Establishment of Novel Simple Sequence Repeat (SSR) Markers from Chimonanthus praecox Transcriptome Data and Their Application in the Identification of Varieties
Abstract
:1. Introduction
2. Results
2.1. Transcriptome Sequencing and Assembly
2.2. Functional Annotation
2.3. Frequency and Distribution of SSRs in the Transcriptome
2.4. Development of Polymorphic EST-SSR Markers
2.5. UPGMA Cluster Analysis of Different Varieties of C. praecox Based on the EST-SSR Markers
3. Discussion
4. Materials and Methods
4.1. Plant Materials and DNA/RNA Extraction
4.2. Transcriptome Sequencing De Novo Assembly
4.3. Raw Data Analysis and Function Annotation
4.4. Microsatellite Identification, PCR Amplification, and Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Sui, S.Z.; Luo, J.; Ma, J.; Zhu, Q.; Lei, X.; Li, M. Generation and analysis of expressed sequence tags from Chimonanthus praecox (Wintersweet) flowers for discovering stress-responsive and floral development-related genes. Int. J. Genom. 2012, 2012, 134596. [Google Scholar]
- Shen, Z.; Li, W.; Li, Y.; Liu, M.; Cao, H.; Provart, N.; Ding, X.; Sun, M.; Tang, Z.; Yue, C.; et al. The red flower wintersweet genome provides insights into the evolution of magnoliids and the molecular mechanism for tepal color development. Plant J. 2021, 108, 1662–1678. [Google Scholar] [CrossRef] [PubMed]
- Shang, J.; Tian, J.; Cheng, H.; Yan, Q.; Li, L.; Jamal, A.; Xu, Z.; Xiang, L.; Saski, C.A.; Jin, S.; et al. The chromosome-level wintersweet (Chimonanthus praecox) genome provides insights into floral scent biosynthesis and flowering in winter. Genome Biol. 2020, 21, 200. [Google Scholar] [CrossRef]
- Fu, X.; Yang, N.; Du, Y.; Kamran, H.M.; Wang, H.; Chen, S.; Chen, L. Development of SSR molecular markers and genetic diversity analysis of TPS gene family in Chimonanthus praecox. Agriculture 2023, 13, 893. [Google Scholar] [CrossRef]
- Kitagawa, N.; Ninomiya, K.; Okugawa, S.; Motai, C.; Nakanishi, Y.; Yoshikawa, M.; Muraoka, O.; Morikawa, T. Quantitative determination of principal alkaloid and flavonoid constituents in wintersweet, the flower buds of Chimonanthus praecox. Nat. Prod. Commun. 2016, 11, 953–956. [Google Scholar] [CrossRef]
- Wu, H.F.; Wang, X.; Cao, Y.; Zhang, H.; Hua, R.; Liu, H.; Sui, S. CpBBX19, a B-box transcription factor gene of Chimonanthus praecox, improves salt and drought tolerance in Arabidopsis. Genes 2021, 12, 1456. [Google Scholar] [CrossRef] [PubMed]
- Yao, C.H.; Wang, C.Y. Three basic problems in the classification of Chimonanthus praecox varieties. J. Beijing For. Univ. 1995, 17, 164–167. [Google Scholar]
- Zhu, T.; Feng, Y.; Dong, X.; Yang, X.; Liu, B.; Yuan, P.; Song, X.; Chen, S.; Sui, S. Optimizing DUS testing for Chimonanthus praecox using feature selection based on a genetic algorithm. Front. Plant Sci. 2024, 14, 1328603. [Google Scholar] [CrossRef]
- Liu, D.; Ma, J.; Yang, J.; Nguyen, T.V.; Liu, H.; Huang, R.; Sui, S.; Li, M. Mining simple sequence repeat and single nucleotide polymorphism markers in a transcriptomic database of wintersweet (Chimonanthus praecox). HortScience 2014, 49, 1360–1364. [Google Scholar] [CrossRef]
- Yang, W.; Bai, Z.; Wang, F.; Zou, M.; Wang, X.; Xie, J.; Zhang, F. Analysis of the genetic diversity and population structure of Monochasma savatieri Franch. ex Maxim using novel EST-SSR markers. BMC Genom. 2022, 23, 597. [Google Scholar] [CrossRef]
- Chen, L.Q.; Chen, J.Y.; Zheng, Y.L.; Lu, D.F. Detection of genetic variation within and between natural populations of Chimonanthus praecox (L.) Link using RAPD markers. J. Beijing For. Univ. 1999, 21, 86–90. [Google Scholar]
- Wang, Q.; Yao, Q.J.; Xu, Z.L.; Hu, J.G.; Yang, C.S. Genetic diversityof four populations of Calycanthus chinensis based on ISSR and RAPD markers. Guihaia 2013, 33, 30–34. [Google Scholar]
- Chen, D.W.; Chen, L.Q. The first intraspecific genetic linkage maps of wintersweet [Chimonanthus praecox (L.) Link] based on AFLP and ISSR markers. Sci. Hortic. 2010, 124, 88–94. [Google Scholar] [CrossRef]
- Zhao, M.X. Establishment of in vitro plant regeneration and ssr and aflp reaction system of chimonanthus praecox Link. var. concolor. Afr. J. Biotechnol. 2012, 11, 10358–10361. [Google Scholar]
- Zuo, D.D.; Zhao, H.T.; Liu, C.; Mu, D.; Wang, X.W.; Ming, J. Genetic diversity in natural populations of Chimonanthus praecox (L.) Link revealed by SRAP markers. Acta Hortic. Sin. 2009, 36, 1197–1202. [Google Scholar]
- Bu, H.F.; Gu, Z.H.; Zhang, W.D.; Li, D. Establishment of SRAP-PCR reaction system for Chimonanthus praecox. Agric. Technol. 2022, 42, 129–132. [Google Scholar]
- Hu, H.; Chai, N.; Zhu, H.; Li, R.; Huang, R.; Wang, X.; Liu, D.; Li, M.; Song, X.; Sui, S. Factors affecting vegetative propagation of wintersweet (Chimonanthus praecox) by softwood cuttings. HortScience 2020, 55, 1853–1860. [Google Scholar] [CrossRef]
- Zhao, B.; Zhang, Q.X. Genetic diversity of germplasm resources of Chimonanthus praecox (L.) Link based on AFLP marker. Acta Ecol. Sin. 2007, 27, 4452–4459. [Google Scholar]
- Wang, X.; Zhao, Y.; Wang, J.; Li, Z.; Zhang, J.; Li, Q. Genetic diversity analysis and fingerprinting of 175 Chimonanthus praecox germplasm based on SSR molecular marker. Chin. J. Biotechnol. 2024, 40, 252–268. [Google Scholar]
- Yang, Q.; Jiang, Y.; Wang, Y.; Han, R.; Liang, Z.; He, Q.; Jia, Q. SSR loci analysis in transcriptome and molecular Marker development in Polygonatum sibiricum. BioMed Res. Int. 2022, 2022, 4237913. [Google Scholar] [CrossRef]
- Li, X.; Qiao, L.; Chen, B.; Zheng, Y.; Zhi, C.; Zhang, S.; Pan, Y.; Cheng, Z. SSR markers development and their application in genetic diversity evaluation of garlic (Allium sativum) germplasm. Plant Divers. 2022, 44, 481–491. [Google Scholar] [CrossRef]
- Li, X.; Yang, N.; Zhao, K.G.; Chen, Y.X.; Tang, R.J.; Chen, L.Q. Development and primer selection of EST-SSR molecular markers based on transcriptome sequencing of Chimonanthus praecox. J. Beijing For. Univ. 2013, 35, 25–32. [Google Scholar]
- Yang, J.; Dai, P.; Zhou, T.; Huang, Z.; Feng, L.; Su, H.; Liu, Z.; Zhao, G. Genetic diversity and structure of wintersweet (Chimonanthus praecox) revealed by EST-SSR markers. Sci. Hortic. 2013, 150, 1–10. [Google Scholar] [CrossRef]
- Ali, Q.S. Identification and Diversity Analysis of Wintersweet (Chimonanthus praecox) Crossing Progenies Using SSR Molecular Markers. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2018. [Google Scholar]
- Ning, H.-J.; Gui, F.-F.; Tian, E.-W.; Yang, L.-Y. The novel developed microsatellite markers revealed potential hybridization among Cymbidium species and the interspecies sub-division of C. goeringii and C. ensifolium. BMC Plant Biol. 2023, 23, 492. [Google Scholar] [CrossRef]
- Zhao, K.-G.; Zhou, M.-Q.; Chen, L.-Q.; Zhang, D.; Robert, G.W. Genetic diversity and discrimination of Chimonanthus praecox (L.) Link germplasm using ISSR and RAPD markers. HortScience 2007, 42, 1144–1148. [Google Scholar] [CrossRef]
- Li, D.; Long, C.; Pang, X.; Ning, D.; Wu, T.; Dong, M.; Han, X.; Guo, H. The newly developed genomic-SSR markers uncover the genetic characteristics and relationships of olive accessions. PeerJ 2020, 8, e8573. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Han, R.; Zhang, F.; Mao, A.; Luo, J.; Dong, B.; Liu, H.; Tang, H.; Zhang, J.; Wen, C. Target SSR-Seq: A novel SSR genotyping technology associate with perfect SSRs in genetic analysis of Cucumber varieties. Front. Plant Sci. 2019, 10, 531. [Google Scholar] [CrossRef]
- Wu, F.; Zhang, S.; Gao, Q.; Liu, F.; Wang, J.; Wang, X. Genetic diversity and population structure analysis in a large collection of Vicia amoena in China with newly developed SSR markers. BMC Plant Biol. 2021, 21, 544. [Google Scholar] [CrossRef]
- Chai, M.; Ye, H.; Wang, Z.; Zhou, Y.; Wu, J.; Gao, Y.; Han, W.; Zang, E.; Zhang, H.; Ru, W.; et al. Genetic divergence and relationship among Opisthopappus species identified by development of EST-SSR markers. Front. Genet. 2020, 11, 177. [Google Scholar] [CrossRef]
- Yin, J.W.; Han, B.B.; Ma, Y.X.; Wu, X.Y.; Xu, Z.J.; Jiang, J.F.; Chen, C.W.; Han, R.X. Analysis of genetic diversity of 154 peach cultivars based on SSR markers. Jiangsu Agric. Sci. 2023, 51, 18–26. [Google Scholar]
- Ju, P.J.; Zhu, Y.F.; Zhao, L.; Wang, G.Y.; Zhou, C.C.; Yan, L.J.; Chai, C.Y.; Jiao, Y.; Chen, J.H.; Guo, X.Z.; et al. Construction of specific fluorescent-labeled SSR marker database of Chinese bayberry (Morella rubra) varieties. J. Agric. Biotechnol. 2023, 31, 2209–2220. [Google Scholar]
- Wang, R.; Zhong, Y.; Hong, W.; Luo, H.; Li, D.; Zhao, L.; Zhang, H.; Wang, J. Genetic diversity evaluation and core collection construction of pomegranate (Punica granatum L.) using genomic SSR markers. Sci. Hortic. 2023, 319, 112192. [Google Scholar] [CrossRef]
- Yuan, J.L.; Ma, J.; Zhong, Y.; Yue, J. SSR-based hybrid identification, genetic analyses and fingerprint development of hybridization progenies from sympodial bamboo (Bambusoideae, Poaceae). J. Nanjing For. Univ. Nat. Sci. Ed. 2021, 45, 10–18. [Google Scholar]
- Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef]
- Wang, L.; Li, S.; Wang, T.; He, C.; Luo, H.; Zhang, J.; Zeng, Y. Genomic SSR and EST-SSR markers for phylogenetic and pedigree reconstructions-A comparison in sea buckthorn. Plant Breed. 2021, 140, 167–183. [Google Scholar] [CrossRef]
- Li, J.; Zhang, C.; Chen, S.; Jiang, K.; Guan, H.; Liu, W. Characterization and application of EST-SSR markers developed from transcriptome sequences in Elymus breviaristatus (Poaceae: Triticeae). Genes 2023, 14, 302. [Google Scholar] [CrossRef]
- Wu, J.; Cai, C.; Cheng, F.; Cui, H.; Zhou, H. Characterisation and development of EST-SSR markers in tree peony using transcriptome sequences. Mol. Breed. 2014, 34, 1853–1866. [Google Scholar] [CrossRef]
- Tulsani, N.J.; Hamid, R.; Jacob, F.; Umretiya, N.G.; Nandha, A.K.; Tomar, R.S.; Golakiya, B.A. Transcriptome landscaping for gene mining and SSR marker development in Coriander (Coriandrum sativum L.). Genomics 2020, 112, 1545–1553. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Pan, C.; Diao, Y.; You, Y.; Yang, C. Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae). BMC Genom. 2013, 14, 490. [Google Scholar] [CrossRef]
- Li, Y.C.; Korol, A.B.; Fahima, T.; Nevo, E. Microsatellites within genes: Structure, function, and evolution. Mol. Biol. Evol. 2004, 21, 991–1007. [Google Scholar] [CrossRef]
- Bárbara, R.B.; de Carvalho, L.M.; Carazzolle, M.F.; Pereira, G.A.G. Development of novel EST-SSR markers in the macaúba palm (Acrocomia aculeata) using transcriptome sequencing and cross-species transferability in Arecaceae species. BMC Plant Biol. 2018, 18, 276. [Google Scholar]
- Liu, T.M.; Zeng, L.; Zhu, S.; Chen, X.; Tang, Q.; Mei, S. Large-scale development of expressed sequence tag-derived simple sequence repeat markers by deep transcriptome sequencing in garlic (Allium sativum L.). Mol. Breed. 2015, 35, 204. [Google Scholar] [CrossRef]
- Zhang, Z.; Xie, W.; Zhao, Y.; Zhang, J.; Wang, N.; Ntakirutimana, F.; Yan, J.; Wang, Y. EST-SSR marker development based on RNA-sequencing of E. sibiricus and its application for phylogenetic relationships analysis of seventeen Elymus species. BMC Plant Biol. 2019, 19, 235. [Google Scholar] [CrossRef] [PubMed]
- Xiao, L.; Shang, X.; Cao, S.; Xie, X.; Zeng, W.; Yan, H. Utilization of simple sequence repeat (SSR) markers developed from ade novo transcriptome asembly in Pueraria thomsoni Benth. Acta Bot. Boreali-Occident. Sin. 2019, 39, 59–67. [Google Scholar]
- Kumari, S.; Ujjainwal, S.; Singh, N.; Archak, S.; Wankhede, D.P. Development of genic simple sequence repeat markers as novel genomic resources in dolichos bean (Lablab purpureus L.). Indian J. Plant Genet. Resour. 2022, 35, 80–84. [Google Scholar] [CrossRef]
- Song, X.; Li, N.; Guo, Y.; Bai, Y.; Wu, T.; Yu, T.; Feng, S.; Zhang, Y.; Wang, Z.; Liu, Z.; et al. Comprehensive identification and characterization of simple sequence repeats based on the whole-genome sequences of 14 forest and fruit trees. For. Res. 2021, 1, 7. [Google Scholar] [CrossRef]
- Liu, T.; Zhu, S.; Fu, L.; Tang, Q.; Yu, Y.; Chen, P.; Luan, M.; Wang, C.; Tang, S. Development and characterization of 1,827 expressed sequence tag-derived simple sequence repeat markers for ramie (Boehmeria nivea L. Gaud). PLoS ONE 2013, 8, e60346. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.Q.; Lu, D.F. Cultivar classification system of Chimonanthus praecox (L.) Link. J. Beijing For. Univ. 2001, 23, 107–108. [Google Scholar]
- Gao, X.; Su, Q.; Yao, B.; Yang, W.; Ma, W.; Yang, B.; Liu, C. Development of EST-SSR markers related to polyphyllin biosynthesis reveals genetic diversity and population structure in Paris polyphylla. Diversity 2022, 14, 589. [Google Scholar] [CrossRef]
- Siegel, C.; Stevenson, F.; Zimmer, E. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa. Appl. Plant Sci. 2017, 5, 1600109. [Google Scholar] [CrossRef]
- Chen, Y.; Chen, Y.; Shi, C.; Huang, Z.; Zhang, Y.; Li, S.; Li, Y.; Ye, J.; Yu, C.; Li, Z.; et al. SOAPnuke: A MapReduce acceleration-supported software for integrated quality control and preprocessing of high-throughput sequencing data. GigaScience 2018, 7, 1–6. [Google Scholar] [CrossRef]
- Ogata, H.; Goto, S.; Sato, K.; Fujibuchi, W.; Bono, H.; Kanehisa, M. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 1999, 27, 29–34. [Google Scholar] [CrossRef] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Li, J.Q.; Wu, S.F.; Deng, Y.; Li, Q.Q.; Wu, S.F.; Li, J.; Wu, S.; Zhu, Y.; Chen, Y.; et al. Integrated nr database in protein annotation system and its localization. Comput. Eng. 2006, 32, 71–72. [Google Scholar]
- Kulikova, T.; Akhtar, R.; Aldebert, P.; Althorpe, N.; Andersson, M.; Baldwin, A.; Bates, K.; Bhattacharyya, S.; Bower, L.; Browne, P.; et al. EMBL Nucleotide Sequence Database in 2006. Nucleic Acids Res. 2007, 35, 16–20. [Google Scholar] [CrossRef] [PubMed]
- Amos, B.; Rolf, A. The SWISS-PROT protein sequence database and its supplement TrEMBL in 2000. Nucleic Acids Res. 2000, 28, 45–48. [Google Scholar]
- Bateman, A.; Coin, L.; Durbin, R.; Finn, R.D.; Hollich, V.; Griffiths-Jones, S.; Khanna, A.; Marshall, M.; Moxon, S.; Sonnhammer, E.L.L.; et al. The Pfam protein families database. Nucleic Acids Res. 2008, 32, 138–141. [Google Scholar] [CrossRef] [PubMed]
- Koonin, E.V.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Krylov, D.M.; Makarova, K.S.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; Rao, B.S.; et al. A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome Biol. 2004, 5, 1–28. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
- Rozen, S. Primer3: A Software Component for Picking PCR Primer; Whitehead Institute: Cambridge, MA, USA, 1996. [Google Scholar]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Rohlf, F.J. NTSYS-Pc: Numerical Taxonomy and Multivariate Analysis System, version 2.1; Exeter Publishing Setauket: New York, NY, USA, 2000. [Google Scholar]
Item | Number |
---|---|
Total clean data (Gb) | 114.73 |
Total unigenes | 162,638 |
Total length of unigenes (bp) | 170,847,856 |
Average length of unigenes (bp) | 1050 |
N50 of unigenes (bp) | 2059 |
GC content | 40.98% |
Annotation Database | Number of Unigenes | Percentage (%) |
---|---|---|
NR | 77,914 | 47.91% |
NT | 55,460 | 34.10% |
Swiss-Prot | 55,465 | 34.10% |
KEGG | 57,525 | 35.37% |
KOG | 47,180 | 29.01% |
Pfam | 57,638 | 35.44% |
GO | 62,480 | 38.42% |
Intersection | 24,879 | 15.30% |
Overall | 82,778 | 50.90% |
Total | 162,638 | 100.00% |
Item | Number |
---|---|
Total number of sequences examined | 162,638 |
Total size of examined sequences (bp) | 170,847,856 |
Total number of identified SSRs | 13,556 |
Number of SSR-containing sequences | 11,691 |
Number of sequences containing more than 1 SSR | 1515 |
Number of SSRs present in compound formation | 667 |
Mononucleotide | 222 |
Dinucleotide | 4613 |
Trinucleotide | 7984 |
Tetranucleotide | 355 |
Pentanucleotide | 122 |
Hexanucleotide | 260 |
Locus | Motif | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | GenBank Accession Number | Na | Ne | I | Ho | He |
---|---|---|---|---|---|---|---|---|---|
CP14 | (CTT)7 | CGCTCTCTCCTTAACGCGAT | ACTTCTTGCTTTTGCCGCTG | PP532794 | 2.000 | 1.492 | 0.512 | 0.417 | 0.330 |
CP20 | (TC)25 | CCATCTGCGACTGTCCCTTT | CGGATCTCTCCCGGATTTCG | PP532795 | 4.000 | 3.646 | 1.332 | 0.500 | 0.726 |
CP22 | (CT)18 | AGAACATGTCCAATTCCCATGGA | GCATGCTCGCTCTCTCTCTC | PP532796 | 6.000 | 4.235 | 1.585 | 0.333 | 0.764 |
CP33 | (AT)10 | CAGTCAGGTCCACGTGTTGA | ATCTCGATCTGCTGCCACTG | PP532797 | 6.000 | 3.176 | 1.426 | 0.444 | 0.685 |
CP43 | (GA)14 | TGCCCAGTTGCCTCTTTTCA | CGACTTCTTCTCCTTCGCCA | PP532798 | 2.000 | 1.492 | 0.512 | 0.250 | 0.330 |
CP44 | (TCG)7 | CCGGAAGTAGCCATCGGATC | GCATGGAGAGTCCTCGCTAC | PP532799 | 3.000 | 2.969 | 1.093 | 0.750 | 0.663 |
CP67 | (AG)22 | CACGAAGCCCTCCAGAAAGT | CTTGCAGGGGAGCATGTACA | PP532800 | 5.000 | 3.600 | 1.393 | 1.000 | 0.722 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, B.; Wu, H.-F.; Cao, Y.-Z.; Yang, X.-M.; Sui, S.-Z. Establishment of Novel Simple Sequence Repeat (SSR) Markers from Chimonanthus praecox Transcriptome Data and Their Application in the Identification of Varieties. Plants 2024, 13, 2131. https://doi.org/10.3390/plants13152131
Liu B, Wu H-F, Cao Y-Z, Yang X-M, Sui S-Z. Establishment of Novel Simple Sequence Repeat (SSR) Markers from Chimonanthus praecox Transcriptome Data and Their Application in the Identification of Varieties. Plants. 2024; 13(15):2131. https://doi.org/10.3390/plants13152131
Chicago/Turabian StyleLiu, Bin, Hua-Feng Wu, Yin-Zhu Cao, Xi-Meng Yang, and Shun-Zhao Sui. 2024. "Establishment of Novel Simple Sequence Repeat (SSR) Markers from Chimonanthus praecox Transcriptome Data and Their Application in the Identification of Varieties" Plants 13, no. 15: 2131. https://doi.org/10.3390/plants13152131