Next Article in Journal
Application of Open Panicle Traits in Improving the Filling Characteristics at the Base of Indica Rice Panicles
Previous Article in Journal
TkJAZs-TkMYC2-TkSRPP/REF Regulates the Biosynthesis of Natural Rubber in Taraxacum kok-saghyz
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 15
10.3390/plants13152033
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Analysis of PPO Gene Family Members in Paulownia fortunei

by
Zhenli Zhao
1,2,†,
Fei Wang
1,2,†,
Minjie Deng
1,2 and
Guoqiang Fan
1,2,*
1
College of Forestry, Henan Agricultural University, Zhengzhou 450002, China
2
Institute of Paulownia, Henan Agricultural University, Zhengzhou 450002, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2024, 13(15), 2033; https://doi.org/10.3390/plants13152033
Submission received: 27 June 2024 / Accepted: 18 July 2024 / Published: 24 July 2024
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)
Browse Figures
Versions Notes

Abstract

:
Polyphenol oxidase (PPO) is a common metalloproteinase in plants with important roles in plant responses to abiotic and biotic stresses. There is evidence that PPOs contribute to stress responses in Paulownia fortunei. In this study, PPO gene family members in P. fortunei were comprehensively identified and characterized using bioinformatics methods as well as analyses of phylogenetic relationships, gene and protein structure, codon usage bias, and gene expression in response to stress. The genome contained 10 PPO gene family members encoding 406–593 amino acids, with a G/C bias. Most were localized in chloroplasts. The motif structure was conserved among family members, and α-helices and random coils were the dominant elements in the secondary structure. The promoters contained many cis-acting elements, such as auxin, gibberellin, salicylic acid, abscisic acid, and photoresponsive elements. The formation of genes in this family was linked to evolutionary events, such as fragment replication. Real-time quantitative PCR results showed that PfPPO7, PfPPO10, PfPPO1, PfPPO2, PfPPO3, PfPPO4, PfPPO5, and PfPPO8 may be key genes in drought stress resistance. PfPPO1, PfPPO3, PfPPO4, and PfPPO10 were resistant stress-sensitive genes. These results provide a reliable basis for fully understanding the potential functions of these genes and the selection of resistance breeding.

1. Introduction

Polyphenol oxidase (PPO) is a kind of metalloproteinase combined with copper ions that is commonly found in plants, bacteria, and fungi [1]. The PPO protein is generally composed of an N-terminal catalytic domain, PPO1_DWL domain, and PPO1_KFDV domain [2,3]. PPO1_DWL is a conserved sequence motif with a length of about 50 amino acids; this domain is critical for polyphenol oxidase activity [4]. The tyrosinase domain is about 210 amino acids, including CuA and CuB binding regions [5]. The PPO gene family includes seven PPO genes in tomato [6], three PPO genes in chestnut [7], and nine PPO genes of potato [8].
In plants, PPO catalyzes the oxidation of monophenol and resorcinol compounds to produce obenzoquinone, which is accompanied by oxygen reduction to water to produce brown-black pigments and protein complexes [9]. As a reactive oxygen species scavenger, PPO activity is an important indicator of plant stress resistance [10]. For example, cold injury can increase the expression of PINPPO1 and PINPPO2 in pineapple tissues [11]. Drought significantly induces PtrPPO 9/13 and inhibits PtrPPO 11/14/15 in poplar [12]. In strawberry, FaPPO1 and FaPPO2 gene expression levels are regulated by low temperature, abiotic stress (including NaCl and H2O2), and biotic stress (e.g., powdery mildew and gray mold) [13].
PPO contributes to plant defense responses via the production of quinones [14] or by catalyzing lignin to form protective shielding [15]. In tomato (PPOF), pineapple (PINPPO1), and soybean (GmaPPO12), PPOs increase resistance to fungi [12,16,17]. PPO gene family members in tobacco and Salvia miltiorrhiza are highly responsive to methyl jasmonate (MeJA) [18,19]. Antisense PPO gene expression in tomato can negatively regulate members of the gene family and produce hypersensitivity to pathogens [20]. The successful transfer of exogenous PPO into apple and potato explants significantly improves disease resistance [21]. PtrPPO13 expression is significantly up-regulated when poplar is injured or infected with pathogens [22].
Paulownia fortunei is native to China and plays important roles in wood production as well as farmland and environmental protection [23]. Owing to its economic and ecological value, it has been introduced into many countries [24,25]. The species is susceptible to phytoplasma infection during its growth and development, resulting in a large number of clumps of indefinite buds, thereby reducing the yield and quality of Paulownia wood substantially. In view of the large differences in PPO genes between Paulownia and other species found in our previous studies of stress-related genes, we hypothesized that PPO activity contributes to the response to stress [26]. Therefore, in this study, PPO gene family members were identified from the whole genome sequence of P. fortunei, followed by analyses of sequence characteristics, phylogenetic relationships, and expression patterns under stress. Genes related to abiotic stress were screened to provide a theoretical basis for revealing the functions of PPO family members in P. fortunei.

2. Results

2.1. Identification of PPO Gene Family Members in P. fortunei and Analysis of Physicochemical Properties

Ten PPO genes were identified using Pfam, HMMER, BLAST, and NCBI-CDD; they were named PfPPO1 to PfPPO10 according to their positions on the genome (Figure 1).
The physical and chemical properties of PfPPO proteins were analyzed using ProtParam. As shown in Table 1, among the 10 PfPPOs, PfPPO10 was the shortest (406 amino acids) and PfPPO8 was the longest (593 amino acids). The molecular weights of PfPPOs ranged from 44.959 to 66.677kDa. The isoelectric points (pI) ranged from 5.68 to 9.15, and the pI values for seven PfPPOs were lower than 7.00, indicating that most family members were acidic. The hydrophilicity of PfPPOs ranged from −0.533 to −0.357, indicating that all proteins in this family are hydrophilic.
The proteins encoded by the 10 PfPPOs were not predicted to contain signal peptides and belonged to non-secreted proteins, which do not enter the endoplasmic reticulum and Golgi secretion pathway after synthesis and are released directly into the cytoplasm. With the exception of PfPPO5 and PfPPO7, the other eight proteins contained chloroplast transport peptides. With the exception of PfPPO9, the other nine family members are likely to have a transmembrane region. According to the above results and a subcellular localization analysis, PfPPO5 was localized in the peroxisome, PfPPO9 was located in the cytoplasm, and the other eight proteins were located in chloroplasts. This indicates that PfPPOs mainly function in chloroplasts, consistent with the results of subcellular localization analyses of the family in other species [27].

2.2. Analyses of Conserved Motifs and Gene Structure

To study the structural characteristics of PPO gene family members of P. fortunei, the domain, conserved motif, and secondary structure were analyzed. Motif analyses (Figure 2a) revealed that all family members had motif1, motif2, motif5, and motif6, indicating that these four motifs were relatively conserved in the evolution of the PPO gene family. The high frequency of the motif structure motif10, motif9, motif8, motif6, motif2, motif1, motif5, motif4, motif3, and motif7 may be related to gene functions. Among the 10 motifs, only motif1, motif2, motif5, and motif6 were detected in all PfPPOs, indicating that these four motifs were the most highly conserved.
By analyzing the CDD of NCBI, the conserved domains of the amino acid sequences of PfPPOs were obtained (Figure 2b). All proteins contained the PPO1_DWL (PF12142.11) domain, except PfPPO10. All except PfPPO9 and PfPPO10 contained the tyrosinase (PF00264.23) domain, and all except PfPPO6 and PfPPO10 contained the PPO1_KFDV (PF12143.11) domain.
The secondary structure provides insight into protein function. The SOPMA online database was used to predict the secondary structures of 10 PfPPO proteins. The secondary structures of PfPPOs mainly included α-helices (17.24–23.51%) and random coils (55.31–62.32%), with relatively small frequencies of extended chains and β-turns (Figure 3). The α-helix in PfPPOs may contain the active site, and the β-fold contains sites for interactions with the catalytic substrate or inactivation [28].

2.3. Analysis of PPO Gene Codon Preference in P. fortunei

CUSP and CodonW1.4.4 were used to analyze the base content in the PPO gene coding region of P. fortunei. As shown in Table 2, the average GC content of three codon positions in PfPPOs’ gene was 52.01%. The average values for GC1, GC2, and GC3 were 50.37%, 48.65%, and 54.80%, respectively, revealing differences between GC1 and GC2 (with values similar to the average GC value across all sites) and GC3. The codon ENC in A/T-ending codons is a new index of bias [29]. The G and C contents of PfPPO6, PfPPO8, and PfPPO10 were higher than the A and U contents, while the opposite pattern was observed for the other six genes. The GC and GC3s values for PfPPO1, PfPPO7, and PfPPO9 were all lower than 50%, indicating a general preference for codons ending in G/C.
CodonW1.4.4 was used to calculate the relative codon usage in the PPO gene family. As shown in Table 3, the most commonly encoded amino acid was leucine (Leu) (463 codons or 8.25% of the total codons), followed by proline (Pro) (424 codons or 7.56% of the total codons). However, the fewest codons encoded tryptophane (Trp) (i.e., 85 codons). In the PPO gene family, 31 codons had RSCU values greater than 1, indicating a high frequency, and most of these ended in G and C. The RSCU values of UUG, GUG, UGA, and AGG were greater than 1.5, indicating a strong preference. Among these, the RSCU values of UUG and UGA were 1.80, and their codon usage frequency was the highest, indicating the strongest preference for these three codons.

2.4. Gene Structure and Promoter Element Prediction of PPO Gene Family Members of P. fortunei

The gene structures of 10 PfPPOs were analyzed using GSDS software (http://gsds.cbi.pku.edu.cn/ (accessed on 28 September 2022)). Six PfPPO genes had no introns (Figure 4b). The remaining four contained one or two introns; however, these were much shorter than the exons. Six genes had no non-coding region, two genes had non-coding regions at both the 5′ and 3′ ends, and two genes had non-coding regions only at the 3′ end. These results indicated that the PPO genes of P. fortunei show substantial diversification.
The sequences 2000 bp upstream of 10 PfPPOs were analyzed using PlantCARE. We found that photoresponsive elements and hormone elements were widely present in P. fortunei PPO family members. Additionally, there were many cis-acting elements that respond to hormones (abscisic acid, salicylic acid, gibberellin, auxin, and photoallergens) and abiotic stress (low temperature) as well as those related to anaerobic induction, defense and stress responses, metabolic regulation, meristem expression, endosperm expression, heterologous regulation and circadian control, protein binding sites, and α-amylase promoters (Figure 4a and Figure 5). Various cis-acting elements were unevenly distributed across PfPPOs; for example, auxin-related elements were only present in the promoters of two genes, while salicylic acid-related elements were present in the promoters of six genes.

2.5. Collinearity and Phylogenetic Analyses of the PPO Family

Phylogenetic trees were constructed based on amino acid sequences of 10 family members of P. fortunei as well as Populus trichocarpa, Oryza sativa L., Capsicum annuum, Glycine max, Triticum aestivum, Zea mays, and Malus domestica (Figure 6). PfPPO1 and CaPPO1 were closely related, and PfPPO6 was closely related to CaPPO8 and CaPPO9. The PPO gene family in P. fortunei was closely related to the PPO gene family in pepper.
A collinearity analysis showed that PfPPO2/3/4/5/6 on chromosome 9 and PfPPO8/9/10 on chromosome 16 formed two tandem repeat regions. The high sequence similarity between the duplicate gene pairs suggested that they are involved in regulating similar biological processes. We also found that two genes (PfPPO2 and PfPPO8) were fragmented repeats. These results suggest that PfPPOs expanded by gene duplication, and tandem duplication is the main driving force for the formation of the PPO gene family in P. fortunei (Figure 7).

2.6. Tissue Expression Analysis of PPO Gene Family Members of P. fortunei

The genes showed differences in expression among tissues (Figure 8). The expression levels of PfPPO1, PfPPO3, PfPPO4, PfPPO6, and PfPPO8 were highest in the root; PfPPO2, PfPPO5, PfPPO7, and PfPPO9 were highest in the stem; and PfPPO10 was highest in the bud.In addition, the expression levels of different genes varied within the same tissue. In the root, the expression of PfPPO4 was the highest, and PfPPO7 and PfPPO9 were nearly undetectable. In the bud, the expression of PfPPO10 was the highest, and PfPPO7 was nearly undetectable. The expression of PfPPO2 was the highest in both stems and leaves.

2.7. Effects of Witches’ Broom on Gene Expression in P. fortunei

To understand the roles of PPO gene family members in the pathogenesis of Paulownia witches’ broom, qRT-PCR was used to evaluate expression levels in different organs of infected seedlings (Figure 8). Compared with expression levels in healthy seedlings, the expression levels of PfPPO1 and PfPPO3 in the root were significantly lower and the expression levels of PfPPO4 and PfPPO6 were slightly lower in infected plants, while the expression levels of other genes did not differ significantly between infected and healthy plants. In the stem, all members showed variable decreases in expression. In leaves, PfPPO3, PfPPO4, and PfPPO7 were up-regulated and showed the greatest expression changes. PfPPO10 showed the most significant expression change in the bud. Overall, PfPPO1, PfPPO3, PfPPO4, and PfPPO10 are the four PPO gene family members that respond positively to arbusardosis.

2.8. Responses of PPO Genes to Drought Stress in P. fortunei

PPO as an antioxidant enzyme contributes to plant responses to abiotic stress [30]. Therefore, we evaluated the expression changes in PPO family members in P. fortunei before and after drought stress. As shown in Figure 9, except for PfPPO9, significant changes were found in the expression of the other nine family members, including highly significant changes in levels of PfPPO1, PfPPO4, PfPPO5, and PfPPO7 under drought stress. In terms of trends, PfPPO7, PfPPO9, and PfPPO10 expressions were significantly higher and the other seven expressions decreased compared to the untreated samples. Three genes (PfPPO1, PfPPO3, and PfPPO4) that were up-regulated in the pathogenesis of witches’ broom were down-regulated in response to drought stress, suggesting that members of the PPO family have different functions in response to biotic and abiotic stresses.

3. Discussion

PPOs are copper-containing enzymes that function as antioxidants and contribute to plant defense. In this study, 10 PfPPO genes were identified in P. fortunei using bioinformatics methods, with evidence for duplication events in the evolution of the gene family. Most encoded hydrophilic weakly acidic proteins, and the secondary structures, were dominated by α-helices and irregular coils. Localization was mainly in chloroplasts. All family members contained highly conserved motifs and domains. The hormone response elements showed uneven distributions in PPO gene family promoter sequences. These family members showed different responses to phytoplasma infection and drought, suggesting both conserved and divergent functions [31].
Recent studies have identified 18, 7, 12, 9, and 13 PPO genes in poplar, tomato, tobacco, potato, and wheat, respectively [6,12,20,27,32,33], compared with 10 PPO gene family members in the genome of P. fortunei. Other antioxidant enzyme gene families have fewer family members. For example, there are two CAT family genes in barley [34]; three CAT genes in Arabidopsis, rice, and maize [35,36,37]; four CAT genes in cucumber and soybean [38,39]; and seven in cotton and tobacco [40,41]. There are 15, 6, 9, and 18 SOD genes in pepper, corn, Arabidopsis, and tobacco, respectively [42,43,44,45], and 15 SOD genes in potato, tomato, and cucumber [46,47,48]. There are also some larger transcription factor families in plants. For example, the bZIP gene family has 89, 78, and 54 members in P. fortunei, Arabidopsis, and cayenne pepper [49,50,51]. The MYB gene family has 138, 152, 192, and 463 genes in P. fortunei, poplar, Arabidopsis, and soybean, respectively [52,53,54,55]. The number of gene family members is commensurate with its evolution, structure, and function, with relatively high numbers of genes in functionally diverse gene families.
Plant PPOs could be divided into four classes. PfPPOs were assigned to the second, third, and fourth categories, among which PfPPO1 belonged to the second class. Most PfPPOs (PfPPO2 to PfPPO5 and PfPPO7 to PfPPO10) are in the third class, and PfPPO6 is in the fourth class. PPOs of the dicotyledonous plants Capsicum and apple are distributed in these three classes; PPOs of monocotyledonous wheat and maize belong to the first and second classes, and those of monocotyledonous rice belong to the third class. PPO families of each species are more likely to be closely related, indicating that PPO gene families show relatively low conservation. However, we found that PfPPO1 and CaPPO1 were closely related, and PfPPO6 was closely related to CaPPO8 and CaPPO9. Broadly, the PPO gene family in P. fortunei was most closely related to the PPO gene family in pepper.
Under drought stress, PPO gene activity in Populus trichocarpa is induced or inhibited to some extent [12]. A transcriptome analysis of P. fortunei showed that the expression levels of PfPPO7 and PfPPO10 were significantly higher, while the expression levels of PfPPO1, PfPPO2, PfPPO3, PfPPO4, PfPPO5, and PfPPO8 were significantly lower after drought stress than without drought stress, similar to results in poplar. In Malus domestica sprouts, PPO gene activity is altered by infection with pathogens [21]. In P. fortunei, PfPPO1, PfPPO3, PfPPO4, and PfPPO10 showed expression changes in response to witches’ broom, suggesting that these four genes contribute to disease resistance. At the same time, three genes (PfPPO1, PfPPO3, and PfPPO4) were up-regulated in witches’ broom and down-regulated in response to drought stress, suggesting that genes in the family may have different functions in response to biotic and abiotic stresses.

4. Materials and Methods

4.1. Plant Materials

We selected for the Henan Agricultural University tung biotechnology laboratory diploid healthy P. fortunei seedlings (PF), PaWB-infected P. fortune seedlings (PFI), and drought-treated P. fortunei seedlings (PFT; soil relative water content for field water at more than 80% for the control group, the soil relative water content for field water at about 50% for drought stress treatment group; drought stress after 15 d; collect different treatment groups of root, stem, leaf, and top bud). Among them, the culture method of healthy seedlings and PaWB-infected seedlings followed Cao et al.’s method [56]. The drought-treated seedlings were watered regularly every day, the control group supplied 100 mL normally, and the drought stress-treated group supplied 50 mL water. The culture temperature was (25 ± 2) °C, the light intensity was 130 μmol m−2s−1, and the light cycle was 16 h/8 h (light/dark). When histculture seedlings grew to 30 d, the roots, stems, leaves, and top buds of different groups were taken. After sampling, all samples were immediately flash-frozen with liquid nitrogen and stored in an ultra-low-temperature refrigerator at −80 °C.

4.2. P. fortunei PPO Gene Family Identification and Physicochemical Analyses

Genomic data for P. fortunei were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/ (accessed on 15 September 2022)) to identify the PfPPO gene family. The hidden Markov model files for domains PPO-1(PF00264.23), PPO-2 (PF12142.11), and PPO-3 (PF12143.11) were downloaded from the Pfam database as seed sequences. HMMER3.0 was used to search all protein sequence files of P. fortunei (E-value < 0.001) [57], and candidate members of the PfPPO gene family were obtained. Then, the Ensembl Plants website (https://plants.ensembl.org/index.html (accessed on 15 July 2022)) was used to obtain PPO amino acid sequences for Populus trichocarpa, Oryza sativa, and Nicotiana tabacum. The query sequences were compared with the amino acid sequence file for P. fortunei (E-value < 0.001), and candidate members of the PfPPO gene family were obtained. After the two results were merged to remove redundant sequences, the NCBI-CDD online tool (https://www.ncbi.nlm.nih.gov/cdd/?term= (accessed on 25 June 2022)) was used for PPO domain validation, and members of the PfPPO gene family were finally identified. They were named according to their chromosomal sequence. TBtools (V 1.09868) [58] was used to draw the distribution of PPO gene family members on chromosomes, using default parameters.
EXPASY (httos://www.expasy.org/protparam/ (accessed on 27 June 2022)) was used to predict physical and chemical properties. CELLO (CELLO v.2.5) and WoLF PSORT (https://www.genscript.com/wolf-psort.html (accessed on 17 August 2022)) were used to predict the subcellular localization of members of the PfPPO gene family.

4.3. Analysis of Signal Peptides and Transmembrane Domains of PPO Family Members of P. fortunei

Chloroplast transport peptides from 10 PfPPOs were predicted using the Ipsort Server (https://ipsort.hgc.jp/ (accessed on 17 June 2022)).
SignalP 6.0 Server (https://services.healthtech.dtu.dk/services/SignalP-4.1/ (accessed on 17 August 2022)) was used to predict amino acid sequences. Signal peptide analyses were performed according to the default neural network method and hidden Markov models.
TMHMM Server v. 2.0 (https://services.healthtech.dtu.dk/services/TMHMM-2.0/ (accessed on 24 September 2022)) was used to predict membrane proteins and related domains.

4.4. Prediction of PPO Gene Family Domains

MEME online software (http://meme-suite.org/tools/meme (accessed on 25 September 2022)) was used for a motif analysis of the amino acid sequence of PPO gene family members of P. fortunei. The motif number was set to 10. Then, TBtools was used for a visual analysis of motifs.
Conserved domains were analyzed using CDD (Conserved Domain Database) and the results were visualized using TBtools.
SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html (accessed on 25 September 2022)) was used to predict the secondary structure of PPO proteins in P. fortunei.

4.5. Codon Usage Characteristics

EMBOSS CUSP (http://emboss.sourceforge.net/ (accessed on 26 September 2022)) was used to calculate GC contents at the first (GC1), second (GC2), and third bases (GC3) of codons as well as the average value of GC1 and GC2 (GC). The effective number of codons (ENC) was calculated using GHIPS. Relative synonymous codon usage (RSCU) was analyzed using CodonW1.4.4.

4.6. Gene Structure and Cis-Regulatory Element Analyses of PPO Gene Family Members

Based on the reported CDS sequence, the full-length gene file was obtained using activestate (https://www.activestate.com/ (accessed on 28 September 2022)) and GSDS (http://gsds.cbi.pku.edu.cn/ (accessed on 28 September 2022)). A structure map of the PPO family gene of P. fortunei was drawn.
Sequence information for the region 2000 bp upstream of PfPPO genes was extracted. The PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantc-are/html/ (accessed on 11 October 2022)) was used to predict the roles of cisregulatory elements and TBtools was used to visualize the results.

4.7. Phylogenetic and Collinearity Analyses of the PPO Gene Family

A phylogeny of the PPO gene family in P. fortune, Populus trichocarpa, Oryza sativa, Capsicum annuum, Glycine max, Triticum aestivum, and Zea mays was reconstructed with the neighbor-joining method using MEGA-X 10.2 (Method, NJ; Bootstrap, 1000). And, the evolutionary tree of the PPO proteins was modified using the iTOL (https://itol.embl.de/ (accessed on 20 August 2022)) online website.
The local BLAST program was used to compare the protein sequences of PPO gene family members, and collinearity was evaluated (Evalue < −10). Use the online software MCScanX program to obtain the collinear file, and use the circle_plotter tool to visualize the result.

4.8. Analysis of Gene Expression in PPO Family Members of P. fortunei

Total RNA was extracted from the roots, stems, leaves, and top buds of PF, PFI seedlings, and leaves of PFT using a plant RNA extraction kit (Tiangen Biotech Co., Beijing, China). PfActin was used as the internal control. The reaction system and procedure followed those described by Cao et al. [56]. A real-time quantitative polymerase chain reaction (qRT-PCR) was used to evaluate PfPPO gene expression in different tissue parts of 10 healthy P. fortunei seedlings (Table 4). Relative gene expression was evaluated using the 2−ΔΔCT method, with three biological replicates per sample. GraphPad Prism was used for analyses, and Primer-BLAST was used for primer design (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 22 August 2022)).

4.9. Statistical Analysis

All results were collected from three parallel experiments. Data were compared with the control group or between treatments, by using the analysis ofvariance (ANOVA) and Duncan’s multiple range test with significant differences; for the Student’s t-test, * p< 0.05. Graphs were plotted using GraphPad Prism 8.0.

5. Conclusions

In summary, the P. fortunei genome includes 10 members of the PfPPO gene family. Similar to the gene family in other plants, PfPPO gene family members participate in multiple biological processes in P. fortunei. A transcriptome analysis showed that PPO gene expression is tissue-specific, and the same gene may have different functions in response to biotic and abiotic stresses. Specific gene functions need to be verified using transgenic plants. These results provide an important basis for breeding new varieties resistant to biotic and abiotic stresses.

Author Contributions

G.F. conceived and designed the experiments; Z.Z. and F.W. performed the experiments and wrote the paper; M.D. contributed reagents and analyzed the data. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Academic Scientist Fund for Zhongyuan Scholars of Henan Province (grant [99]), The Joint Fund of Science and technology R & D Program of Henan Province (222103810007), Expansion and Cultivation Technology Demonstration and Promotion of Excellent New Varieties of Paulownia (No. GTH[2022]16), and National Key Research and Development Program (Grant No. 2016YFD0600106).

Data Availability Statement

Data are contained within the article.

Acknowledgments

We appreciate the reviewers’ and editors’ diligent reading of and constructive criticism on this work.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, W.; Shen, Y.; Li, Z.; Xie, X.; Gong, E.S.; Tian, J.; Si, X.; Wang, Y.; Gao, N.; Shu, C.; et al. Effects of high hydrostatic pressure and thermal processing on anthocyanin content, polyphenol oxidase and beta-glucosidase activities, color, and antioxidant activities of blueberry (Vaccinium spp.) puree. Food Chem. 2020, 342, 128564. [Google Scholar] [CrossRef] [PubMed]
  2. Stenico, M.; Lloyd, A.T.; Sharp, P.M. Codon usage in Caenorhabditis elegans: Delineation of translational selection and mutational biases. Nucleic Acids Res. 1994, 22, 2437–2446. [Google Scholar] [CrossRef] [PubMed]
  3. Xiao, K.; Liu, X.; Zhang, A.; Zha, D.; Zhu, W.; Tan, F.; Huang, Q.; Zhou, Y.; Zhang, M.; Li, J.; et al. Genome-wide identification of polyphenol oxidase (PPO) family members in eggplant (Solanum melongena L.) and their expression in response to low temperature. Hortic. Environ. Biotechnol. 2022, 63, 747–758. [Google Scholar] [CrossRef]
  4. Zhang, J.; Chi, M.; Yu, X.; Wang, Y.; Li, E.; Liu, H.; Ma, R. Isolation and Identification of a Novel StuPPO9 Gene from Potato Polyphenol Oxidase and Its Genetic Transformation of Overexpression Tobacco. Food Res. Dev. 2020, 41, 165–171. [Google Scholar]
  5. Rong, X.; Lai, Z.; Lin, Y.; Liu, S.; Lai, G.; Chen, Y.; Zhang, Z. Cloning and Expression of Polyphenol Oxidase (PPO) Gene During Different Process of Preservation in in vitro Chinese Olive (Canarium album). Chin. J. Trop. Crops 2014, 35, 738–745. [Google Scholar]
  6. Newman, S.M.; Eannetta, N.T.; Yu, H.; Prince, J.P.; de Vicente, M.C.; Tanksley, S.D.; Steffens, J.C. Organisation of the tomato polyphenol oxidase gene family. Plant Mol. Biol. 1993, 21, 1053–1058. [Google Scholar] [CrossRef] [PubMed]
  7. Cheng, L.L.; Cheng, Y.H.; Cao, Q.C.; Hu, G.L.; Lan, Y.P. Identification and bioinformatics analysis of PPO gene family in Chinese chestnut (Castanea mollissima). J. Fruit Sci. 2020, 37, 1305–1313. [Google Scholar]
  8. Chi, M.; Bhagwat, B.; Lane, W.D.; Tang, G.; Su, Y.; Sun, R.; Oomah, B.D.; Wiersma, P.A.; Xiang, Y. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs. BMC Plant Biol. 2014, 14, 62. [Google Scholar] [CrossRef]
  9. Shepherd, L.V.; Alexander, C.J.; Hackett, C.A.; McRae, D.; Sungurtas, J.A.; Verrall, S.R.; Morris, J.A.; Hedley, P.E.; Rockhold, D.; Belknap, W.; et al. Impacts on the metabolome of down-regulating polyphenol oxidase in potato tubers. Transgenic Res. 2015, 24, 447–461. [Google Scholar] [CrossRef]
  10. Muthukumarasamy, M.; Gupta, D.S.; Panneerselvam, R. Enhancement of Peroxidase, Polyphenol Oxidase and Superoxide Dismutase Activities by Triadimefon in NaCl Stressed Raphanus Sativus L. Biol. Plant. 2000, 43, 317–320. [Google Scholar] [CrossRef]
  11. Stewart, R.J.; Sawyer, B.J.B.; Bucheli, C.S.; Robinson, S.P. Polyphenol oxidase is induced by chilling and wounding in pineapple. Funct. Plant Biol. 2001, 28, 181–191. [Google Scholar] [CrossRef]
  12. He, F.; Shi, Y.J.; Zhao, Q.; Zhao, K.J.; Cui, X.L.; Chen, L.H.; Yang, H.B.; Zhang, F.; Mi, J.X.; Huang, J.L.; et al. Genome-wide investigation and expression profiling of polyphenol oxidase (PPO) family genes uncover likely functions in organ development and stress responses in Populus trichocarpa. BMC Genom. 2021, 22, 731. [Google Scholar] [CrossRef] [PubMed]
  13. Jia, H.; Zhao, P.; Wang, B.; Tariq, P.; Zhao, F.; Zhao, M.; Fang, J. Overexpression of Polyphenol Oxidase Gene in Strawberry Fruit Delays the Fungus Infection Process. Plant Mol. Biol. Report. 2016, 34, 592–606. [Google Scholar] [CrossRef]
  14. Fuerst, E.P.; Okubara, P.A.; Anderson, J.V.; Morris, C.F. Polyphenol oxidase as a biochemical seed defense mechanism. Front. Plant Sci. 2014, 5, 689. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, G.D.; Huang, C.N.; Wu, W.L.; Bu, X.J.; Zheng, D.H. Defense Enzyme Activities and the Resistance to Northern Leaf Blight of Different Hybrids in Maize. J. Maize Sci. 2014, 22, 146–152. [Google Scholar]
  16. Thipyapong, P.; Steffens, J.C. Tomato Polyphenol Oxidase (Differential Response of the Polyphenol Oxidase F Promoter to Injuries and Wound Signals). Plant Physiol. 1997, 115, 409–418. [Google Scholar] [CrossRef]
  17. Chai, C.; Lin, Y.; Shen, D.; Wu, Y.; Li, H.; Dou, D. Identification and functional characterization of the soybean GmaPPO12 promoter conferring Phytophthora sojae induced expression. PLoS ONE 2013, 8, e67670. [Google Scholar] [CrossRef]
  18. Cai, Y.; Dong, Z.; Zhao, S.; Han, Y.; Shao, Y.; Lu, M.; Qin, H.; Liu, X.; Wang, D.; Chen, Y. Genome-wide analysis of polyphenol oxidase genes and their transcriptional patterns during grain development in Sorghum. Int. J. Plant Sci. 2013, 174, 10–21. [Google Scholar] [CrossRef]
  19. Li, C.; Li, D.; Li, J.; Shao, F.; Lu, S. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza. Sci. Rep. 2017, 7, 44622. [Google Scholar] [CrossRef] [PubMed]
  20. Wang, Z.; Wang, M.; Liu, L.; Meng, F. Physiological and proteomic responses of diploid and tetraploid black locust (Robinia pseudoacacia L.) subjected to salt stress. Int. J. Mol. Sci. 2013, 14, 20299–20325. [Google Scholar] [CrossRef]
  21. Murata, M.; Haruta, M.; Murai, N.; Tanikawa, N.; Nishimura, M.; Homma, S.; Itoh, Y. Transgenic apple (Malus x domestica) shoot showing low browning potential. J. Agric. Food Chem. 2000, 48, 5243–5248. [Google Scholar] [CrossRef] [PubMed]
  22. Tran, L.T.; Constabel, C.P. The polyphenol oxidase gene family in poplar: Phylogeny, differential expression and identification of a novel, vacuolar isoform. Planta 2011, 234, 799–813. [Google Scholar] [CrossRef] [PubMed]
  23. Barbu, M.C.; Radauer, H.; Petutschnigg, A.; Tudor, E.M.; Kathriner, M. Lightweight Solid Wood Panels Made of Paulownia Plantation Wood. Appl. Sci. 2023, 13, 11234. [Google Scholar] [CrossRef]
  24. Doumett, S.; Lamperi, L.; Checchini, L.; Azzarello, E.; Mugnai, S.; Mancuso, S.; Petruzzelli, G.; Del Bubba, M. Heavy metal distribution between contaminated soil and Paulownia tomentosa, in a pilot-scale assisted phytoremediation study: Influence of different complexing agents. Chemosphere 2008, 72, 1481–1490. [Google Scholar] [CrossRef] [PubMed]
  25. Kang, K.H.; Huh, H.; Kim, B.K.; Lee, C.K. An antiviral furanoquinone from Paulownia tomentosa Steud. Phytother. Res. 1999, 13, 624–626. [Google Scholar] [CrossRef]
  26. Zhao, X.; Li, B.; Lv, Y.; Xu, S.; Dong, Y.; Zhao, Z. Study on the differential expression of resistant genes between diploid and autotetraploid of Paulownia fortunei. J. Henan Agric. Univ. 2021, 55, 257–265. [Google Scholar]
  27. Chen, Y.; Mao, J.; Zhang, L.; Zhu, C.; Qin, Q.; Li, N. Bioinformatics and expression analysis of polyphenol oxidase gene family in potato. J. Hunan Agric. Univ. 2019, 45, 601–610. [Google Scholar]
  28. Cai, X.Y.; Li, Z.J.; Cheng, X.R.; Yang, T.B.; Yang, X.X.; Liu, L.; Dai, L.Y. Bioinformatics Analysis of SUT Gene Family in Sorghum bicolor. Appl. Biol. 2020, 39, 674–683. [Google Scholar]
  29. Wright, F. The ‘effective number of codons’ used in agene. Gene 1990, 87, 23–29. [Google Scholar] [CrossRef] [PubMed]
  30. Sullivan, M.L. Beyond brown: Polyphenol oxidases as enzymes of plant specialized metabolism. Front. Plant Sci. 2015, 5, 783. [Google Scholar] [CrossRef] [PubMed]
  31. Hu, G.; Chen, Y.; Wei, J.; Wang, H.; Zhang, J. Bioinformatics Analysis of Phosphoinositide-specific Phospholipase C Gene Family in Orchid[Phalaenopsis equestris (Schauer) Rchb. F.]. Southwest China J. Agric. Sci. 2017, 30, 2218–2223. [Google Scholar]
  32. Massa, A.N.; Beecher, B.; Morris, C.F. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family. Appl. Genet. 2007, 114, 1239–1247. [Google Scholar] [CrossRef] [PubMed]
  33. Zhu, Z. Cloning and Analysis of Polyphenol Oxidase Gene and Molecular Marker Development in Wheat. Master’s Thesis, Henan Agricultural University, Zhengzhou, China, 2018. [Google Scholar]
  34. Kendall, A.C.; Keys, A.J.; Turner, J.C.; Lea, P.J.; Miflin, B.J. The isolation and characterisation of a catalase-deficient mutant of barley (Hordeum vulgare L.). Planta 1983, 159, 505–511. [Google Scholar] [CrossRef] [PubMed]
  35. Du, Y.Y.; Wang, P.C.; Chen, J.; Song, C.P. Comprehensive functional analysis of the catalase gene family in Arabidopsis thaliana. J. Integr. Plant Biol. 2008, 50, 1318–1326. [Google Scholar] [CrossRef] [PubMed]
  36. Willekens, H.; Villarroel, R.; Van Montagu, M.; Inzé, D.; Van Camp, W. Molecular identification of catalases from Nicotiana plumbaginifolia (L.). FEBS Lett. 1994, 352, 79–83. [Google Scholar] [CrossRef] [PubMed]
  37. Xu, Y.; Wang, L.; Liu, H.; He, W.; Jiang, N.; Wu, M.; Xiang, Y. Identification of TCP family in moso bamboo (Phyllostachys edulis) and salt tolerance analysis of PheTCP9 in transgenic Arabidopsis. Mol. Plant Breed. 2022, 20, 4891–4899. [Google Scholar] [CrossRef] [PubMed]
  38. Hu, L.; Yang, Y.; Jiang, L.; Liu, S. The catalase gene family in cucumber: Genome-wide identification and organization. Genet. Mol. Biol. 2016, 39, 408–415. [Google Scholar] [CrossRef] [PubMed]
  39. Dong, L.; Yang, C.; Chen, L.; Song, L. Bioinformatics Analysis of Soybean Catalase Family and the Response to Abiotic Stress. Soybean Sci. 2022, 41, 663–671. [Google Scholar]
  40. Wang, W.; Cheng, Y.; Chen, D.; Liu, D.; Hu, M.; Dong, J.; Zhang, X.; Song, L.; Shen, F. The Catalase Gene Family in Cotton: Genome-Wide Characterization and Bioinformatics Analysis. Cells 2019, 8, 86. [Google Scholar] [CrossRef] [PubMed]
  41. Liu, Z. Identification of Catalase Genes in Nicotiana tabacum and Functional Studies in Response to Abiotic Stress Abstract. Master’s Thesis, Shandong Agricultural University, Jinan, China, 2021. [Google Scholar]
  42. Abarca, D.; Roldán, M.; Martín, M.; Sabater, B. Arabidopsis thaliana ecotype Cvi shows an increased tolerance to photo-oxidativestress and contains a new chloroplastic copper/zinc superoxide dismutase isoenzyme. J. Exp. Bot. 2001, 52, 1417–1425. [Google Scholar] [CrossRef] [PubMed]
  43. Li, Y.H.; Zhao, Z.H.; Wu, Z.; Bai, J.T.; Wang, S.Y.; Wang, T.C. Cloning and Expression of ZmSOD Gene under Drought Stress in Maize. Acta Bot. Boreali-Occident. Sin. 2023, 43, 1097–1106. [Google Scholar]
  44. Zhu, R.; Ji, X.; Zhang, Z.; Li, H.; Zhang, H. Bioinformatics analysis of Capsicum superoxide dismutase gene family. J. Shihezi Univ. 2020, 38, 712–717. [Google Scholar]
  45. Sun, J.; Li, S.; Wu, K.; Li, Z.; Gong, D.; Wang, F.; Chen, C.; Tian, Z. Genome-Wide Identification and Expression Analysis of SOD Gene Family in Tobacco. Mol. Plant Breed. 2024, 1–9. Available online: http://kns.cnki.net/kcms/detail/46.1068.S.20230316.1516.016.html (accessed on 22 August 2022).
  46. Ren, Y. Bioinformatics Analysis of Potato SOD Gene Family and Its Functional Research in Production of Reactive Oxygen Species of Wound Healing of Tubers. Master’s Thesis, Gansu Agricultural University, Lanzhou, China, 2021. [Google Scholar]
  47. Feng, K. Genome-Wide identification and Expression Analysis of SOD Gene Family in Tomato. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2017. [Google Scholar]
  48. He, P. Cloning and Prokaryotic Expression Analysis of Two SOD Genes CsCSD1 and CsFSD2 in Cucumber. Master’s Thesis, Jiangxi Agricultural University, Nanchang, China, 2020. [Google Scholar]
  49. Dong, Y.; Deng, M.; Mo, S.; Fan, G. Identification of bZIP gene family of Paulownia fortunei and their response to pathogenic process of witches’ broom phytoplasmas. J. Henan Agric. Univ. 2023, 57, 216–230. [Google Scholar]
  50. Jakoby, M.; Weisshaar, B.; Dröge-Laser, W.; Vicente-Carbajosa, J.; Tiedemann, J.; Kroj, T.; Parcy, F.; bZIP Research Group. bZIP transcription factors in Arabidopsis. Trends Plant Sci. 2002, 7, 106–111. [Google Scholar] [CrossRef] [PubMed]
  51. Gai, W.X.; Ma, X.; Qiao, Y.M.; Shi, B.H.; Ul Haq, S.; Li, Q.H.; Wei, A.M.; Liu, K.K.; Gong, Z.H. Characterization of the bZIP Transcription Factor Family in Pepper (Capsicum annuum L.): CabZIP25 Positively Modulates the Salt Tolerance. Front. Plant Sci. 2020, 11, 139. [Google Scholar] [CrossRef] [PubMed]
  52. Zhao, X.; Li, B.; Zhai, X.; Liu, H.; Deng, M.; Fan, G. Genome-Wide Analysis of Specific PfR2R3-MYB Genes Related to Paulownia Witches’ Broom. Genes 2022, 14, 7. [Google Scholar] [CrossRef] [PubMed]
  53. Feng, P.; Chen, P.; Hong, W.; Zhao, X.; Liu, X. Research Progress of MYB Transcription Factor Family in Arabidopsis thaliana. Life Sci. Res. 2016, 20, 555–560. [Google Scholar]
  54. Yang, X.; Guo, T.; Li, J.; Chen, Z.; Guo, B.; An, X. Genome-wide analysis of the MYB-related transcription factor family and associated responses to abiotic stressors in Populus. Int. J. Biol. Macromol. 2021, 191, 359–376. [Google Scholar] [CrossRef] [PubMed]
  55. Lv, L.; Sui, C.; Wang, D.; Meng, H.; Sun, Y.; Guo, S. Cloning and Expression Analysis of Soybean MYB124 Gene. Mol. Plant Breed. 2024, 1–10. Available online: http://kns.cnki.net/kcms/detail/46.1068.S.20230913.2304.008.html (accessed on 22 August 2022).
  56. Cao, Y.; Sun, G.; Zhai, X.; Xu, P.; Ma, L.; Deng, M.; Zhao, Z.; Yang, H.; Dong, Y.; Shang, Z.; et al. Genomic insights into the fast growth of paulownias and the formation of Paulownia witches’ broom. Mol. Plant 2021, 14, 1668–1682. [Google Scholar] [CrossRef] [PubMed]
  57. Bu, J.; Zhao, J.; Liu, M. Expression Stabilities of Candidate Reference Genes for RT-qPCR in Chinese Jujube (Ziziphus jujuba Mill.) under a Variety of Conditions. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  58. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
Plants 13 02033 g001
Figure 1. Distribution of P. fortunei PPO gene family on different chromosomes. Note: Color indicates the expression size of the gene, larger expression is darker, red is high expression and blue is low expression.
Figure 1. Distribution of P. fortunei PPO gene family on different chromosomes. Note: Color indicates the expression size of the gene, larger expression is darker, red is high expression and blue is low expression.
Plants 13 02033 g001
Plants 13 02033 g002
Figure 2. (a) Analyzing the conserved motifs of PfPPO gene family members; (b) the conservative domain analysis.
Figure 2. (a) Analyzing the conserved motifs of PfPPO gene family members; (b) the conservative domain analysis.
Plants 13 02033 g002
Plants 13 02033 g003
Figure 3. Stacking bar chart of percentage of secondary structure content of PfPPOs.
Figure 3. Stacking bar chart of percentage of secondary structure content of PfPPOs.
Plants 13 02033 g003
Plants 13 02033 g004
Figure 4. (a) Schematic diagram of cis-acting elements contained in PfPPO gene promoter region; (b) gene structure analysis.
Figure 4. (a) Schematic diagram of cis-acting elements contained in PfPPO gene promoter region; (b) gene structure analysis.
Plants 13 02033 g004
Plants 13 02033 g005
Figure 5. Cis-acting regulatory elements in PfPPO promoters.
Figure 5. Cis-acting regulatory elements in PfPPO promoters.
Plants 13 02033 g005
Plants 13 02033 g006
Figure 6. Phylogenetic tree of PfPPO family. Note—★: represents P. fortunei; ○: represents P. trichocarpa; ○: represents O. sativa; ○: represents C. annuum; ○: represents G. max; ☆: represents Z. mays; △: represents T. aestivum; △: represents M. domestica.
Figure 6. Phylogenetic tree of PfPPO family. Note—★: represents P. fortunei; ○: represents P. trichocarpa; ○: represents O. sativa; ○: represents C. annuum; ○: represents G. max; ☆: represents Z. mays; △: represents T. aestivum; △: represents M. domestica.
Plants 13 02033 g006
Plants 13 02033 g007
Figure 7. The collinearity analysis of PfPPOs. Note: Black lines indicate segmental duplicated gene pairs, and gray lines connect syntenic blocks in the genome. The inner circle represents the gene density of the chromosome. The exterior circle represents the amount of expression of the gene.
Figure 7. The collinearity analysis of PfPPOs. Note: Black lines indicate segmental duplicated gene pairs, and gray lines connect syntenic blocks in the genome. The inner circle represents the gene density of the chromosome. The exterior circle represents the amount of expression of the gene.
Plants 13 02033 g007
Plants 13 02033 g008
Figure 8. Relative expression of PfPPO genes in different parts of P. fortune in healthy (PF)and phytoplasma-infected (PFI)seedlings.
Figure 8. Relative expression of PfPPO genes in different parts of P. fortune in healthy (PF)and phytoplasma-infected (PFI)seedlings.
Plants 13 02033 g008
Plants 13 02033 g009
Figure 9. Relative expression of differential genes between control group and drought-treated seedlingsin P. fortunei. Note: * represents significant indigenous difference between PF and PFT (* p < 0.05, ** p < 0.01, and *** p < 0.001).
Figure 9. Relative expression of differential genes between control group and drought-treated seedlingsin P. fortunei. Note: * represents significant indigenous difference between PF and PFT (* p < 0.05, ** p < 0.01, and *** p < 0.001).
Plants 13 02033 g009
Table 1. Physical and chemical property analysis of PfPPOs.
Table 1. Physical and chemical property analysis of PfPPOs.
Gene NameGene IDAmino AcidRelative Molecular Weight (kDa)Isoelectric PointAverage Value of Total HydrophilicitySubcellular LocalizationChloroplast Transit Peptide
PfPPO1Pfo09g00547058766.0017.65−0.532chloroplast√
PfPPO2Pfo09g01816059266.5876.10−0.500chloroplast√
PfPPO3Pfo09g01817059266.6106.42−0.525chloroplast√
PfPPO4Pfo09g01818059266.6496.02−0.530chloroplast√
PfPPO5Pfo09g01820057464.5257.22−0.533peroxisome-
PfPPO6Pfo09g01821057664.0975.68−0.389chloroplast√
PfPPO7Pfo10g00630058966.2726.15−0.358chloroplast-
PfPPO8Pfo16g00454059366.6776.72−0.508chloroplast√
PfPPO9Pfo16g00455049956.6955.76−0.423cytoplasm√
PfPPO10Pfo16g00456040644.9599.15−0.357chloroplast√
Note: “√” indicates the presence of chloroplast transport peptides in the gene, and “-” indicates the absence of chloroplast transport peptides in the gene.
Table 2. Correlation parameter of codon usage bias in PfPPOs.
Table 2. Correlation parameter of codon usage bias in PfPPOs.
GeneGCENC
GC1GC2GC3sGC
PfPPO150.68 42.01 49.10 47.85 57.65
PfPPO251.26 39.63 53.90 48.79 56.87
PfPPO351.43 39.97 54.20 49.02 58.57
PfPPO451.60 39.97 52.70 48.62 57.88
PfPPO550.96 39.65 57.00 49.74 53.25
PfPPO654.59 41.94 62.00 53.26 53.49
PfPPO748.64 42.88 43.50 45.59 54.85
PfPPO852.19 40.40 58.30 50.84 57.01
PfPPO953.60 36.00 49.50 46.87 55.97
PfPPO1050.37 48.65 54.80 52.01 57.94
Average value51.53 41.11 53.50 49.26 56.35
Note: GC1, GC2, and GC3, respectively, represent the GC content of the first, second, and third bits of the codon; total GC represents the total GC content of the codon; ENC indicates the number of effective codons.
Table 3. Statistics of codon bias of P. fortunei PPO family genes.
Table 3. Statistics of codon bias of P. fortunei PPO family genes.
Amino AcidCodonNumberRelative Synonymous Codon UsageAmino AcidCodonNumberRelative Synonymous Codon Usage
PheUUU1030.80SerUCU821.32
UUC1541.20 UCC871.40
LeuUUA220.29 UCA671.08
UUG1391.80 UCG540.87
CUU851.10 AGU290.47
CUC720.93 AGC540.87
CUA290.38ProCCU930.88
CUG1161.50 CCC1161.09
ValGUU961.14 CCA1381.30
GUC780.93 CCG770.73
GUA240.28ThrACU961.09
GUG1391.65 ACC1131.28
TyrUAU960.97 ACA860.98
UAC1021.03 ACG570.65
HisCAU660.98AlaGCU1171.23
CAC691.02 GCC1251.31
GlnCAA911.01 GCA740.78
CAG900.99 GCG650.68
AsnAAU1280.86ArgCGU410.92
AAC1691.14 CGC451.01
LysAAA1800.95 CGA230.51
AAG1991.05 CGG250.56
AspGAU2060.99 AGA631.41
GAC2101.01 AGG711.59
GluGAA1270.96IleAUU1031.17
GAG1371.04 AUC1021.15
GlyGGU760.96 AUA600.68
GGC961.21MetAUG1171.00
GGA841.06TER *UAA20.60
GGG610.77 UAG20.60
CysUGU250.55 UGA61.80
UGC661.45TrpUGG851.00
Note: * represents the stop codon; bold font represents RSCU > 1.
Table 4. Primer sequences required for the verification of differential genes of PfPPOs’ family.
Table 4. Primer sequences required for the verification of differential genes of PfPPOs’ family.
Gene NameForward Primer (5′–3′)Reverse Primer (5′–3′)
PfPPO1ATGACAGGCTTCGTGACCAGCCGAAGAAAAGCCGAGGAGT
PfPPO2TACAGTCACGACAATGCGCTGCGCAGTGGACATTAGCTTG
PfPPO3ACTAGACGTGAACTGCTGCCACTAGACGTGAACTGCTGCC
PfPPO4TCTACGATGAGAACGCGCTGCCTTCGGCCTGTTTGTCAAC
PfPPO5TTGTGCTTACTGCAATGGCGAAAACGGCAACGCGAAAGTT
PfPPO6GGAAGGTCGACAGGAGGAACCTTGTCGAGCTCAGGTGGTT
PfPPO7GACTCTGGTGATGACAGCCCTGCTGCCGAAACCAATCAGA
PfPPO8TGGGATTGACTGAGCTGCTGACCGCCAATGGTGATGTCTT
PfPPO9GCTCGTGCGTGTTAAGGTTGTGGAGCATTAGAAGTGGCGG
PfPPO10CTTGAACACTGGCCAACAGCATCAGCAGGAAGGCGTTTCA
PfActinAATGGAATCTGCTGGAATACTGAGGACAATGTTACC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, Z.; Wang, F.; Deng, M.; Fan, G. Identification and Analysis of PPO Gene Family Members in Paulownia fortunei. Plants 2024, 13, 2033. https://doi.org/10.3390/plants13152033

AMA Style

Zhao Z, Wang F, Deng M, Fan G. Identification and Analysis of PPO Gene Family Members in Paulownia fortunei. Plants. 2024; 13(15):2033. https://doi.org/10.3390/plants13152033

Chicago/Turabian Style

Zhao, Zhenli, Fei Wang, Minjie Deng, and Guoqiang Fan. 2024. "Identification and Analysis of PPO Gene Family Members in Paulownia fortunei" Plants 13, no. 15: 2033. https://doi.org/10.3390/plants13152033

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop