGS2 (GenBank: MW579501.1) have previously been deposited in the NCBI (National Center for Biotechnology Information, National Institutes of Health, Bethesda, Maryland, USA) database. To construct overexpression vectors pNC-Cam1304-MCS35S-MbEGS1 and pNC-Cam1304-MCS35S-MbEGS2, the full length MbEGS1 (963 bp) and MbEGS2 (972 bp) open reading frames (ORFs) were cloned from M. bracteata. The full length primers containing Nimble cloning universal joints were amplified by secondary PCR, and the full length products containing the universal joint were purified. The purified products were cloned into the pNC-Cam1304-MCS35S vector using the Nimble Cloning kit (Yi Tian Biotech, Haikou, China) following the kit’s instructions. Overexpression vector carrying the full length were transformed into 50 μL E. coli T1 cells using the T1 Cloning Kit (TransGen Biotech, Beijing, China) and selected to be cultured on LB (Luria Bertani Medium) plates containing 100 mg·L−1 kanamycin at 37 °C overnight. As a next step, the six monoclonal colonies were selected and cultured for 12 h at 37 °C in 700 μL LB liquid medium containing kanamycin. Through PCR verification, 300 μL of the positive clones bacteria solution was selected and sent to BioSune (BioSune Co., Ltd., Shanghai, China) for sequencing. The remaining positive clones bacteria solution were added with 60% glycerin at a ratio of 1:1 and stored at −80 °C.
The sequencing results demonstrated that the full length were successfully linked to the overexpression vector. About 100 μL positive clones bacteria solution were cultured in 5 mL LB liquid medium containing kanamycin at 200 rpm in a shaker for 16 h at 37 °C. Recombinant plasmids were extracted from bacterial solution using the TIANprep Mini Plasmid Kit (TianGen Biotech, Beijing, China) according to the manufacturer’s instructions. The concentration and integrity of plasmids were measured using a Nano-400A Ultramicro nucleic acid analyzer (AllSheng Company, Hangzhou, China) and 1.0% agarose gel electrophoresis, respectively. Finally, recombinant vector plasmids were introduced into Agrobacterium tumefaciens strain GV3101 (Zoman Biotechnology Co., Ltd., Beijing, China) using the freeze-thaw method and selected to be cultured on YEB (Agrobacterium rhizogene Medium) plates containing 100 mg·L−1 kanamycin and 50 mg·L−1 rifampicin. Positive clones were verified and stored as described above. A. tumefaciens strain GV3101 carrying the pNC-Cam1304-MCS35S-Control, pNC-Cam1304-MCS35S-MbEGS1, pNC-Cam1304-MCS35S-MbEGS2 vectors were constructed.

4.4.2. Construction of VIGS Vectors

To construct VIGS vectors pNC-TRV2-MbEGS1 and pNC-TRV2-MbEGS2, 298 bp MbEGS1 fragment and 241 bp MbEGS2 fragment (Supplemental Figure S2) were selected and cloned into the pNC-TRV2 vector with Nimble Cloning kit (Yi Tian Biotech, Haikou, China). The TRV1 and pNC-TRV2 combined plasmids (pNC-TRV2-Control, pNC-TRV2-MbEGS1 and pNC-TRV2-MbEGS2) were inoculated to E. coli T1 cells and A. tumefaciens strain GV3101 using the method as above. Finally, A. tumefaciens strain GV3101 carrying the TRV1, pNC-TRV2-Control, pNC-TRV2-MbEGS1, and pNC-TRV2-MbEGS2 vectors were constructed and stored at −80 °C.

4.5. Infection Preparation and Vacuum Infiltration

For the initial activation, 50 μL of A. tumefaciens strains GV3101 containing the recombinant vectors (pNC-Cam1304-MCS35S-Control, pNC-Cam1304-MCS35S-MbEGS1, pNC-Cam1304-MCS35S-MbEGS2, TRV1, pNC-TRV2-Control, pNC-TRV2-MbEGS1, and pNC-TRV2-MbEGS2) were taken, placed in 5 mL of YEB medium containing 100 mg·L−1 kanamycin and 50 mg·L−1rifampicin, and cultured at 28 °C for 12 h in a 200 rpm shaker. Afterward, 1 mL of primary activated propagation solution was added to 100 mL of YEB liquid medium (containing Kan and Rif), placed in a 200 rpm shaker and incubated at 28 °C for 16 h in the dark until the OD600 value reached approximately 1.0. Agrobacterium cells containing the different constructs were harvested at 12,000 rpm for 10 min and resuspended in Agrobacterium infiltration buffer (10 mM MES pH 5.6–5.7, 10 mM MgCl2, 0.1 mM AS), and the final OD600 value was adjusted to 1.0.
Additionally, in the VIGS experiment, Agrobacterium suspension containing the pNC-TRV2-Control, pNC-TRV2-MbEGS1 and pNC-TRV2-MbEGS2 vectors were mixed with Agrobacterium suspension TRV1 at a volume ratio of 1:1. The mixed bacterial fluids were named VIGS-TRV2, VIGS-MbEGS1, and VIGS-MbEGS2, and the infection fluids needed for overexpression and VIGS were placed in the dark for 3 h.
Agrobacterium infection solutions from different treatment groups were fully contacted with plant materials, and subjected to vacuum (−70 kPa) for 20 min. After infection, branches treated with overexpression were cultured in clean water for 48 h, and then the leaves were collected in groups. However, the VIGS-treated cutting seedlings were planted in the artificial climate room of the College of Horticulture, Fujian Agriculture and Forestry University, and leaves were collected after a month.

4.6. Detection of the GUS Reporter Gene and TRV Virus

To verify whether the plant materials were successfully infected, total RNA was extracted from different treatment groups and reverse transcribed into cDNA. The primers for the GUS and TRV2 genes are described in Table 1. We tested the GUS and TRV2 genes by PCR.

4.7. Quantitative RT-PCR Analysis

Total RNA extraction and cDNA synthesis were performed as described above. A five-fold dilution of the cDNA was used for qRT-PCR. qRT-PCR determination was performed using a TB Green® Premix Ex Taq™ kit with a total reaction volume of 20 μL (Takara Biotech, Beijing, China). The gene-specific primers used for qRT-PCR were designed using Primer Premier 5.0 software. qRT-PCR specific primers were qMbEGS1, qMbEGS2, qMbEOMT1, qMbEOMT2, and qMbCYP, and the specific sequences are shown in Table 1. In this study, qRT-PCR assays were performed using a LightCycler 96 (LightCycler® 96, Roche Company, Basel, Switzerland), and the qRT-PCR conditions were as follows: predenaturation at 95 °C for 30 s; 40 cycles of denaturation for 5 s at 95 °C and annealing for 30 s at 60 °C; and a final signal acquisition at 72 °C for 30 s. The 2−ΔΔCT method was used to analyze the qRT-PCR expression data according to Gong et al. [46]. The data were analyzed by variance using SPSS software.

4.8. Determination of Eugenol and Methyleugenol Content

M. bracteata leaves from different treatment groups were ground in liquid nitrogen into powder. For each treatment group, 0.20 g leaf powder was weighed separately, and extraction with 5 mL petroleum ether was conducted in a shaker at 200 rpm for 3 h at 28 °C. Following centrifugation at 12,000 rpm for 10 min, the supernatants were extracted using sterile syringes of 2 mL and each extract was passed through a membrane filter (0.22 mm). For each sample, three biological replicates were conducted. The eugenol and methyleugenol contents were detected by GC680 + SQ8T + HS40 gas chromatography-mass spectrometry (GC-MS, Perkin Elmer Company, Waltham, Massachusetts, USA). The GC-MS setup parameters were according to Li et al. [30]. GC-MS detection results were compared with the mass spectrometry database of NIST 2011, if the matching degree is greater than 750 (the total value is 1000), and the probability of the first matching compound is as higher as 100 than the second possible compound, then we defined the first matching compound as complete identification; if the matching degree is greater than 700, but not confirmed by the previous literature, then we defined the result as preliminary identification; if the matching degree is less than 700, the compound has a low level of content that cannot be accurately identified.
Finally, the contents of eugenol and methyleugenol were calculated by area normalization and external standard method. The eugenol and methyleugenol standards (Solarbio Science and Technology Co., Ltd., Beijing, China) were formulated into different concentration gradients (6.25; 12.50; 25.00; 50.00; 100.00; 200.00 μg/mL) using petroleum ether. Eugenol and methyleugenol peak areas were determined in 2 mL solutions under the same GC-MS conditions. The linear regression equation was obtained by taking the concentration of eugenol and methyleugenol as the horizontal coordinate and the absorption peak area as the vertical coordinate.

5. Conclusions

In this study, we found that the content of methyleugenol in the leaves of M. bracteata was significantly correlated with the transcription levels of MbEGS1 and MbEGS2 genes. We suggest that MbEGS1 and MbEGS2 are involved in methyleugenol biosynthesis in M. bracteata and are the key genes involved in this pathway.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12051026/s1. Melaleuca bracteata eugenol synthase 1 (EGS1) mRNA, complete cds (https://www.ncbi.nlm.nih.gov/nuccore/MW579500.1 (accessed on 13 December 2022), GenBank: MW579500.1); Melaleuca bracteata eugenol synthase 2 (EGS2) mRNA, complete cds (https://www.ncbi.nlm.nih.gov/nuccore/mw579501 (accessed on 13 December 2022), GenBank: MW579501.1). Figure S1. GC-MS analysis of VIGS experiments. Figure S2. Cloning of MbEGS1, MbEGS2 gene fragments (A), and cloning of MbEGS1, MbEGS2 gene fragments with NC linkers (B).

Author Contributions

Conceptualization, C.Y. and Y.L. (Yongyu Li); methodology, C.Y. and Y.L. (Yongsheng Lin); software, Z.Q. and X.L.; validation, Y.W., X.N., G.Y., D.S., and X.X.; formal analysis, Y.L. (Yongsheng Lin); investigation, Y.L. (Yongsheng Lin) and Z.Q.; resources, Y.L. (Yongsheng Lin); data curation, Y.L. (Yongsheng Lin); writing—original draft preparation, Y.L. (Yongsheng Lin); writing—review and editing, Y.L. (Yongyu Li), C.Y., and Y.L. (Yongsheng Lin). All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by fund from the Natural Science Foundation of China (31902067 and 31501694), the Natural Science Foundation of Fujian Provincial (Grant No. 2022J01138), the Foundation of Fujian Science and Technology Committee (Grant No. 2018N0003), the Foundation of Fuzhou Science and Technology Committee (Grant No. 2017NF30048).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gang, D.R.; Wang, J.; Dudareva, N.; Nam, K.H.; Simon, J.E.; Lewinsohn, E.; Pichersky, E. An Investigation of the Storage and Biosynthesis of Phenylpropenes in Sweet Basil. Plant Physiol. 2001, 125, 539–555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Yauk, Y.K.; Chagné, D.; Tomes, S.; Matich, A.J.; Atkinson, R.G. The O-methyltransferase gene MdoOMT1 is required for biosynthesis of methylated phenylpropenes in ripe apple fruit. Plant J. 2015, 82, 937–950. [Google Scholar] [CrossRef] [PubMed]
  3. Pichersky, E.; Noel, P.J.; Dudareva, N. Biosynthesis of plant volatiles: Nature’s diversity and ingenuity. Science 2006, 311, 808–811. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Tan, K.H.; Nishida, R. Methyl eugenol: Its occurrence, distribution, and role in nature, especially in relation to insect behavior and pollination. J. Insect Sci. 2012, 12, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Raguso, R.A.; Pichersky, E. Floral volatiles fromClarkia breweri andC. concinna (Onagraceae): Recent evolution of floral scent and moth pollination. Plant Syst. Evol. 1995, 194, 55–67. [Google Scholar] [CrossRef] [Green Version]
  6. Koeduka, T.; Louie, G.V.; Orlova, I.; Kish, C.M.; Ibdah, M.; Wilkerson, C.G.; Bowman, M.E.; Baiga, T.J.; Noel, J.P.; Dudareva, N.; et al. The multiple phenylpropene synthases in both Clarkia breweri and Petunia hybrida represent two distinct protein lineages. Plant J. Cell Mol. Biol. 2008, 54, 362–374. [Google Scholar] [CrossRef] [Green Version]
  7. Verdonk, J.; De Vos, C.R.; Verhoeven, H.A.; Haring, M.A.; Van Tunen, A.J.; Schuurink, R.C. Regulation of floral scent production in petunia revealed by targeted metabolomics. Phytochemistry 2003, 62, 997–1008. [Google Scholar] [CrossRef]
  8. Grossman, J.M. Botanical pesticides in Africa. Ipm Pract. 1993, 15, 1–9. [Google Scholar]
  9. Sisk, C.B.; Shorey, H.H.; Gerber, R.G.; Gaston, L.K. Semiochemicals that Disrupt Foraging by the Argentine Ant (Hymenoptera: Formicidae): Laboratory Bioassays. J. Econ. Entomol. 1996, 89, 385–391. [Google Scholar] [CrossRef]
  10. Koeduka, T.; Fridman, E.; Gang, D.R.; Vasso, D.G.; Pichersky, E. Eugenol and isoeugenol, characteristic aromatic constituents of spices, are biosynthesized via reduction of a coniferyl alcohol ester. Proc. Natl. Acad. Sci. USA 2006, 103, 10128–10133. [Google Scholar] [CrossRef] [Green Version]
  11. Gang, D.R.; Lavid, N.; Zubieta, C.; Chen, F.; Beuerle, T.; Lewinsohn, E.; Noel, J.P. Characterization of Phenylpropene O-Methyltransferases from Sweet Basil: Facile Change of Substrate Specificity and Convergent Evolution within a Plant O-Methyltransferase Family. Plant Cell 2002, 14, 505–519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Muhlemann, J.K.; Woodworth, B.D.; Morgan, J.A.; Dudareva, N. The monolignol pathway contributes to the biosynthesis of volatile phenylpropenes in flowers. New Phytol. 2014, 204, 661–670. [Google Scholar] [CrossRef] [PubMed]
  13. Anand, A.; Jayaramaiah, R.H.; Beedkar, S.D.; Singh, P.A.; Joshi, R.S.; Mulani, F.A.; Dholakia, B.B.; Punekar, S.A.; Gade, W.N.; Thulasiram, H.V.; et al. Comparative functional characterization of eugenol synthase from four different Ocimum species: Implications on eugenol accumulation. BBA Proteins Proteom. 2016, 1864, 1539–1547. [Google Scholar] [CrossRef] [PubMed]
  14. Schuurink, R.C.; Haring, M.A.; Clark, D.G. Regulation of volatile benzenoid biosynthesis in petunia flowers. Trends Plant Sci. 2006, 11, 20–25. [Google Scholar] [CrossRef]
  15. Cheng, S.; Fu, X.; Mei, X.; Zhou, B.; Naoharu, W.; Yang, Z. Regulation of biosynthesis and emission of volatile phenylpropanoids/benzenoids in petuniax hybrida flowers by multi-factors of circadian clock, light, and temperature. Plant Physiol. Biochem. 2016, 107, 1–8. [Google Scholar] [CrossRef] [PubMed]
  16. Sun, T.; Xu, Y.; Zhang, D.; Zhuang, H.; Wu, J.; Sun, G. An acyltransferase gene that putatively functions in anthocyanin modification was horizontally transferred from Fabaceae into the genus Cuscuta. Plant Divers. 2016, 38, 149–155. [Google Scholar] [CrossRef] [Green Version]
  17. Rodrigues, J.; Perrier, V.; Lecomte, J.; Dubreucq, E.; Ferreira-Dias, S. Biodiesel production from crude jatropha oil catalyzed by immobilized lipase/acyltransferase from Candida parapsilosis in aqueous medium. Bioresour. Technol. 2016, 218, 1224–1229. [Google Scholar] [CrossRef]
  18. Min, T.; Kasahara, H.; Bedgar, D.L.; Youn, B.; Lawrence, P.K.; Gang, D.R.; Halls, S.C.; Park, H.; Hilsenbeck, J.L.; Davin, L.B. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases. J. Biol. Chem. 2003, 278, 50714–50723. [Google Scholar] [CrossRef] [Green Version]
  19. Dal Cin, V.; Tieman, D.M.; Tohge, T.; McQuinn, R.; de Vos, R.C.; Osorio, S.; Schmelz, E.A.; Taylor, M.G.; Smits-Kroon, M.T.; Schuurink, R.C.; et al. Identification of Genes in the Phenylalanine Metabolic Pathway by Ectopic Expression of a MYB Transcription Factor in Tomato Fruit. Plant Cell 2011, 23, 2738–2753. [Google Scholar] [CrossRef]
  20. Kyo, W.; Atsushi, I. Metabolic engineering of the tryptophan and phenylalanine biosynthetic pathways in rice. Plant Biotechnol. 2009, 26, 523–533. [Google Scholar]
  21. Hatzimanikatis, V.; Li, C.; Ionita, J.A.; Henry, C.S.; Jankowski, M.D.; Broadbelt, L.J. Exploring the diversity of complex metabolic networks. Bioinformatics 2004, 21, 1603–1609. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Pascual, M.B.; El-Azaz, J.; de la Torre, F.N.; Cañas, R.A.; Avila, C.; Cánovas, F.M. Biosynthesis and Metabolic Fate of Phenylalanine in Conifers. Front. Plant Sci. 2016, 7, 1030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Brophy, J.J.; Goldsack, R.J.; Doran, J.C.; Craven, L.A.; Lepschi, B.J. A Comparison of the Leaf Oils of Melaleuca squamophloia with Those of Its Close Relatives, M. styphelioides and M. bracteata. J. Essent. Oil Res. 1999, 11, 327–332. [Google Scholar] [CrossRef]
  24. Carson, C.F.; Hammer, K.A.; Riley, T.V. Melaleuca alternifolia (Tea Tree) oil: A review of antimicrobial and other medicinal properties. Clin. Microbiol. Rev. 2006, 19, 50–62. [Google Scholar] [CrossRef] [Green Version]
  25. Adesanwo, J.K.; Shode, F.O.; Aiyelaagbe, O.O.; Rabiu, O.O.; Oyede, R.T. Antisecretory and antiulcerogenic activities of the stem bark extract of Melaleuca bracteata and isolation of principles. J. Med. Plants Res. 2009, 3, 822–824. [Google Scholar]
  26. Kardinan, A.K.; Hidayat, P. Potency of Melaleuca bracteata and Ocimum sp. Leaf Extractsas Fruit Fly (Bactrocera dorsalis complex) Attractants in Guava and Star Fruit Orchards in Bogor, West Java, Indonesia. J. Dev. Sustain. Agric. 2013, 8, 79–84. [Google Scholar]
  27. Wang, W.; Huang, X.; Yang, H.; Niu, X.; Li, Y. Antibacterial Activity and Anti-Quorum Sensing Mediated Phenotype in Response to Essential Oil from Melaleuca bracteata Leaves. Int. J. Mol. Sci. 2019, 20, 5696. [Google Scholar] [CrossRef] [Green Version]
  28. Wang, W.; Lin, X.; Yang, H.; Huang, X.; Pan, L.; Wu, S.; Yang, C.; Zhang, L.; Li, Y. Anti-quorum sensing evaluation of methyleugenol, the principal bioactive component, from the Melaleuca bracteata leaf oil. Front. Microbiol. 2022, 13, 970520. [Google Scholar] [CrossRef]
  29. Goswami, P.; Verma, S.K.; Chauhan, A.; Venkatesha, K.T.; Verma, R.S.; Singh, V.R.; Darokar, M.P.; Chanotiya, C.S.; Padalia, R.C. Chemical Composition and Antibacterial Activity of Melaleuca bracteata Essential Oil from India: A Natural Source of Methyl Eugenol. Nat. Prod. Commun. 2017, 12, 965–968. [Google Scholar] [CrossRef] [Green Version]
  30. Li, Y.; Ye, Z.; Wang, W.; Yang, C.; Liu, J.; Zhou, L.; Shen, Y.; Wang, Z.; Chen, J.; Wu, S.; et al. Composition Analysis of Essential Oil from Melaleuca bracteata Leaves Using Ultrasound-assisted Extraction and its Antioxidative and Antimicrobial Activities. BioResources 2018, 13, 8488–8504. [Google Scholar] [CrossRef]
  31. Yasin, M.; Younis, A.; Ramzan, F.; Javed, T.; Shabbir, R.; Noushahi, H.A.; Skalicky, M.; Ondrisik, P.; Brestic, M.; Hassan, S. Extraction of Essential Oil from River Tea Tree (Melaleuca bracteata F. Muell.): Antioxidant and Antimicrobial Properties. Sustainability 2021, 13, 4827. [Google Scholar] [CrossRef]
  32. Wang, X.; He, X.; Lin, J.; Shao, H.; Chang, Z.; Dixon, R.A. Crystal Structure of Isoflavone Reductase from Alfalfa (Medicago sativa L.). J. Mol. Biol. 2006, 358, 1341–1352. [Google Scholar] [CrossRef] [PubMed]
  33. Gang, D.R.; Kasahara, H.; Xia, Z.Q.; Vander Mijnsbrugge, K.; Bauw, G.; Boerjan, W.; Van Montagu, M.; Davin, L.B.; Lewis, N.G. Evolution of plant defense mechanisms. Relationships of phenylcoumaran benzylic ether reductases to pinoresinol-lariciresinol and isoflavone reductases. J. Biol. Chem. 1999, 274, 7516–7527. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Akashi, T.; Koshimizu, S.; Aoki, T.; Ayabe, S.I. Identification of cDNAs encoding pterocarpan reductase involved in isoflavan phytoalexin biosynthesis in Lotus japonicus by EST mining. FEBS Lett. 2006, 580, 5666–5670. [Google Scholar] [CrossRef] [Green Version]
  35. Qiu, Z.; Liu, L.; Lin, Y.; Lin, X.; Li, Y.; Wu, S.; Yang, C. Cloning and Functional Analysis of the MbEGS Gene from Melaleuca bracteata. Acta Hortic. Sin. 2022, 49, 1747. [Google Scholar]
  36. El Asbahani, A.; Miladi, K.; Badri, W.; Sala, M.; Addi, E.A.; Casabianca, H.; El Mousadik, A.; Hartmann, D.; Jilale, A.; Renaud, F.N.R.; et al. Essential oils: From extraction to encapsulation. Int. J. Pharm. 2015, 483, 220–243. [Google Scholar] [CrossRef]
  37. Porto, C.D.; Decorti, D. Ultrasound-assisted extraction coupled with under vacuum distillation of flavour compounds from spearmint (carvone-rich) plants: Comparison with conventional hydrodistillation. Ultrason. Sonochem. 2009, 16, 795–799. [Google Scholar] [CrossRef]
  38. Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essencial oils-a review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef]
  39. Siddique, S.; Parveen, Z.; Mazhar, S. Chemical composition, antibacterial and antioxidant activities of essential oils from leaves of three Melaleuca species of Pakistani flora. Arab. J. Chem. 2020, 13, 67–74. [Google Scholar] [CrossRef]
  40. Aragüez, I.; Osorio, S.; Hoffmann, T.; Rambla, J.L.; Medina-Escobar, N.; Granell, A.; Botella, M.Á.; Schwab, W.; Valpuesta, V. Eugenol production in achenes and receptacles of strawberry fruits is catalyzed by synthases exhibiting distinct kinetics. Plant Physiol. 2013, 163, 946–958. [Google Scholar] [CrossRef] [Green Version]
  41. Gupta, A.K.; Schauvinhold, I.; Pichersky, E.; Schiestl, F.P. Eugenol synthase genes in floral scent variation in Gymnadenia species. Funct. Integr. Genom. 2014, 14, 779–788. [Google Scholar] [CrossRef] [PubMed]
  42. Yahyaa, M.; Berim, A.; Nawade, B.; Ibdah, M.; Dudareva, N.; Ibdah, M. Biosynthesis of methyleugenol and methylisoeugenol in Daucus carota leaves: Characterization of eugenol/isoeugenol synthase and O-Methyltransferase. Phytochemistry 2019, 159, 179–189. [Google Scholar] [CrossRef] [PubMed]
  43. Koeduka, T.; Orlova, I.; Baiga, T.J.; Noel, J.P.; Dudareva, N.; Pichersky, E. The lack of floral synthesis and emission of isoeugenol in Petunia axillaris subsp. parodii is due to a mutation in the isoeugenol synthase gene. Howard Hughes Med. Inst. 2009, 58, 961–969. [Google Scholar]
  44. Wang, J.; Dudareva, N.; Bhakta, S.; Raguso, R.A.; Pichersky, E. Floral scent production in Clarkia breweri (Onagraceae). II. Localization and developmental modulation of the enzyme S-adenosyl-L-methionine:(iso)eugenol O-methyltransferase and phenylpropanoid emission. Plant Physiol. 1997, 114, 213–221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Yan, H.; Baudino, S.; Caissard, J.C.; Nicolè, F.; Zhang, H.; Tang, K.; Li, S.; Lu, S. Functional characterization of the eugenol synthase gene (RcEGS1) in rose. Plant Physiol. Biochem. 2018, 129, 21–26. [Google Scholar] [CrossRef]
  46. Gong, B.; Yi, J.; Wu, J.; Sui, J.; Khan, M.A.; Wu, Z.; Zhong, X.; Seng, S.; He, J.; Yi, M. LlHSFA1, a novel heat stress transcription factor in lily (Lilium longiflorum), can interact with LlHSFA2 and enhance the thermotolerance of transgenic Arabidopsis thaliana. Plant Cell Rep. 2014, 33, 1519–1533. [Google Scholar] [CrossRef]
Plants 12 01026 g001 550
Figure 1. The biosynthesis pathways of methyleugenol.
Figure 1. The biosynthesis pathways of methyleugenol.
Plants 12 01026 g001
Plants 12 01026 g002 550
Figure 2. PCR results for the GUS reporter gene (a) and TRV virus detection (b).
Figure 2. PCR results for the GUS reporter gene (a) and TRV virus detection (b).
Plants 12 01026 g002
Plants 12 01026 g003 550
Figure 3. MbEGSs genes transcription level analysis (a) and contents of methyleugenol (b) in the overexpression treatment groups. Note: Different lowercase letters indicate significant differences (p < 0.05).
Figure 3. MbEGSs genes transcription level analysis (a) and contents of methyleugenol (b) in the overexpression treatment groups. Note: Different lowercase letters indicate significant differences (p < 0.05).
Plants 12 01026 g003
Plants 12 01026 g004 550
Figure 4. Transcription level analysis of MbEGSs genes (a) and MbEOMTs genes (b), and contents of methyleugenol (c) in the VIGS treatment groups. Note: Different lowercase letters indicate significant differences (p < 0.05).
Figure 4. Transcription level analysis of MbEGSs genes (a) and MbEOMTs genes (b), and contents of methyleugenol (c) in the VIGS treatment groups. Note: Different lowercase letters indicate significant differences (p < 0.05).
Plants 12 01026 g004
Table
Table 1. List of primers used in this study.
Table 1. List of primers used in this study.
Primer NameForward Primer Sequence
(5′→3′)		Reverse Primer Sequence
(5′→3′)
MbEGS1ATGGCAGGAGAGGCCGAGAAAATCATTCGAAAGCAGCCCTAGCTG
MbEGS2ATGACGATCATAAGCAGTAGTTGCATCATTCCAATACAGCGCTTGC
NC-MbEGS1agtggtctctgtccagtcctATGGCAGGAGAGGCCGAGAAAAggtctcagcagaccacaagtTCATTCGAAAGCAGCCCTAGCTG
NC-MbEGS2agtggtctctgtccagtcctATGACGATCATAAGCAGTAGTTGCAggtctcagcagaccacaagtTCATTCCAA TACAGCGCTTGC
VIGS-MbEGS1GCAGGCATTCCTTACACCCGGGCACTTGGACTTTC
VIGS-MbEGS2GCACTCCCACCATTCGAGTCGTTCGCCACTTTT
NC-VIGS-MbEGS1agtggtctctgtccagtcctGCAGGCATTCCTTACACCggtctcagcagaccacaagtCGGGCACTTGGACTTTC
NC-VIGS-MbEGS2agtggtctctgtccagtcctGCACTCCCACCATTCGggtctcagcagaccacaagtAGTCGTTCGCCACTTTT
GUSACGGGGAAACTCAGCAAGCATGTAATGTTCTGCGACGCTCA
TRV2GGCGGTTCTTGTGTGTCAACGGCGGTTCTTGTGTGTCAAC
qMbEGS1TTCGGGAGTGAGGAGGATAATGGGGATGAAGGAGGTTGTT
qMbEGS2CCCCACCTTTGTCTTCGCTCAACCTCTTTATGTTGCCCGC
qMbEOMT1CACCAACATACGACGGAATCACTCATCATCGAACATGCCATCGCCTTC
qMbEOMT2CCTTGCTCCGATGGTGCTGATGATGCGATGCCACCGTTCTTGAC
qMbCYPCGCCGTGAAGGGATGTTTGTACGGGAAGCATTTCATCCTCTG
Note: Underlined bases indicate Nimble cloning universal joints.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lin, Y.; Qiu, Z.; Lin, X.; Wu, Y.; Niu, X.; Yin, G.; Shao, D.; Xiang, X.; Li, Y.; Yang, C. The Role of MbEGS1 and MbEGS2 in Methyleugenol Biosynthesis by Melaleuca bracteata. Plants 2023, 12, 1026. https://doi.org/10.3390/plants12051026

AMA Style

Lin Y, Qiu Z, Lin X, Wu Y, Niu X, Yin G, Shao D, Xiang X, Li Y, Yang C. The Role of MbEGS1 and MbEGS2 in Methyleugenol Biosynthesis by Melaleuca bracteata. Plants. 2023; 12(5):1026. https://doi.org/10.3390/plants12051026

Chicago/Turabian Style

Lin, Yongsheng, Ziwen Qiu, Xiaojie Lin, Yingxiang Wu, Xianqian Niu, Guanwen Yin, Dandan Shao, Xuwen Xiang, Yongyu Li, and Chao Yang. 2023. "The Role of MbEGS1 and MbEGS2 in Methyleugenol Biosynthesis by Melaleuca bracteata" Plants 12, no. 5: 1026. https://doi.org/10.3390/plants12051026

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop