Biochemical and Molecular Responses Underlying the Contrasting Phosphorus Use Efficiency in Ryegrass Cultivars
Abstract
:1. Introduction
2. Results
2.1. Phosphorus Concentration and Uptake
2.2. Growth Responses of Ryegrass Plants to P Treatments
2.3. Phosphorus Acquisition and Utilization Efficiency
2.4. Gene Expression Analysis of P Transporters
2.5. Phosphatase Activity and Gene Expression of PAP1
2.6. Principal Component Analysis (PCA)
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Plant Material and Growth Conditions
5.2. Plant Growth and P Determination
5.3. Intracellular Acid Phosphatase Activity
5.4. Gene Expression Analysis
5.5. Data Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blackwell, M.; Darch, T.; Haslam, R. Phosphorus use efficiency and fertilizers: Future opportunities for improvements. Front. Agric. Sci. Eng. 2019, 6, 332–340. [Google Scholar] [CrossRef] [Green Version]
- Menezes-Blackburn, D.; Giles, C.; Darch, T.; George, T.S.; Blackwell, M.; Stutter, M.; Shand, C.; Lumsdon, D.; Cooper, P.; Wendler, R.; et al. Opportunities for mobilizing recalcitrant phosphorus from agricultural soils: A review. Plant Soil 2018, 427, 5–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vance, C.P.; Uhde-Stone, C.; Allan, D.L. Phosphorus acquisition and use: Critical adaptations by plants for securing a nonrenewable resource. New Phytol. 2003, 157, 423–447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cordell, D.; White, S. Life’s Bottleneck: Sustaining the World’s Phosphorus for a Food Secure Future. Annu. Rev. Environ. Resour. 2014, 39, 161–188. [Google Scholar] [CrossRef]
- Cordell, D.; Drangert, J.O.; White, S. The story of phosphorus: Global food security and food for thought. Glob. Environ. Chang. 2009, 19, 292–305. [Google Scholar] [CrossRef]
- Gilbert, J.; Gowing, D.; Wallace, H. Available soil phosphorus in semi-natural grasslands: Assessment methods and community tolerances. Biol. Conserv. 2009, 142, 1074–1083. [Google Scholar] [CrossRef] [Green Version]
- Elser, J.J. Phosphorus: A limiting nutrient for humanity? Curr. Opin. Biotechnol. 2012, 23, 833–838. [Google Scholar] [CrossRef]
- Wang, X.; Shen, J.; Liao, H. Acquisition or utilization, which is more critical for enhancing phosphorus efficiency in modern crops? Plant Sci. 2010, 179, 302–306. [Google Scholar] [CrossRef]
- Han, Y.; White, P.J.; Cheng, L. Mechanisms for improving phosphorus utilization efficiency in plants. Ann. Bot. 2022, 129, 247–258. [Google Scholar] [CrossRef]
- Campos, P.; Borie, F.; Cornejo, P.; López-Ráez, J.A.; López-García, Á.; Seguel, A. Phosphorus Acquisition Efficiency Related to Root Traits: Is Mycorrhizal Symbiosis a Key Factor to Wheat and Barley Cropping? Front. Plant Sci. 2018, 9, 752. [Google Scholar] [CrossRef]
- Rose, T.J.; Rose, M.T.; Pariasca-Tanaka, J.; Heuer, S.; Wissuwa, M. The frustration with utilization: Why have improvements in internal phosphorus utilization efficiency in crops remained so elusive? Front. Plant Sci. 2011, 2, 45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhadouria, J.; Giri, J. Purple acid phosphatases: Roles in phosphate utilization and new emerging functions. Plant Cell Rep. 2022, 41, 33–51. [Google Scholar] [CrossRef]
- Tian, J.; Liao, H. The Role of Intracellular and Secreted Purple Acid Phosphatases in Plant Phosphorus Scavenging and Recycling. In Phosphorus Metabolism in Plants; Wiley: Hoboken, NJ, USA, 2015; Volume 48, pp. 265–288. ISBN 9781118958841. [Google Scholar] [CrossRef]
- Tran, H.T.; Hurley, B.A.; Plaxton, W.C. Feeding hungry plants: The role of purple acid phosphatases in phosphate nutrition. Plant Sci. 2010, 179, 14–27. [Google Scholar] [CrossRef]
- Wang, D.; Lv, S.; Jiang, P.; Li, Y. Roles, Regulation, and Agricultural Application of Plant Phosphate Transporters. Front. Plant Sci. 2017, 8, 817. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nussaume, L. Phosphate import in plants: Focus on the PHT1 transporters. Front. Plant Sci. 2011, 2, 45. [Google Scholar] [CrossRef] [Green Version]
- Młodzińska, E.; Zboińska, M. Phosphate Uptake and Allocation–A Closer Look at Arabidopsis thaliana L. and Oryza sativa L. Front. Plant Sci. 2016, 7, 1198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, C.Y.; Shirley, N.; Genc, Y.; Shi, B.; Langridge, P. Phosphate Utilization Efficiency Correlates with Expression of Low-Affinity Phosphate Transporters and Noncoding RNA, IPS1, in Barley. Plant Physiol. 2011, 156, 1217–1229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, H.; Yin, Z.; Chao, M.; Ning, L.; Zhang, D.; Yu, D. Functional properties and expression quantitative trait loci for phosphate transporter GmPT1 in soybean. Plant Cell Environ. 2014, 37, 462–472. [Google Scholar] [CrossRef]
- Chang, M.X.; Gu, M.; Xia, Y.W.; Dai, X.L.; Dai, C.R.; Zhang, J.; Wang, S.C.; Qu, H.Y.; Yamaji, N.; Feng Ma, J.; et al. OsPHT1;3 Mediates Uptake, Translocation, and Remobilization of Phosphate under Extremely Low Phosphate Regimes. Plant Physiol. 2019, 179, 656–670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mora, M.L.; Alfaro, M.A.; Jarvis, S.C.; Demanet, R.; Cartes, P. Soil aluminium availability in Andisols of southern Chile and its effect on forage production and animal metabolism. Soil Use Manag. 2006, 22, 95–101. [Google Scholar] [CrossRef]
- Byrne, S.L.; Foito, A.; Hedley, P.E.; Morris, J.A.; Stewart, D.; Barth, S. Early response mechanisms of perennial ryegrass (Lolium perenne) to phosphorus deficiency. Ann. Bot. 2011, 107, 243–254. [Google Scholar] [CrossRef] [Green Version]
- Mora, M.L.; Demanet, R.; Vistoso, E.; Gallardo, F. Influence of sulfate concentration in mineral solution on ryegrass grown at different pH and aluminum levels. J. Plant Nutr. 2005, 28, 1117–1132. [Google Scholar] [CrossRef]
- Parra-Almuna, L.; Diaz-Cortez, A.; Ferrol, N.; de la Luz Mora, M. Aluminium toxicity and phosphate deficiency activates antioxidant systems and up-regulates expression of phosphate transporters gene in ryegrass (Lolium perenne L.) plants. Plant Physiol. Biochem. 2018, 130, 445–454. [Google Scholar] [CrossRef] [PubMed]
- López-Arredondo, D.L.; Leyva-González, M.A.; González-Morales, S.I.; López-Bucio, J.; Herrera-Estrella, L. Phosphate Nutrition: Improving Low-Phosphate Tolerance in Crops. Annu. Rev. Plant Biol. 2014, 65, 95–123. [Google Scholar] [CrossRef]
- Bilal, H.M.; Aziz, T.; Maqsood, M.A.; Farooq, M.; Yan, G. Categorization of wheat genotypes for phosphorus efficiency. PLoS ONE 2018, 13, e0205471. [Google Scholar] [CrossRef] [Green Version]
- Iqbal, A.; Gui, H.; Zhang, H.; Wang, X.; Pang, N.; Dong, Q.; Song, M. Genotypic variation in cotton genotypes for phosphorus-use efficiency. Agronomy 2019, 9, 689. [Google Scholar] [CrossRef] [Green Version]
- Wacker-Fester, K.; Uptmoor, R.; Pfahler, V.; Dehmer, K.J.; Bachmann-Pfabe, S.; Kavka, M. Genotype-Specific Differences in Phosphorus Efficiency of Potato (Solanum tuberosum L.). Front. Plant Sci. 2019, 10, 1029. [Google Scholar] [CrossRef] [Green Version]
- Su, J.Y.; Zheng, Q.; Li, H.W.; Li, B.; Jing, R.L.; Tong, Y.P.; Li, Z.S. Detection of QTLs for phosphorus use efficiency in relation to agronomic performance of wheat grown under phosphorus sufficient and limited conditions. Plant Sci. 2009, 176, 824–836. [Google Scholar] [CrossRef]
- Rose, T.J.; Mori, A.; Julia, C.C.; Wissuwa, M. Screening for internal phosphorus utilisation efficiency: Comparison of genotypes at equal shoot P content is critical. Plant Soil 2016, 401, 79–91. [Google Scholar] [CrossRef]
- Veneklaas, E.J.; Lambers, H.; Bragg, J.; Finnegan, P.M.; Lovelock, C.E.; Plaxton, W.C.; Price, C.A.; Scheible, W.R.; Shane, M.W.; White, P.J.; et al. Opportunities for improving phosphorus-use efficiency in crop plants. New Phytol. 2012, 195, 306–320. [Google Scholar] [CrossRef]
- van de Wiel, C.C.M.; van der Linden, C.G.; Scholten, O.E. Improving phosphorus use efficiency in agriculture: Opportunities for breeding. Euphytica 2016, 207, 1–22. [Google Scholar] [CrossRef] [Green Version]
- Parra-Almuna, L.; Pontigo, S.; Larama, G.; Cumming, J.R.; Pérez-Tienda, J.; Ferrol, N.; de la Luz Mora, M. Expression analysis and functional characterization of two PHT1 family phosphate transporters in ryegrass. Planta 2020, 251, 6. [Google Scholar] [CrossRef] [PubMed]
- López-Arredondo, D.L.; Sánchez-Calderón, L.; Yong-Villalobos, L. Molecular and Genetic Basis of Plant Macronutrient Use Efficiency: Concepts, Opportunities, and Challenges; Elsevier Inc.: Amsterdam, The Netherlands, 2017; ISBN 9780128112946. [Google Scholar] [CrossRef]
- Ma, B.; Zhang, L.; Gao, Q.; Wang, J.; Li, X.; Wang, H.; Liu, Y.; Lin, H.; Liu, J.; Wang, X.; et al. A plasma membrane transporter coordinates phosphate reallocation and grain filling in cereals. Nat. Genet. 2021, 53, 906–915. [Google Scholar] [CrossRef]
- Ren, P.; Meng, Y.; Li, B.; Ma, X.; Si, E.; Lai, Y.; Wang, J.; Yao, L.; Yang, K.; Shang, X.; et al. Molecular Mechanisms of Acclimatization to Phosphorus Starvation and Recovery Underlying Full-Length Transcriptome Profiling in Barley (Hordeum vulgare L.). Front. Plant Sci. 2018, 9, 500. [Google Scholar] [CrossRef]
- Dissanayaka, D.M.S.B.; Ghahremani, M.; Siebers, M.; Wasaki, J.; Plaxton, W.C. Recent insights into the metabolic adaptations of phosphorus-deprived plants. J. Exp. Bot. 2021, 72, 199–223. [Google Scholar] [CrossRef] [PubMed]
- Plaxton, W.C.; Tran, H.T. Update on Metabolic Adaptations Metabolic Adaptations of Phosphate-Starved Plants. Plant Physiol. 2011, 156, 1006–1015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, D.; Zhu, H.; Liu, K.; Liu, X.; Leggewie, G.; Udvardi, M.; Wang, D. Purple acid phosphatases of Arabidopsis thaliana. Comparative analysis and differential regulation by phosphate deprivation. J. Biol. Chem. 2002, 277, 27772–27781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pang, X.; Cheng, Y.; Ruan, M.; Ye, Q.; Wang, R.; Yao, Z.; Zhou, G.; Wan, H. The PAP Gene Family in Tomato: Comprehensive Comparative Analysis, Phylogenetic Relationships and Expression Profiles. Plants 2022, 11, 563. [Google Scholar] [CrossRef]
- Mehra, P.; Pandey, B.K.; Giri, J. Improvement in phosphate acquisition and utilization by a secretory purple acid phosphatase (OsPAP21b) in rice. Plant Biotechnol. J. 2017, 15, 1054–1067. [Google Scholar] [CrossRef] [Green Version]
- González-Muñoz, E.; Avendaño, A.O.V.; Chávez Montes, R.A.; de Folter, S.; Andrés-Hernández, L.; Abreu-Goodger, C.; Sawers, R.J.H. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family. Front. Plant Sci. 2015, 6, 341. [Google Scholar] [CrossRef] [Green Version]
- Taylor, G.J.; Foy, C.D. Mechanisms of aluminum tolerance in Triticum aestivum (wheat). I. Differential pH induced by winter cultivars in nutrient solutions. Am. J. Bot. 1985, 72, 695–701. [Google Scholar] [CrossRef]
- Sadzawka, A.; Grez, R.; Carrasco, A.; Mora, M. Metodos de Analisis de Tejidos Vegetales; CNA Comisión de Normalización y Acreditacion, Sociedad Chilena de las Cincicas del Suelo: Santiago, Chile, 2004; p. 53. [Google Scholar]
- Siddiqi, M.Y.; Glass, A.D.M. Utilization index: A modified approach to the estimation and comparison of nutrient utilization efficiency in plants. J. Plant Nutr. 1981, 4, 289–302. [Google Scholar] [CrossRef]
- Venkatachalam, P.; Jain, A.; Sahi, S.; Raghothama, K. Molecular cloning and characterization of phosphate (Pi) responsive genes in Gulf ryegrass (Lolium multiflorum L.): A Pi hyperaccumulator. Plant Mol. Biol. 2009, 69, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Method 2001, 408, 402–408. [Google Scholar] [CrossRef] [PubMed]
Cultivar/P Treatment | 0.01 mM P | 0.1 mM P | 0.01 mM P | 0.1 mM P |
---|---|---|---|---|
Shoots | Roots | |||
P Concentration (g kg−1 DW) | ||||
Nui | 1.20 ± 0.02 Bd | 4.56 ± 0.31 Abc | 1.03 ± 0.11 Bb | 3.84 ± 0.33 Ac |
Expo | 1.22 ± 0.08 Bcd | 3.62 ± 0.19 Acd | 1.08 ± 0.14 Bb | 3.26 ± 0.29 Ac |
One50 | 1.29 ± 0.09 Bbcd | 5.68 ± 0.20 Aab | 1.13 ± 0.05 Bb | 4.37 ± 0.27 Aab |
Extreme | 0.84 ± 0.02 Be | 3.07 ± 0.01 Ad | 0.96 ± 0.09 Bbc | 3.55 ± 0.18 Ac |
24Seven | 0.77 ± 0.03 Be | 3.07 ± 0.13 Ad | 0.87 ± 0.02 Bc | 3.11 ± 0.03 Ac |
Hustle | 1.50 ± 0.02 Bb | 4.83 ± 0.15 Abc | 1.27 ± 0.02 Bb | 4.07 ± 0.16 Abc |
Stellar | 1.99 ± 0.07 Ba | 6.09 ± 0.37 Aa | 2.07 ± 0.09 Ba | 5.75 ± 0.55 Aab |
Ansa | 1.79 ± 0.08 Ba | 6.03 ± 0.52 Aa | 2.01 ± 0.10 Ba | 5.80 ± 0.68 Aa |
Abergreen | 1.48 ± 0.01 Bbc | 5.34 ± 0.20 Aab | 1.33 ± 0.05 Bb | 4.51 ± 0.10 Aab |
P content (mg pot−1) | ||||
Nui | 6.55 ± 0.07 Bab | 53.0 ± 3.15 Aa | 2.36 ± 0.22 Babc | 9.48 ± 0.80 Aa |
Expo | 6.78 ± 0.36 Ba | 42.9 ± 1.58 Ab | 2.63 ± 0.36 Bab | 7.62 ± 0.64 Aab |
One50 | 5.64 ± 0.33 Bbcd | 39.2 ± 2.30 Ab | 2.02 ± 0.09 Bbc | 4.93 ± 0.36 Acd |
Extreme | 4.80 ± 0.06 Bde | 35.9 ± 0.61 Abc | 3.20 ± 0.19 Ba | 9.87 ± 0.22 Aa |
24Seven | 4.52 ± 0.06 Be | 41.7 ± 1.34 Ab | 2.83 ± 0.03 Bab | 8.60 ± 0.58 Aab |
Hustle | 6.02 ± 0.11 Babc | 41.3 ± 1.69 Ab | 2.22 ± 0.12 Bbc | 6.12 ± 0.71 Abc |
Stellar | 5.61 ± 0.14 Bbcd | 27.7 ± 2.28 Acd | 1.77 ± 0.13 Bc | 4.18 ± 0.34 Acd |
Ansa | 5.27 ± 0.31 Bcde | 24.5 ± 1.73 Ad | 1.55 ± 0.05 Bc | 3.12 ± 0.35 Ad |
Abergreen | 5.07 ± 0.08 Bcde | 37.1 ± 1.39 Abc | 1.75 ± 0.05 Bc | 4.79 ± 0.24 Acd |
Gene Name | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
LpPHT1;1 | CCT GGG ATT GCT TTC TCA C | TGG TTG CGT CAT CGT CAT AG |
LpPHT1;4 | AAC CAG CGT ACC AGG ACA AC | GAG GAT GAT GCG CCA GAC |
LpPHO1;2 | TGTTCTACCGCTCAACACGG | AGTAGCACGCTGTAAACTCCA |
LpPAP1 | CCTTGGTTGATCGTCCTGAT | TGGCTCATACATCACCCTCA |
LpeEF1α(h) | ATG TCT GTT GAG CAG CCT TC | GCG GAG TAT ATA AAG GGG TAGC |
LpeEF1α(s) | CCG TTT TGT CGA GTT TGG T | AGC AAC TGT AAC CGA ACA TAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pontigo, S.; Parra-Almuna, L.; Luengo-Escobar, A.; Poblete-Grant, P.; Nunes-Nesi, A.; Mora, M.d.l.L.; Cartes, P. Biochemical and Molecular Responses Underlying the Contrasting Phosphorus Use Efficiency in Ryegrass Cultivars. Plants 2023, 12, 1224. https://doi.org/10.3390/plants12061224
Pontigo S, Parra-Almuna L, Luengo-Escobar A, Poblete-Grant P, Nunes-Nesi A, Mora MdlL, Cartes P. Biochemical and Molecular Responses Underlying the Contrasting Phosphorus Use Efficiency in Ryegrass Cultivars. Plants. 2023; 12(6):1224. https://doi.org/10.3390/plants12061224
Chicago/Turabian StylePontigo, Sofía, Leyla Parra-Almuna, Ana Luengo-Escobar, Patricia Poblete-Grant, Adriano Nunes-Nesi, María de la Luz Mora, and Paula Cartes. 2023. "Biochemical and Molecular Responses Underlying the Contrasting Phosphorus Use Efficiency in Ryegrass Cultivars" Plants 12, no. 6: 1224. https://doi.org/10.3390/plants12061224