Paclobutrazol Enhanced Stem Lodging Resistance of Direct-Seeded Rice by Affecting Basal Internode Development
Abstract
:1. Introduction
2. Results
2.1. Yield and Lodging Rate
2.2. Internode Length
2.3. Endogenous Hormones in the Culm
2.4. The Culm Diameter, Culm Wall Thickness, and Culm Filling Degree
2.5. Culm Physical Parameters (Breaking Strength, Bending Stress, and Cross-Section Modulus)
2.6. Lignin Content and Lignin-Related Enzymes Activities of Culm
2.6.1. Lignin Content
2.6.2. Activities of Lignin-Related Enzymes
2.7. The Cellulose Content
2.8. The Anatomical Characteristics of Culm Tissue
2.9. Expression of Genes Involved in Lignin Synthesis
2.10. Principal Component Analysis (PCA)
2.11. The Relationships between the Culm Anatomical Characteristics and Endogenous Hormones, Morphological Characteristics
3. Discussion
3.1. Paclobutrazol Increased the Yield and Decreased the Lodging Rate of Direct-Seeded Rice
3.2. Paclobutrazol Optimized the Morphological and Anatomical Structure of Direct-Seeded Rice Stems and Enhanced Lodging Resistance by Regulating the Endogenous Hormone Content
3.3. Paclobutrazol Promoted the Development of Cell Walls through Internode Carbohydrate Anabolism, Thereby Enhancing Stem Lodging Resistance
4. Materials and Methods
4.1. Experimental Location
4.2. Field Experiment, Materials, and Design
4.3. Measuring Items and Method
4.3.1. Yield and Lodging Rate
4.3.2. Morphological Characteristics of the Basal Second Internode
4.3.3. Determination of Endogenous Hormones
4.3.4. Determination of the Breaking Strength of the Second Basal Internode
- (1)
- Breaking strength (M, g cm), M = BL × L × 1/4 × 103, where BL is the force applied to break the stem segment (kg) and L is the distance between two points (cm).
- (2)
- Section modulus (SM, mm3): SM = π/32 × (a13b1 – a23b2)/a1, where b1 is the outer diameter of the major axis in an oval cross-section (mm), b2 is inner diameter of the major axis in an oval cross-section (mm), a1 is outer diameter of the minor axis in an oval cross-section (mm), and a2 is inner diameter of the minor axis in an oval cross-section (mm).
- (3)
- Bending stress (BS, g mm−2): BS = M×10/SM.
4.3.5. Lignin Determination
Lignin Content
Enzyme Extraction and Assays
Expression of Genes Involved in the Synthesis of Lignin
4.3.6. Determination of Cellulose Content
4.3.7. Microstructure of the Basal Second Internode of Stem
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liu, W.Y.; Fan, X.H.; Liu, Y.Y.; Bao, S.Y.; Lu, Y.Y.; Gai, D.S.; Fu, X.K.; Du, J.; Guo, L.Y.; Zhang, Q.; et al. Relationship between characteristics of basal internodes and lodging and its physiological mechanism in direct-seeded rice. J. Agron. Crop Sci. 2023, 209, 632–650. [Google Scholar] [CrossRef]
- Kobayashi, K.; Wang, X.; Wang, W. Genetically Modified Rice Is Associated with Hunger, Health, and Climate Resilience. Foods 2023, 14, 2776. [Google Scholar] [CrossRef]
- Liang, C.; Li, Y.; Zhang, K.; Wu, Z.; Liu, J.; Liu, J.; Zhou, C.; Wang, S.; Li, F.; Sui, G. Selection and Yield Formation Characteristics of Dry Direct Seeding Rice in Northeast China. Plants 2023, 12, 3496. [Google Scholar] [CrossRef] [PubMed]
- Farooq, M.; Siddique, K.H.M.; Rehman, H.; Aziz, T.; Lee, D.J.; Wahid, A. Rice direct seeding: Experiences, challenges and opportunities. Soil Till. Res. 2011, 111, 87–98. [Google Scholar] [CrossRef]
- Liu, H.; Hussain, S.; Zheng, M.; Peng, S.; Huang, J.; Cui, K.; Nie, L. Dry direct-seeded rice as an alternative to transplanted-flooded rice in Central China. Agron. Sustain. Dev. 2015, 35, 285–294. [Google Scholar] [CrossRef]
- Wang, W.Q.; Peng, S.B.; Liu, H.Y.; Tao, Y.; Huang, J.L.; Cui, K.H.; Nie, L.X. The possibility of replacing puddled transplanted flooded rice with dry seeded rice in central China: A review. Field Crops Res. 2017, 214, 310–320. [Google Scholar] [CrossRef]
- Rao, A.N.; Nagamani, A. Available technologies and future research challenges for managing weeds in dry-seeded rice in India. In Proceedings of the 21st Asian Pacific Weed Science Society (APWSS) Conference, Colombo, Sri Lanka, 2–6 October 2007; pp. 391–401. [Google Scholar]
- Gianessi, L.; Silvers, C.; Sankula, S.; Carpenter, J. Plant Biotechnology: Current and Potential Impact for Im-proving Pest Management in U.S. Agriculture: Case Study 27, Herbicide Tolerant Rice; National Centre for Food and Agricultural Policy: Washington, DC, USA, 2002. [Google Scholar]
- Pandey, S.; Velasco, L. Economics of direct seeding in Asia: Patterns of adoption and research priorities. In Direct Seeding: Research Strategies and Opportunities; International Rice Research Institute: Los Baños, Philippines, 2002; pp. 3–14. [Google Scholar]
- Niu, Y.N.; Chen, T.X.; Zhao, C.C.; Zhou, M.X. Lodging prevention in cereals: Morphological, biochemical, anatomical traits and their molecular mechanisms, management and breeding strategies. Field Crop. Res. 2022, 289, 108733. [Google Scholar] [CrossRef]
- Khobra, R.; Sareen, S.; Meena, B.K.; Kumar, A.; Tiwari, V.; Singh, G.P. Exploring the traits for lodging tolerance in wheat genotypes: A review. Physiol. Mol. Biol. Plants 2019, 25, 589–600. [Google Scholar] [CrossRef]
- Zhang, R.; Jia, Z.F.; Ma, X.; Ma, H.L.; Zhao, Y.W. Characterising the morphological characters and carbohydrate metabolism of oat culms and their association with lodging resistance. Plant Biol. 2020, 22, 267–276. [Google Scholar] [CrossRef]
- Lang, Y.Z.; Yang, X.D.; Wang, M.E.; Zhu, Q.S. Effects of lodging at different filling stages on rice yield and grain quality. Rice Sci. 2012, 19, 315–319. [Google Scholar] [CrossRef]
- Xing, Z.P.; Wu, P.; Zhu, M.; Qian, H.J.; Cao, W.W.; Hu, Y.J.; Guo, B.W.; Wei, H.Y.; Xu, K.; Dai, Q.G.; et al. Effect of mechanized planting methods on plant type and lodging resistance of different rice varieties. Trans. Chin. Soc. Agric. Eng. 2017, 33, 52–62. [Google Scholar]
- Peng, D.L.; Chen, X.G.; Yin, Y.P.; Lu, K.L.; Yang, W.B.; Tang, Y.H.; Wang, Z.L. Lodging resistance of winter wheat (Triticum aestivum L.): Lignin accumulation and its related enzymes activities due to the application of paclobutrazol or gibberellin acid. Field Crops Res. 2014, 157, 1–7. [Google Scholar] [CrossRef]
- Zhang, W.J.; Yao, X.; Duan, X.J.; Liu, Q.M.; Tang, Y.Q.; Li, J.Y.; Li, G.H.; Ding, Y.F.; Liu, Z.H. Foliar application uniconazole enhanced lodging resistance of hybrid indica rice by altering basal stem quality under poor light stress. Agron. J. 2021, 114, 524–544. [Google Scholar] [CrossRef]
- Dong, X.C.; Qian, T.F.; Chu, J.P.; Zhang, X.; Liu, Y.J.; Dai, X.L.; He, M.R. Late sowing enhances lodging resistance of wheat plant via improving biosynthesis and accumulation of lignin and cellulose. J. Integr. Agric. 2023, 22, 1351–1365. [Google Scholar] [CrossRef]
- Yang, H.; Huang, J.; Ye, Y.; Xu, Y.; Xiao, Y.; Chen, Z.; Li, X.; Ma, Y.; Lu, T.; Rao, Y. Research Progress on Mechanical Strength of Rice Stalks. Plants 2024, 13, 1726. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.N.; Tanveer, M.; Rehman, A.U.; Anjum, S.A.; Iqbal, J.; Ahmad, R. Lodging stress in cereal-effects and management: An overview. Environ. Sci. Pollut. Res. 2017, 24, 5222–5237. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.Y.; Le, X.; LI, X.X.; Yang, G.D.; Wang, F.; Peng, S.B. Grain yield and lodging-related traits of ultrashort-duration varieties for direct-seeded and double-season rice in Central China. J. Integr. Agric. 2022, 21, 2888–2899. [Google Scholar] [CrossRef]
- Xu, S.; Zhang, M.; Ye, J.; Hu, D.; Zhang, Y.; Li, Z.; Liu, J.; Sun, Y.; Wang, S.; Yuan, X.; et al. Brittle culm 25, which encodes anUDP-xylose synthase, affects cell wall properties in rice. Crop. J. 2023, 11, 733–743. [Google Scholar] [CrossRef]
- Wang, C.; Hu, D.; Liu, X.B.; She, H.Z.; Ruan, R.W.; Yang, H.; Yi, Z.L.; Wu, D.Q. Effects of uniconazole on the lignin metabolism and lodging resistance of culm in common buckwheat (Fagopyrum esculentum M.). Field Crop. Res. 2015, 180, 46–53. [Google Scholar] [CrossRef]
- Ahmad, I.; Kamran, M.; Ali, S.; Bilegjargal, B.; Cai, T.; Ahmad, S.; Meng, X.P.; Su, W.N.; Liu, T.N.; Han, Q.F. Uniconazole application strategies to improve lignin biosynthesis, lodging resistance and production of maize in semiarid regions. Field Crop Res. 2018, 222, 66–77. [Google Scholar] [CrossRef]
- Wang, W.X.; Du, J.; Zhou, Y.Z.; Zeng, Y.J.; Tan, X.M.; Pan, X.H.; Shi, Q.H.; Wu, Z.M.; Zeng, Y.H. Effects of different mechanical direct seeding methods on grain yield and lodging resistance of early indica rice in South China. J. Integr. Agric. 2021, 20, 1204–1215. [Google Scholar] [CrossRef]
- Huber, H.; Brouwer, J.; Wettberg, E.J.; During, H.J.; Anten, N.P.R. More cells, bigger cells or simply reorganization? Alternative mechanisms leading to changed internode architecture under contrasting stress regimes. New Phytol. 2013, 201, 193–204. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wu, L.; Wu, X.; Ding, Y.; Li, G.; Li, J.; Weng, F.; Liu, Z.; Tang, S.; Ding, C.; et al. Lodging resistance of Japonica rice (Oryza sativa L.): Morphological and anatomical traits due to top-dressing nitrogen application rates. Rice 2016, 9, 31. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.M.; Liu, X.; Zhang, Y.K.; Huang, K.H.; Li, Y.S.; Nie, J.; She, H.Z.; Ruan, R.W.; Yuan, X.H.; Yi, Z.L. Effects of uniconazole or gibberellic acid application on the lignin metabolism in relation to lodging resistance of culm in common buckwheat (Fagopyrum esculentum M.). J. Agron. Crop Sci. 2018, 204, 414–423. [Google Scholar] [CrossRef]
- Lv, R.J.; Zhang, W.J.; Xie, X.B.; Wang, Q.J.; Gao, K.G.; Zeng, Y.H.; Zeng, Y.J.; Pan, X.H.; Shang, Q.Y. Foliar application uniconazole enhanced lodging resistance of high-quality indica rice (Oryza sativa L.) by altering anatomical traits, cell structure and endogenous hormones. Field Crops Res. 2022, 277, 108425. [Google Scholar] [CrossRef]
- Desta, B.; Amare, G. Paclobutrazol as a plant growth regulator. Chem. Biol. Technol. Agric. 2021, 8, 1. [Google Scholar] [CrossRef]
- Rady, M.; Gaballah, S. Improving barley yield grown under water stress conditions. Res. J. Recent. Sci. 2012, 1, 1–6. [Google Scholar]
- Xing, P.P.; Duan, M.Y.; Liu, Y.H.; Mo, Z.W.; Lai, R.F.; Tang, X.R. Enhancement of Yield, Grain Quality Characters, 2-Acetyl-1-Pyrroline Content, and Photosynthesis of Fragrant Rice Cultivars by Foliar Application of Paclobutrazol. Plant Growth Regul. 2022, 42, 748–758. [Google Scholar] [CrossRef]
- Zhao, J.H.; Lai, H.J.; Bi, C.; Zhao, M.J.; Liu, Y.L.; Li, X.D.; Yang, D.Q. Effects of paclobutrazol application on plant architecture, lodging resistance, photosynthetic characteristics, and peanut yield at different single-seed precise sowing densities. Crop J. 2023, 11, 301–303. [Google Scholar] [CrossRef]
- Kamran, M.; Ahmad, S.; Ahmad, I.; Hussain, I.; Meng, X.P.; Zhang, X.D.; Javed, T.; Ullah, M.; Ding, R.X.; Xu, P.Z.; et al. Paclobutrazol application favors yield improvement of maize under semiarid regions by delaying leaf senescence and regulating photosynthetic capacity and antioxidant system during grain-filling stage. Agronomy 2020, 10, 187. [Google Scholar] [CrossRef]
- Kamran, M.; Ahmad, I.; Wu, X.R.; Liu, T.N.; Ding, R.X.; Han, Q.F. Application of paclobutrazol: A strategy for inducing lodging resistance of wheat through mediation of plant height, stem physical strength, and lignin biosynthesis. Environ. Sci. Pollut. Res. 2018, 25, 29366–29378. [Google Scholar] [CrossRef]
- Kamran, M.; Wennan, S.; Ahmad, I.; Meng, X.P.; Cui, W.W.; Zhang, X.D.; Mou, S.W.; Khan, A.; Han, Q.F.; Liu, T.N. Application of paclobutrazol affect maize grain yield by regulating root morphological and physiological characteristics under a semi-arid region. Sci. Rep. 2018, 8, 4815–4818. [Google Scholar] [CrossRef]
- Gai, D.S.; Liu, W.Y.; Liang, J.N.; Guo, L.Y.; Geng, Y.Q.; Zhang, Q.; Du, J.; Gao, J.Q.; Shao, X.W. The Effects of Paclobutrazol Seed Soaking on Biomass Production and Yield Formation in Direct-Seeded Rice. Agronomy 2023, 13, 1402. [Google Scholar] [CrossRef]
- Khanna, V.K. Relationship of lodging resistance yield to anatomical characters of stem in wheat [Triticum spp.], triticale and rye. Wheat. Inf. Serv. 1991, 73, 19–24. [Google Scholar]
- Zhang, M.C.; Liu, Y.Y.; Luo, S.G.; Peng, X.L.; Chen, L.N.; Li, Z.Y.; Li, J. Effects of integrated nutrient management on lodging resistance of rice in cold area. Sci. Agric. Sin. 2010, 43, 4536–4542. [Google Scholar]
- Zhong, X.H.; Liang, K.M.; Peng, B.L.; Tian, K.; Li, X.J.; Huang, N.R.; Liu, Y.Z.; Pan, J.F. Basal internode elongation of rice as affected by light intensity and leaf area. Crop J. 2019, 8, 62–70. [Google Scholar] [CrossRef]
- Ahmad, I.; Kamran, M.; Meng, X.P.; Ali, S.; Ahmad, S.; Gao, Z.Q.; Liu, T.N.; Han, Q.F. Hormonal changes with uniconazole trigger canopy apparent photosynthesis and grain filling in wheat crop in a semi-arid climate. Protoplasma 2021, 258, 139–150. [Google Scholar] [CrossRef]
- Cui, S.X.; Huang, H.Y.; Wang, D. Uniconazole induced morphological change and its relation to endogenous hormones in wheat seedings. Acta Bot. Boreali-Occident. Sin. 1997, 17, 5–11. [Google Scholar]
- Voorend, W.; Nelissen, H.; Vanholme, R.; Vliegher, A.D.; Breusegem, F.V.; Boerjan, W.; Rold’an-Ruiz, I.; Muylle, H.; Inz’e, D. Overexpression of GA20-OXIDASE1 impacts plant height, biomass allocation and saccharification efficiency in maize. Plant Biotechnol. J. 2016, 14, 997–1007. [Google Scholar] [CrossRef]
- Wang, X.; Yu, M.Y.; Tao, L.X.; Huang, X.L. Effect of pentefezole on the endogenous IAA content in rice seedings. Acta Bot. Sin. 1997, 39, 629–633. [Google Scholar]
- Li, C.H.; Li, W.Q.; Long, Y.L.; Jin, M.; Chang, Y.L.; Cui, H.X.; Sun, S.F.; Li, Y.; Wang, Z.L. Mixed cropping increases grain yield and lodging resistance by improving the canopy light environment of wheat populations. Eur. J. Agron. 2023, 147, 126849. [Google Scholar] [CrossRef]
- Li, L.; He, L.X.; Li, Y.X.; Wang, Y.F.; Ashraf, U.; Hamoud, U.A.; Hu, X.; Wu, T.Y.; Tang, X.R.; Pan, X.G. Deep fertilization combined with straw incorporation improved rice lodging resistance and soil properties of paddy fields. Eur. J. Agron. 2023, 142, 126659. [Google Scholar] [CrossRef]
- Liu, C.; Zheng, S.; Gui, J.S.; Fu, C.J.; Yu, H.S.; Song, D.L.; Shen, J.H.; Qin, P.; Liu, X.M.; Han, B.; et al. Shortened basal internodes encodes a Gibberellin 2-Oxidase and contributes to lodging resistance in rice. Mol. Plant. 2018, 11, 288–299. [Google Scholar] [CrossRef] [PubMed]
- Li, W.Q.; Han, M.M.; Pang, D.W.; Chen, J.; Wang, Y.Y.; Dong, H.H.; Chang, Y.L.; Jin, M.; Luo, Y.L.; Li, Y.; et al. Characteristics of lodging resistance of high-yield winter wheat as affected by nitrogen rate and irrigation managements. J. Integr. Agric. 2022, 21, 1290–1309. [Google Scholar] [CrossRef]
- Yin, X.; Tao, Z.; Huang, M.; Zou, Y. Increasing wall thickness is more effective than increasing diameter for improving breaking resistance of rice internode. J. Plant Biol. Crop Res. 2018, 1, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.Y.; Cao, Z.Q.; Zhou, Q.; Chen, J.; Xu, G.W.; Gu, J.F.; Liu, L.J.; Wang, Z.Q.; Yang, J.C.; Zhang, H. Grain filling characteristics and their relations with endogenous hormones in large- and small-grain mutants of rice. PLoS ONE 2016, 11, e0165321. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.C.; Lin, C.H.; Jiang, Z.R.; Yan, F.Y.; Li, Z.Y.; Tang, X.N.; Yang, F.; Ding, Y.F.; Li, W.W.; Liu, Z.H.; et al. Uniconazole enhances lodging resistance by increasing structural carbohydrate and sclerenchyma cell wall thickness of japonica rice (Oryza sativa L.) under shading stress. Environ. Exp. Bot. 2023, 206, 105145. [Google Scholar] [CrossRef]
- Zhang, W.J.; Wu, L.M.; Ding, Y.F.; Yao, X.; Wu, X.R.; Weng, F.; Li, G.H.; Liu, Z.H.; Tang, S.; Ding, C.Q.; et al. Nitrogen fertilizer application affects lodging resistance by altering secondary cell wall synthesis in japonica rice (Oryza sativa L.). J. Plant Res. 2017, 130, 859–871. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.G.; Shi, C.Y.; Yin, Y.P.; Wang, Z.L.; Shi, Y.H.; Peng, D.L.; Ni, Y.L.; Cai, T. Relationship between lignin metabolism and lodging resistance in wheat. Acta Agron. Sin. 2011, 37, 1616–1622. [Google Scholar] [CrossRef]
- Boerjan, W.; Ralph, J.; Baucher, M. Lignin biosynthesis. Annu. Rev. Plant Biol. 2003, 54, 519–546. [Google Scholar] [CrossRef] [PubMed]
- Fetherolf, M.M.; Levy-Booth, D.J.; Navas, L.E.; Liu, J.; Grigg, J.C.; Wilson, A.; Katahira, R.; Beckham, G.T.; Mohn, W.W.; Eltis, L.D. Characterization of alkylguaiacol-degrading cytochromes P450 for the biocatalytic valorization of lignin. Proc. Natl. Acad. Sci. USA 2020, 117, 25771–25778. [Google Scholar] [CrossRef] [PubMed]
- Fang, L.; Xu, X.; Li, J.; Zheng, F.; Li, M.Z.; Yan, J.W.; Li, Y.; Zhang, X.H.; Li, L.; Ma, G.H.; et al. Transcriptome analysis provides insights into the non-methylated lignin synthesis in paphiopedilum armeniacum seed. BMC Genom. 2020, 21, 524. [Google Scholar] [CrossRef] [PubMed]
- Boudet, A.M.; Kajita, S.; Grima-Pettenati, J.; Goffner, D. Lignins and lignocellulosic-s: A better control of synthesis for new and improved uses. Trends Plant Sci. 2003, 8, 576–581. [Google Scholar] [CrossRef] [PubMed]
- Ookawa, T.; Ishihara, K. Varietal difference of physical characteristics of the culm related to lodging resistance in paddy rice. Jpn. J. Crop Sci. 1992, 61, 419–425. [Google Scholar] [CrossRef]
- Islam, M.S.; Peng, S.B.; Visperas, R.M.; Ereful, N.; Bhuiya, M.S.U.; Julfiquar, A.W. Lodging-related morphological traits of hybrid rice in a tropical irrigated ecosystem. Field Crops Res. 2007, 101, 240–248. [Google Scholar] [CrossRef]
- Ookawa, T.; Hobo, T.; Yano, M.; Murata, K.; Ando, T.; Miura, H.; Asano, K.; Ochiai, Y.; Ikeda, M.; Nishitani, R.; et al. New approach for rice improvement using a pleiotropic QTL gene for lodging resistance and yield. Nat. Commun. 2010, 1, 132. [Google Scholar] [CrossRef] [PubMed]
- Syros, T.; Yupsanis, T.; Zafiriadis, H.; Economou, A. Activity and isoforms of peroxidases, lignin and anatomy, during adventitious rooting in cuttings of Ebenus cretica L. J. Plant Physiol. 2004, 161, 69–77. [Google Scholar] [CrossRef]
- Assis, J.S.; Maldonado, R.; Muñoz, T.; Escribano, M.I.; Merodio, C. Effect of high carbon dioxide concentration on PAL activity and phenolic contents in ripening cherimoya fruit. Postharvest Biol. Technol. 2001, 23, 33–39. [Google Scholar] [CrossRef]
- Morrison, T.A.; Kessler, J.R.; Hatfield, R.D.; Buxton, D.R. Activity of two lignin biosynthesis enzymes during development of a maize internode. J. Sci. Food Agric. 1994, 65, 133–139. [Google Scholar] [CrossRef]
- Updegraff, D.M. Semimicro determination of cellulose in biological materials. Anal. Biochem. 1969, 32, 420–424. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.Y.; Jin, M.; Luo, Y.L.; Chang, Y.L.; Zhu, J.K.; Li, Y.; Wang, Z.L. Effects of irrigation on stem lignin and breaking strength of winter wheat with different planting densities. Field Crops Res. 2022, 208, 108518. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Os4CL3 | GCCGTCTCCTCGTGTAAC | TTGGCCTTAGCTGCTTTT |
OsCAD2 | CGACCAGAAGTTTGTGGTGAA | GAAGTGCTTCAGTGGGCTGTA |
OsCAD7 | TCACCGGGGTGGTGACCGAG | CCGCCGCAGGTGTTCACCAT |
OsPAL | ACCGCTTCGTGTATCTTCAG | AAGGATGGAATCGAGTAGCA |
OsCOMT | GAAGGTGGTGGTGGTGGAGT | GCGTTGGCGTAGATGTAGGTG |
OsActin | CAATCGTGAGAAGATGACCC | GTCCATCAGGAAGCTCGTAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, W.; Cui, J.; Ran, C.; Zhang, Y.; Liang, J.; Shao, X.; Zhang, Q.; Geng, Y.; Guo, L. Paclobutrazol Enhanced Stem Lodging Resistance of Direct-Seeded Rice by Affecting Basal Internode Development. Plants 2024, 13, 2289. https://doi.org/10.3390/plants13162289
Liu W, Cui J, Ran C, Zhang Y, Liang J, Shao X, Zhang Q, Geng Y, Guo L. Paclobutrazol Enhanced Stem Lodging Resistance of Direct-Seeded Rice by Affecting Basal Internode Development. Plants. 2024; 13(16):2289. https://doi.org/10.3390/plants13162289
Chicago/Turabian StyleLiu, Weiyang, Jiehao Cui, Cheng Ran, Yuchen Zhang, Jianuo Liang, Xiwen Shao, Qiang Zhang, Yanqiu Geng, and Liying Guo. 2024. "Paclobutrazol Enhanced Stem Lodging Resistance of Direct-Seeded Rice by Affecting Basal Internode Development" Plants 13, no. 16: 2289. https://doi.org/10.3390/plants13162289