GmHs1-1 and GmqHS1 Simultaneously Contribute to the Domestication of Soybean Hard-Seededness

Abstract

Seed physical dormancy (hard-seededness) is an interesting ecological phenomenon and important agronomic trait. The loss of seed coat impermeability/hard-seededness is a key target trait during the domestication of leguminous crops which allows seeds to germinate rapidly and uniformly. In this study, we examined the mutation of quantitative trait locus (QTL) genes, GmHs1-1 and GmqHS1, in 18 wild soybean (G. soja) and 23 cultivated soybean (G. max) accessions. The sequencing results indicate that a G-to-T substitution in GmqHS1 and a C-to-T substitution in GmHs1-1 occurred in all 23 cultivated soybean accessions but not in any of the 18 wild soybean accessions. The mutations in the two genes led to increased seed coat permeability in cultivated soybean. Therefore, we provide evidence that two genes, GmHs1-1 and GmqHS1, simultaneously contribute to the domestication of hard-seededness in soybeans. This finding is of great significance for genetic analysis and improved utilization of the soybean hard-seededness trait.

1. Introduction

Hard-seededness is an important trait related to soybean domestication. Compared with non-hard seeds, hard soybean seeds have higher seed vigor and longer seed lifespan [1,2,3]. Additionally, hard seeds are less prone to imbibition, delaying seed deterioration and facilitating seed preservation and transportation [2]. However, hard-seededness is not convenient for seed production in agriculture and utilization in daily life, as it not only reduces field emergence and final yield, but also affects seed consumption and processing. The breakdown of seed coat impermeability/hard-seededness is a crucial step in soybean domestication and improvement to produce high-value cultivated seeds [4]. Loss of seed coat impermeability is a key trait for many leguminous crops, which allows seeds to germinate rapidly and uniformly [5,6,7]. Permeable seed coats are also beneficial in processing seeds to produce vegetable oil and soy foods [8].

As we were interested in the seed coat permeability phenotype of legume species, two papers published in 2015 attracted our attention with their interesting results on soybean. Sun et al. [9] reported that seed coat impermeability in soybean is controlled by a major quantitative trait locus (QTL) gene, GmHs1-1, encoding a calcineurin-like protein. Soon after, another major QTL gene, qHS1, was also identified to control seed coat impermeability in soybean by fine mapping [10]. qHS1, an endo-1, 4-β-glucanase gene, promotes the accumulation of 1, 4-β-glucan in the outer layer of palisade cells, leading to the production of hard seeds. Moreover, qHS1 had the greatest effect on soybean impermeability according to another study [11]. Interestingly, the locations of these two genes are close to each other on the physical map. It is possible that these two genes function together to improve the seed coat permeability in cultivated soybean (Glycine max) [12], but each set of authors missed the gene identified by the other during their fine-mapping processes. To test the above hypothesis, we analyzed the single-nucleotide polymorphism (SNP) variation in different wild soybean (Glycine soja) and elite cultivated soybean populations. Our findings, unsurprisingly, indicated that these two genes, not one, simultaneously exist and contribute to improving seed coat permeability in cultivated soybean. Our analyses suggest that both the Hs1-1 and qHS1 genes are functional in controlling seed coat impermeability in legume species. Hs1-1 and qHS1 function together to facilitate cultivated soybean domestication for seed coat permeability.

2. Results and Discussion

Hard-seededness is one of the crucial target traits during domestication of many legume crops [5,7,11]. Modern cultivated soybean, the most economically important legume crop, is commonly believed to have been domesticated from wild soybean in East Asia about 5000 years ago [13,14]. Previous studies indicated that several genes/QTLs control the hard-seededness [11]. Keim et al. [15] first used five RFLP markers to detect the QTLs of soybean hard-seededness, which were located on chromosomes 2, 3, 8 and 19, and explained 71.0% of the genetic variation. Watanabe et al. [16] identified three markers (RAS1-3) related to soybean hard-seededness and found that the dominant QTL (RAS2) was located on chromosome 2. In soybean PI594619, a single gene located between the markers Sat_202 and Satt459 on chromosome 2 was also identified to control seed coat impermeability [17]. Subsequently, two genes, qHS1 and GmHs1-1, related to soybean hard-seededness on chromosome 2 were cloned independently [9,10]. It is possible that the QTLs on chromosome 2 in soybean have the greatest effect on seed coat impermeability [15,18]. Interestingly, according to current research information, GmHs1-1 and GmqHS1 were mapped close to each other on chromosome 2 in the soybean genome (Figure 1a) by two different independent research groups [9,10].

Investigating the relationship between these two genes in cultivated soybean varieties will help us clearly understand the trait during soybean domestication. Thus, to test this speculation, we ordered 18 wild soybean (G. soja) and 23 cultivated soybean (G. max) accessions from the USDA which were used in the research of Sun et al. [9]. No mutations were found in either gene in the 18 wild soybean accessions. However, we observed SNPs in GmHs1-1 simultaneously with GmqHS1 in all 23 cultivated soybean accessions (Figure 1b). These results indicated that GmHs1-1 and GmqHS1 were selected together during soybean domestication, which might be the reason why functional GmHs1-1 or GmqHS1 only partially recovered the seed coat permeability phenotype in previous reported studies. Currently, the single-origin theory of the domestication of soybean appears to be widely accepted and also supported by marker analysis [19] and recent genome resequencing data [20,21]. The current understanding of the GmHs1-1 and GmqHS1 genes, together with advances for future research and utilization of the hard-seededness trait of soybean, was summarized recently [22].

During the process of soybean’s transition from wild to domesticated, the removal of hard-seededness characteristics affected the seed’s ability to absorb water and germinate. The classic imbibition process of wild soybean (G. soja) and cultivated soybean seeds (G. max) was described in this study (Figure 1c). Additionally, compared with wild soybean, the vigor and lifespan of cultivated soybean seeds after the breakdown of the impermeable seed coat are also affected. Based on previous reports of both hard and non-hard soybean seeds stored at room temperature (20 °C), it was found that non-hard seeds lost their vigor after approximately 2 years, while hard seeds still maintained a higher germination percentage of over 90% after 4 years [23]. As the main channel for germinating seeds to absorb water and exchange gases from the external environment, the seed coat and hilum are closely related to the maintenance of vigor and longer lifespan in hard soybean seeds. They hinder or restrict the influence of external water and gases on seeds, causing seeds to remain in a dormant or semi-dormant state for a long time, reducing the consumption of nutrients to the minimum level, thereby maintaining and extending seed vigor and lifespan. Overall, although the removal of hard-seededness characteristics in soybean is beneficial for seed germination, cultivation and production, it to some extent damages seed vigor and longevity under normal storage conditions. All these data indicate that both Hs1-1 and qHS1 are critical in controlling seed coat impermeability/hard-seededness. The simultaneous mutations of these two genes may have enabled artificial selection to break down hard-seededness during soybean domestication.

3. Materials and Methods

3.1. Plant Materials, Plant Growth and Growth Conditions

Wild soybean (G. soja) and cultivated soybean (G. max) accessions were requested from the USDA Soybean Germplasm Collection (

Table 1. G. soja and G. max population samples from the USDA Soybean Germplasm Collection used for genotyping and phenotyping.

No.	Accession	Allele	Phenotype	Category	Province/State	Country
1	PI 483464A	GmHs1-1 GmqHS1	Hard	Glycine soja	Ningxia	China
2	PI 407301	GmHs1-1 GmqHS1	Hard	Glycine soja	Jiangsu	China
3	PI 407140	GmHs1-1 GmqHS1	Hard	Glycine soja	Kumamoto	Japan
4	PI 326582A	GmHs1-1 GmqHS1	Hard	Glycine soja	Primorye	Russia
5	PI 483465	GmHs1-1 GmqHS1	Hard	Glycine soja	Shaanxi	China
6	PI 464935	GmHs1-1 GmqHS1	Hard	Glycine soja	Jiangsu	China
7	PI 468400A	GmHs1-1 GmqHS1	Hard	Glycine soja	Ningxia	China
8	PI 468916	GmHs1-1 GmqHS1	Hard	Glycine soja	Liaoning	China
9	PI 339871A	GmHs1-1 GmqHS1	Hard	Glycine soja	Cheju	Korea
10	PI 458538	GmHs1-1 GmqHS1	Hard	Glycine soja	Heilongjiang	China
11	PI 597459D	GmHs1-1 GmqHS1	Hard	Glycine soja	Shandong	China
12	PI 393551	GmHs1-1 GmqHS1	Hard	Glycine soja	Taiwan	China
13	PI 597461A	GmHs1-1 GmqHS1	Hard	Glycine soja	Shandong	China
14	PI 407131	GmHs1-1 GmqHS1	Hard	Glycine soja	Kumamoto	Japan
15	PI 447004	GmHs1-1 GmqHS1	Hard	Glycine soja	Jilin	China
16	PI 562559	GmHs1-1 GmqHS1	Hard	Glycine soja	Cholla Puk	S. Korea
17	PI 366120	GmHs1-1 GmqHS1	Hard	Glycine soja	Akita	Japan
18	PI 407170	GmHs1-1 GmqHS1	Hard	Glycine soja	Kyonggi	S. Korea
19	PI 536637	Gmhs1-1 Gmqhs1	Permeable	Glycine max	South Carolina	USA
20	PI 548985	Gmhs1-1 Gmqhs1	Permeable	Glycine max	South Carolina	USA
21	PI 518664	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Virginia	USA
22	PI 548604	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Missouri	USA
23	PI 548520	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Iowa	USA
24	PI 522236	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Georgia	USA
25	PI 533655	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Illinois	USA
26	PI 508266	Gmhs1-1 Gmqhs1	Permeable	Glycine max	North Carolina	USA
27	PI 515961	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Kentucky	USA
28	PI 533602	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Arkansas	USA
29	PI 548638	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Ontario (Guelph)	Canada
30	PI 553047	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Georgia	USA
31	PI 513382	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Minnesota	USA
32	PI 548644	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Ontario (Guelph)	Canada
33	PI 536635	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Ohio	USA
34	PI 548643	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Ontario (Ottawa)	Canada
35	PI 508083	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Minnesota	USA
36	PI 525453	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Iowa	USA
37	PI 548634	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Ohio	USA
38	PI 542403	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Minnesota	USA
39	PI 540552	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Ohio	USA
40	PI 556511	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Michigan	USA
41	PI 548512	Gmhs1-1 Gmqhs1	Permeable	Glycine max	Indiana	USA

). These populations were used for GmHs1-1 and GmqHS1 mutation variation analyses and association tests. Plants were grown at 22 °C day/20 °C night temperatures under a 16 h day/8 h night photoperiod in greenhouse conditions.

3.2. Seed Imbibition Phenotyping

Seeds of 18 wild soybean (G. soja) and 23 cultivated soybean (G. max) accessions were simultaneously harvested and used for seed coat impermeability tests. After the seeds were incubated in sterile water at room temperature for 2 h, the imbibed seeds were counted and the proportion of seeds with seed coat permeability was calculated. Cultivated soybean seeds showed imbibition, while wild soybean seeds did not. Additionally, the imbibition process of wild-type and mutant seeds was recorded by measuring the increased weight of imbibed seeds compared with their original dry weight at an interval of 40 min for 360 min.

3.3. DNA Isolation, PCR, Sequencing and Alignments

Genomic DNA was isolated from leaves of 4-week-old seedlings using a classical CTAB method (https://www.nature.com/articles/nprot.2006.384). PCR primers were designed to amplify the SNPs of the Hs1-1 and qHS1 genes (

Table 2. Primers used in this study.

Source of Gene Sequence	Primer Name	Primer Sequence	Application
Glyma.02G269400	GmqHS1 F	GCTACTATGCGTCGGTGAGT	For cloning of the SOYBEAN GmqHS1 and SNP sequencing
Glyma.02G269400	GmqHS1 R	GAGACCATGAGTTGAAGGCCA	For cloning of the SOYBEAN GmqHS1 and SNP sequencing
Glyma.02G269500	GmHs1-1 F1	TGGGCTTTCATTAGGTCAGACAAAC	For cloning of the SOYBEAN GmHs1-1 and SNP sequencing
Glyma.02G269500	GmHs1-1 R1	TCGAAGGAGTGACATCCAAGGTAA	For cloning of the SOYBEAN GmHs1-1 and SNP sequencing

). The amplified fragment length was 190 bp for qHS1 and 388 bp for Hs1-1. The PCR cycling conditions included an initial denaturation step at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 15 s and annealing at 55 °C for 30 s. PCR products were directly sequenced, and alignment of the PCR product nucleotide sequences was carried out with DNASTAR Lasergene 12 (https://www.dnastar.com/software/).

4. Conclusions

All the above data indicate that the Hs1-1 and qHS1 genes are critical in controlling seed coat impermeability/hard-seededness. The simultaneous mutations of these two genes may have enabled artificial selection to break down hard-seededness during soybean domestication.