Enhancing Resistance to Cercospora Leaf Spot in Mung Bean (Vigna radiata L.) through Bradyrhizobium sp. DOA9 Priming: Molecular Insights and Bio-Priming Potential
Abstract
:1. Introduction
2. Results
2.1. Bradyrhizobium sp. DOA9-Mediated Priming Triggers Brown Spot Resistance in Mung Bean
2.2. Bio-Priming by Bradyrhizobium sp. DOA9 Triggers Plant Immunity
2.3. Hydrogen Peroxide and Phenolic Content and Enzyme Activities
2.4. The Impact of Bradyrhizobium sp. DOA9 Exopolysaccharide (EPS) on Induced Resistance of Plants against C. canescens
2.5. The Impact of Bradyrhizobium sp. Type 3 Secretion System (T3SS) on Resistance of Plants against C. canescens
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Preparation of Bradyrhizobium sp. Strain DOA9 Inoculum, Cercospora Canescens, and Exopolysaccharide (EPS) Production
4.3. Experimental Design
4.4. Evaluation of C. canescens DNA Copy Number and Hyphae Colonization on Infected Leaves
4.5. Total RNA Extraction and qRT-PCR Analysis
4.6. Determination of Enzyme Activities and Total H2O2 and Phenolic Compound Contents
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Dahiya, P.K.; Linnemann, A.R.; Van Boekel, M.A.J.S.; Khetarpaul, N.; Grewal, R.B.; Nout, M.J.R. Mung Bean: Technological and Nutritional Potential. Crit. Rev. Food Sci. Nutr. 2015, 55, 670–688. [Google Scholar] [CrossRef] [PubMed]
- Hou, D.; Yousaf, L.; Xue, Y.; Hu, J.; Wu, J.; Hu, X.; Feng, N.; Shen, Q. Mung Bean (Vigna radiata L.): Bioactive Polyphenols, Polysaccharides, Peptides, and Health Benefits. Nutrients 2019, 11, 1238. [Google Scholar] [CrossRef]
- Kumari, R. Integrated Management against Root-Rot of Mungbean [Vigna radiata (L.) Wilczek] Incited by Macrophomina Phaseolina. J. Plant Pathol. Microb. 2012, 3, 136. [Google Scholar] [CrossRef]
- Sarkar, M.; Datta, S.; Kundagrami, S. Global Climate Change and Mung Bean Production: A Roadmap towards Future Sustainable Agriculture. In Sustaining Future Food Security in Changing Environment; Nova Science Publishers Inc.: New York, NY, USA, 2017; pp. 99–119. [Google Scholar]
- Sehrawat, N.; Yadav, M.; Sharma, A.; Kumar, S.; Singh, M.; Kumar, V.; Rakesh, R.; Sharma, P.; Singh, R. Mungbean (Vigna radiata L. Wilczek) as Functional Food, Agronomic Importance and Breeding Approach for Development of Climate Resilience: Current Status and Future Perspectives. Asian J. Biol. Life Sci. 2021, 10, 87–92. [Google Scholar] [CrossRef]
- Anjum, M.S.; Ahmed, Z.I.; Rauf, C.A. Effect of Rhizobium Inoculation and Nitrogen Fertilizer on Yield and Yield Components of Mung bean. Int. J. Agric. Biol. 2006, 8, 238–240. [Google Scholar]
- Baza, M.; Shanka, D.; Bibiso, M. Agronomic and Economic Performance of Mung Bean (Vigna radiata L.) Varieties in Response to Rates of Blended NPS Fertilizer in Kindo Koysha District, Southern Ethiopia. Open Life Sci. 2022, 17, 1053–1063. [Google Scholar] [CrossRef]
- Chand, R.; Pal, C.; Singh, V.; Kumar, M.; Singh, V.; Chowdappa, P. Draft Genome Sequence of Cercospora canescens: A Leaf Spot Causing Pathogen. Curr. Sci. 2015, 109, 2103. [Google Scholar] [CrossRef]
- Sahoo, J.P.; Mahapatra, M.; Mohapatra, M.; Samal, K.C. Morpho-Genetic Assessment and Dissecting the Genetic Architecture for Cercospora Leaf Spot (CLS) Resistance in Mung Bean [Vigna radiata (L.) Wilczek]. Physiol. Mol. Plant Pathol. 2023, 128, 102178. [Google Scholar] [CrossRef]
- Yundaeng, C.; Somta, P.; Chen, J.; Yuan, X.; Chankaew, S.; Chen, X. Fine mapping of QTL conferring Cercospora leaf Spot disease resistance in mungbean revealed TAF5 as candidate gene for the resistance. Theor. Appl. Genet. 2021, 134, 701–714. [Google Scholar] [CrossRef]
- Chauhan, M.P.; Gupta, R.P. Genetics of Cercospora leaf spot disease resistance in mungbean {Vigna radiata (L.) Wilczek}. Legume Res. Int. J. 2004, 27, 155–156. [Google Scholar]
- Das, A.; Gupta, S.; Parihar, A.K.; Singh, D.; Chand, R.; Pratap, A.; Singha, K.D.; Kushwaha, K.P.S. Delineating Genotype × Environment Interactions towards durable resistance in mungbean against Cercospora leaf spot (Cercospora canescens) using GGE biplot. Plant Breed. 2020, 139, 639–650. [Google Scholar] [CrossRef]
- Fiodor, A.; Ajijah, N.; Dziewit, L.; Pranaw, K. Biopriming of seed with Plant Growth-Promoting Bacteria for improved germination and seedling growth. Front. Microbiol. 2023, 14, 1142966. [Google Scholar] [CrossRef] [PubMed]
- Mitra, D.; Mondal, R.; Khoshru, B.; Shadangi, S.; Das Mohapatra, P.K.; Panneerselvam, P. Rhizobacteria mediated seed bio-priming triggers the resistance and plant growth for sustainable crop production. Curr. Res. Microb. Sci. 2021, 2, 100071. [Google Scholar] [CrossRef] [PubMed]
- Bigeard, J.; Colcombet, J.; Hirt, H. Signaling Mechanisms in Pattern-Triggered Immunity (PTI). Mol. Plant 2015, 8, 521–539. [Google Scholar] [CrossRef] [PubMed]
- Jones, J.D.G.; Dangl, J.L. The Plant Immune System. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef]
- Nguyen, Q.-M.; Iswanto, A.B.B.; Son, G.H.; Kim, S.H. Recent Advances in Effector-Triggered Immunity in Plants: New Pieces in the Puzzle Create a Different Paradigm. Int. J. Mol. Sci. 2021, 22, 4709. [Google Scholar] [CrossRef]
- Tena, G. PTI and ETI are one. Nat. Plants 2021, 7, 1527. [Google Scholar] [CrossRef]
- Coll, N.S.; Epple, P.; Dangl, J.L. Programmed cell death in the plant immune system. Cell Death Differ. 2011, 18, 1247–1256. [Google Scholar] [CrossRef]
- Fu, Z.Q.; Dong, X. Systemic Acquired Resistance: Turning Local Infection into Global Defense. Annu. Rev. Plant Biol. 2013, 64, 839–863. [Google Scholar] [CrossRef]
- Hõrak, H. Zones of Defense? SA Receptors Have It Under Control. Plant Cell 2020, 32, 3658–3659. [Google Scholar] [CrossRef]
- Vlot, A.C.; Sales, J.H.; Lenk, M.; Bauer, K.; Brambilla, A.; Sommer, A.; Chen, Y.; Wenig, M.; Nayem, S. Systemic Propagation of Immunity in Plants. New Phytol. 2021, 229, 1234–1250. [Google Scholar] [CrossRef]
- Ali, S.; Ganai, B.A.; Kamili, A.N.; Bhat, A.A.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Islam, S.T.; Mushtaq, M.; Yadav, P.; et al. Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 2018, 212–213, 29–37. [Google Scholar] [CrossRef]
- Chen, J.; Clinton, M.; Qi, G.; Wang, D.; Liu, F.; Fu, Z.Q. Reprogramming and remodeling: Transcriptional and epigenetic regulation of salicylic acid-mediated plant defense. J. Exp. Bot. 2020, 71, 5256–5268. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Li, M.; Qi, G.; Zhao, M.; Liu, L.; Zhang, J.; Chen, G.; Wang, D.; Liu, F.; Fu, Z.Q. Two interacting transcriptional coactivators cooperatively control plant immune responses. Sci. Adv. 2021, 7, eabl7173. [Google Scholar] [CrossRef] [PubMed]
- Ezzat, A.; Szabó, Z.; Nyéki, J. Induce the plant resistance to pathogen infection. Int. J. Hortic. Sci. 2014, 20, 89–93. [Google Scholar] [CrossRef]
- Yassin, M.; Ton, J.; Rolfe, S.A.; Valentine, T.A.; Cromey, M.; Holden, N.; Newton, A.C. The rise, fall and resurrection of chemical induced resistance agents. Pest. Manag. Sci. 2021, 77, 3900–3909. [Google Scholar] [CrossRef]
- Yu, Y.; Gui, Y.; Li, Z.; Jiang, C.; Guo, J.; Niu, D. Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes. Plants 2022, 11, 386. [Google Scholar] [CrossRef]
- Niu, D.-D.; Liu, H.-X.; Jiang, C.-H.; Wang, Y.-P.; Wang, Q.-Y.; Jin, H.-L.; Guo, J.-H. The Plant Growth–Promoting Rhizobacterium Bacillus cereus AR156 Induces Systemic Resistance in Arabidopsis thaliana by Simultaneously Activating Salicylate- and Jasmonate/Ethylene-Dependent Signaling Pathways. MPMI 2011, 24, 533–542. [Google Scholar] [CrossRef] [PubMed]
- Gourion, B.; Berrabah, F.; Ratet, P.; Stacey, G. Rhizobium–legume symbioses: The crucial role of plant immunity. Trends Plant Sci. 2015, 20, 186–194. [Google Scholar] [CrossRef]
- Kelly, S.J.; Muszyński, A.; Kawaharada, Y.; Hubber, A.M.; Sullivan, J.T.; Sandal, N.; Carlson, R.W.; Stougaard, J.; Ronson, C.W. Conditional Requirement for Exopolysaccharide in the Mesorhizobium-Lotus Symbiosis. Mol. Plant Microbe Interact. 2013, 26, 319–329. [Google Scholar] [CrossRef]
- Skorupska, A.; Janczarek, M.; Marczak, M.; Mazur, A.; Król, J. Rhizobial exopolysaccharides: Genetic control and symbiotic functions. Microb. Cell Fact. 2006, 5, 7. [Google Scholar] [CrossRef] [PubMed]
- Tampakaki, A.P. Commonalities and differences of T3SSs in rhizobia and plant pathogenic bacteria. Front. Plant Sci. 2014, 5, 114. [Google Scholar] [CrossRef]
- Yasuda, M.; Miwa, H.; Masuda, S.; Takebayashi, Y.; Sakakibara, H.; Okazaki, S. Effector-Triggered Immunity Determines Host Genotype-Specific Incompatibility in Legume–Rhizobium Symbiosis. Plant Cell Physiol. 2016, 57, 1791–1800. [Google Scholar] [CrossRef] [PubMed]
- Songwattana, P.; Noisangiam, R.; Teamtisong, K.; Prakamhang, J.; Teulet, A.; Tittabutr, P.; Piromyou, P.; Boonkerd, N.; Giraud, E.; Teaumroong, N. Type 3 Secretion System (T3SS) of Bradyrhizobium sp. DOA9 and Its Roles in Legume Symbiosis and Rice Endophytic Association. Front. Microbiol. 2017, 8, 1810. [Google Scholar] [CrossRef]
- Piromyou, P.; Songwattana, P.; Teamtisong, K.; Tittabutr, P.; Boonkerd, N.; Tantasawat, P.A.; Giraud, E.; Göttfert, M.; Teaumroong, N. Mutualistic co-evolution of T3SSs during the establishment of symbiotic relationships between Vigna radiata and Bradyrhizobia. Microbiologyopen 2019, 8, e00781. [Google Scholar] [CrossRef]
- Daub, M.E.; Briggs, S.P. Changes in Tobacco Cell Membrane Composition and Structure Caused by Cercosporin 1. Plant Physiol. 1983, 71, 763–766. [Google Scholar] [CrossRef]
- Morel, J.-B.; Dangl, J.L. The hypersensitive response and the induction of cell death in plants. Cell Death Differ. 1997, 4, 671–683. [Google Scholar] [CrossRef]
- Yang, Z.; Zhi, P.; Chang, C. Priming Seeds for the Future: Priming seeds for the future: Plant immune memory and application in crop protection. Front. Plant Sci. 2022, 13, 961840. [Google Scholar] [CrossRef]
- Ding, L.-N.; Li, Y.-T.; Wu, Y.-Z.; Li, T.; Geng, R.; Cao, J.; Zhang, W.; Tan, X.-L. Plant Disease Resistance-Related Signaling Pathways: Recent Progress and Future Prospects. Int. J. Mol. Sci. 2022, 23, 16200. [Google Scholar] [CrossRef]
- Lu, H.; Zhang, C.; Albrecht, U.; Shimizu, R.; Wang, G.; Bowman, K.D. Overexpression of a citrus NDR1 ortholog increases disease resistance in Arabidopsis. Front. Plant Sci. 2013, 4, 157. [Google Scholar] [CrossRef]
- Shapiro, A.D.; Zhang, C. The Role of NDR1 in Avirulence Gene-Directed Signaling and Control of Programmed Cell Death in Arabidopsis. Plant Physiol. 2001, 127, 1089–1101. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Qiu, L.; Liu, Y.; Zhang, H.; Zhang, Y.; Qin, Y.; Mao, Y.; Zhou, M.; Du, X.; Qin, Z.; et al. Pto Interaction Proteins: Critical Regulators in Plant Development and Stress Response. Front. Plant Sci. 2022, 13, 774229. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.-Q.; Wildermuth, M.C.; Chakravarthy, S.; Loh, Y.-T.; Yang, C.; He, X.; Han, Y.; Martin, G.B. Tomato Transcription Factors Pti4, Pti5, and Pti6 Activate Defense Responses When Expressed in Arabidopsis. Plant Cell 2002, 14, 817–831. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.Z.; Yun, H.K. Three transcripts of EDS1-like genes respond differently to Vitis flexuosa infection. J. Plant Biotechnol. 2017, 44, 125–134. [Google Scholar] [CrossRef]
- Li, S.; Zhao, J.; Zhai, Y.; Yuan, Q.; Zhang, H.; Wu, X.; Lu, Y.; Peng, J.; Sun, Z.; Lin, L.; et al. The hypersensitive induced reaction 3 (HIR3) gene contributes to plant basal resistance via an EDS1 and salicylic acid-dependent pathway. Plant J. 2019, 98, 783–797. [Google Scholar] [CrossRef]
- Niderman, T.; Genetet, I.; Bruyère, T.; Gees, R.; Stintzi, A.; Legrand, M.; Fritig, B.; Mösinger, E. Pathogenesis-Related PR-1 Proteins Are Antifungal. Isolation and Characterization of Three 14-Kilodalton Proteins of Tomato and of a Basic PR-1 of Tobacco with Inhibitory Activity against Phytophthora infestans. Plant Physiol. 1995, 108, 17–27. [Google Scholar] [CrossRef]
- Akbudak, M.A.; Yildiz, S.; Filiz, E. Pathogenesis related protein-1 (PR-1) genes in tomato (Solanum lycopersicum L.): Bioinformatics analyses and expression profiles in response to drought stress. Genomics 2020, 112, 4089–4099. [Google Scholar] [CrossRef]
- Du, Y.; Amin, N.; Ahmad, N.; Zhang, H.; Zhang, Y.; Song, Y.; Fan, S.; Wang, P. Identification of the Function of the Pathogenesis-Related Protein GmPR1L in the Resistance of Soybean to Cercospora sojina Hara. Genes 2023, 14, 920. [Google Scholar] [CrossRef]
- Anisimova, O.K.; Shchennikova, A.V.; Kochieva, E.Z.; Filyushin, M.A. Pathogenesis-Related Genes of PR1, PR2, PR4, and PR5 Families Are Involved in the Response to Fusarium Infection in Garlic (Allium sativum L.). Int. J. Mol. Sci. 2021, 22, 6688. [Google Scholar] [CrossRef]
- Zhang, S.-B.; Zhang, W.-J.; Zhai, H.-C.; Lv, Y.-Y.; Cai, J.-P.; Jia, F.; Wang, J.-S.; Hu, Y.-S. Expression of a wheat β-1,3-glucanase in Pichia pastoris and its inhibitory effect on fungi commonly associated with wheat kernel. Protein Expr. Purif. 2019, 154, 134–139. [Google Scholar] [CrossRef]
- Sharma, A.; Tyagi, S.; Alok, A.; Singh, K.; Upadhyay, S.K. Thaumatin-like Protein Kinases: Molecular Characterization and Transcriptional Profiling in Five Cereal Crops. Plant. Sci. 2020, 290, 110317. [Google Scholar] [CrossRef]
- Sun, W.; Zhou, Y.; Movahedi, A.; Wei, H.; Zhuge, Q. Thaumatin-like protein(Pe-TLP)acts as a positive factor in transgenic poplars enhanced resistance to spots disease. Physiol. Mol. Plant Pathol. 2020, 112, 101512. [Google Scholar] [CrossRef]
- Kaur, A.; Kaur, S.; Kaur, A.; Sarao, N.K.; Sharma, D. Pathogenesis-Related Proteins and Their Transgenic Expression for Developing Disease-Resistant Crops: Strategies Progress and Challenges. In Plant Breeding—New Perspectives; IntechOpen: London, UK, 2022; pp. 6–8. [Google Scholar]
- Singh, N.K.; Kumar, K.R.R.; Kumar, D.; Shukla, P.; Kirti, P.B. Characterization of a Pathogen Induced Thaumatin-Like Protein Gene AdTLP from Arachis diogoi, a Wild Peanut. PLoS ONE 2013, 8, e83963. [Google Scholar] [CrossRef]
- Zamioudis, C.; Pieterse, C.M.J. Modulation of Host Immunity by Beneficial Microbes. MPMI 2012, 25, 139–150. [Google Scholar] [CrossRef]
- Weiberg, A.; Wang, M.; Lin, F.-M.; Zhao, H.; Zhang, Z.; Kaloshian, I.; Huang, H.-D.; Jin, H. Fungal Small RNAs Suppress Plant Immunity by Hijacking Host RNA Interference Pathways. Science 2013, 342, 118–123. [Google Scholar] [CrossRef] [PubMed]
- Hamamouch, N.; Li, C.; Seo, P.J.; Park, C.-M.; Davis, E.L. Expression of Arabidopsis pathogenesis-related genes during nematode infection. Mol. Plant Pathol. 2011, 12, 355–364. [Google Scholar] [CrossRef] [PubMed]
- Creelman, R.A.; Tierney, M.L.; Mullet, J.E. JJasmonic acid/methyl jasmonate accumulate in wounded soybean hypocotyls and modulate wound gene expression. Proc. Natl. Acad. Sci. USA 1992, 89, 4938–4941. [Google Scholar] [CrossRef]
- Johzuka-Hisatomi, Y.; Hoshino, A.; Mori, T.; Habu, Y.; Iida, S. Characterization of the Chalcone Synthase Genes Expressed in flowers of the Common and Japanese Morning Glories. Genes. Genet. Syst. 1999, 74, 141–147. [Google Scholar] [CrossRef]
- Wang, Z.; Yu, Q.; Shen, W.; El Mohtar, C.A.; Zhao, X.; Gmitter, F.G. Functional study of CHS gene family members in citrus revealed a novel CHS gene affecting the production of flavonoids. BMC Plant Biol. 2018, 18, 189. [Google Scholar] [CrossRef]
- Bechinger, C.; Giebel, K.F.; Schnell, M.; Leiderer, P.; Deising, H.B.; Bastmeyer, M. Optical Measurements of Invasive Forces Exerted by Appressoria of a Plant Pathogenic Fungus. Science 1999, 285, 1896–1899. [Google Scholar] [CrossRef]
- Huangfu, Y.; Pan, J.; Li, Z.; Wang, Q.; Mastouri, F.; Li, Y.; Yang, S.; Liu, M.; Dai, S.; Liu, W. Genome-wide identification of PTI1 family in Setaria italica and salinity-responsive functional analysis of SiPTI1–5. BMC Plant Biol. 2021, 21, 319. [Google Scholar] [CrossRef]
- Zhou, J.; Loh, Y.T.; Bressan, R.A.; Martin, G.B. The Tomato Gene Pti1 Encodes a Serine/Threonine Kinase That Is Phosphorylated by Pto and Is Involved in the Hypersensitive Response. Cell 1995, 83, 925–935. [Google Scholar] [CrossRef]
- Anthony, R.G.; Khan, S.; Costa, J.; Pais, M.S.; Bögre, L. The Arabidopsis Protein Kinase PTI1-2 Is Activated by Convergent Phosphatidic Acid and Oxidative Stress Signaling Pathways Downstream of PDK1 and OXI1. J. Biol. Chem. 2006, 281, 37536–37546. [Google Scholar] [CrossRef]
- Li, D.; Limwachiranon, J.; Li, L.; Zhang, L.; Xu, Y.; Fu, M.; Luo, Z. Hydrogen peroxide accelerated the lignification process of bamboo shoots by activating the phenylpropanoid pathway and programmed cell death in postharvest storage. Postharvest Biol. Technol. 2019, 153, 79–86. [Google Scholar] [CrossRef]
- Cook, D.; Dreyer, D.; Bonnet, D.; Howell, M.; Nony, E.; VandenBosch, K. Transient Induction of a Peroxidase Gene in Medicago Truncatula Precedes Infection by Rhizobium meliloti. Plant Cell 1995, 7, 43–55. [Google Scholar] [CrossRef]
- Mur, L.A.J.; Kenton, P.; Lloyd, A.J.; Ougham, H.; Prats, E. The hypersensitive response; the centenary is upon us but how much do we know? J. Exp. Bot. 2008, 59, 501–520. [Google Scholar] [CrossRef] [PubMed]
- Bai, S.; Dong, C.; Li, B.; Dai, H. A PR-4 gene identified from Malus domestica is involved in the defense responses against Botryosphaeria dothidea. Plant Physiol. Biochem. 2013, 62, 23–32. [Google Scholar] [CrossRef]
- Bravo, J.M.; Campo, S.; Murillo, I.; Coca, M.; San Segundo, B. Fungus- and wound-induced accumulation of mRNA containing a class II chitinase of the pathogenesis-related protein 4 (PR-4) family of maize. Plant Mol. Biol. 2003, 52, 745–759. [Google Scholar] [CrossRef]
- Ehrhardt, D.W.; Atkinson, E.M.; Long, S.R. Depolarization of Alfalfa Root Hair Membrane Potential by Rhizobium meliloti Nod Factors. Science 1992, 256, 998–1000. [Google Scholar] [CrossRef] [PubMed]
- Songwattana, P.; Boonchuen, P.; Piromyou, P.; Wongdee, J.; Greetatorn, T.; Inthaisong, S.; Alisha Tantasawat, P.; Teamtisong, K.; Tittabutr, P.; Boonkerd, N.; et al. Insights into Antifungal Mechanisms of Bacillus velezensis S141 against Cercospora Leaf Spot in Mungbean (V. radiata). Microb. Environ. 2023, 38, ME22079. [Google Scholar] [CrossRef]
- Wongdee, J.; Piromyou, P.; Songwattana, P.; Greetatorn, T.; Teaumroong, N.; Boonkerd, N.; Giraud, E.; Nouwen, N.; Tittabutr, P. Role of two RpoN in Bradyrhizobium sp. strain DOA9 in symbiosis and free-living growth. Front. Microbiol. 2023, 14, 1131860. [Google Scholar] [CrossRef]
- Kumar, R.; Pandey, M.; Chandra, R. Effect of relative humidity, temperature and fungicide on germination of conidia of Cercospora canescens caused the Cercospora leaf spot disease in mungbean. Arch. Phytopathol. Plant Prot. 2011, 44, 1635–1645. [Google Scholar] [CrossRef]
- Mendoza-Cano, F.; Sánchez-Paz, A. Development and Validation of a Quantitative Real-Time Polymerase Chain Assay for Universal Detection of the White Spot Syndrome Virus in Marine Crustaceans. Virol. J. 2013, 10, 186. [Google Scholar] [CrossRef] [PubMed]
- Koch, E.; Slusarenko, A. Arabidopsis Is Susceptible to Infection by a Downy Mildew Fungus. Plant Cell 1990, 2, 437–445. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ghosh, S.; Mitra, S.; Paul, A. Physiochemical Studies of Sodium Chloride on Mungbean (Vigna radiata L. Wilczek) and Its Possible Recovery with Spermine and Gibberellic Acid. Sci. World J. 2015, 2015, 858016. [Google Scholar] [CrossRef]
- Senthilkumar, M.; Amaresan, N.; Sankaranarayanan, A. Estimation of Peroxidase (POD). In Plant-Microbe Interactions: Laboratory Techniques; Senthilkumar, M., Amaresan, N., Sankaranarayanan, A., Eds.; Springer Protocols Handbooks; Springer: New York, NY, USA, 2021; pp. 123–125. [Google Scholar] [CrossRef]
- Kauffmann, S.; Legrand, M.; Geoffroy, P.; Fritig, B. Biological Function of ‘pathogenesis-Related’ Proteins: Four PR Proteins of Tobacco Have 1,3-β-Glucanase Activity. EMBO J. 1987, 6, 3209–3212. [Google Scholar] [CrossRef]
Bacterial Strains | Descriptions | Reference |
---|---|---|
Bradyrhizobium sp. DOA9 | Wild-type strain, isolated from paddy field using A. americana as trap legume | [35] |
ΩrhcN | rhcN mutant of DOA9 strain obtained by integration of pVO155-Sm-npt2-gfp; Smr Spr Kmr | [35] |
Gene Names | Primer Names | Sequence 5′ to 3′ |
Pti1-like tyrosine-protein kinase At3g15890 (Pti1) | Pti1.F PTi1.R | F: CAGCAGAAAGTGGCAGAGGA R: CGCTATAGTGTCGACCCCAC |
Pathogenesis-related genes transcriptional activator Pti5 (Pti5) | Pti5.F Pti5.R | F: AGGCCAATGCTCTCTCCAAC R: CTGGAAAGTGCCGAGCCATA |
Pathogenesis-related genes transcriptional activator Pti6-like (Pti6) | Pti6.F Pti6.R | F: CTGACTCCGACCACGAACAA R: TTGGGCCTTCTGCACTTTGA |
Pathogenesis-related protein 1 (PR-1) | PR-1.F PR-1.R | F: TGAATGGACACAACCCTGCA R: GATGCCACCACCGTCTGAAT |
Pathogenesis-related protein 2 (PR-2) | PR-2.F PR-2.R | F: GGCCCTGGAACCATCAAGAA R: TCTGCAGTGTTTGGCAAAGC |
Chitinase 10 (PR-3) | PR-3.F PR-3.R | F: ACGACGTGATGGTTGGGAAA R: AGTGTCGACGTTGAACAGCT |
Pathogenesis-related protein 4 (PR-4) | PR-4.F PR-4.R | F: CAGAGTTACACGGGTGGGAC R: CGTCCAAATCCAACCCTCCA |
Thaumatin-like protein 1b (PR-5) | PR-5.F PR-5.R | F: CGATGTCCGTAACCCCACAA R: CCGTTGGTGGACATGTCTCA |
Peroxidase 10 (Prx) | Prx.F Prx.R | F: AGGCTCTTCGACTTTGGTGG R: AAAAGAGCCTGGTCCGACTG |
NDR1/HIN1-like protein 3 (NDR1) | NDR1.F NDR1.R | F: TGACCAAGGCCACAAGAACA R: GCGACGACACTGAACAATGG |
Protein EDS1 (EDS1) | EDS1.F EDS1.R | F: ATAGCAGGTGTGTGGGACGA R: TCCGCGTAATGTCTCCCATG |
Hypersensitive-induced response protein 2-like (HR) | HR.F HR.R | F: GCGGCAAGCCATAGTTGATG R: GGAAGCACCGATGTCCTTCA |
Chalcone synthase 17-like (CHS) | CHS.F CHS.R | F: ATGAAATCCGGCAGGCTCAA R: GCACATGCGCTGGAATTTCT |
Actin (ACT) | Actin.F Actin.R | F: CAGTGTCTGGATTGGAGGCT R: GTCCTCGACCACTTGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Songsaeng, A.; Boonchuen, P.; Nareephot, P.; Piromyou, P.; Wongdee, J.; Greetatorn, T.; Inthaisong, S.; Tantasawat, P.A.; Teamtisong, K.; Tittabutr, P.; et al. Enhancing Resistance to Cercospora Leaf Spot in Mung Bean (Vigna radiata L.) through Bradyrhizobium sp. DOA9 Priming: Molecular Insights and Bio-Priming Potential. Plants 2024, 13, 2495. https://doi.org/10.3390/plants13172495
Songsaeng A, Boonchuen P, Nareephot P, Piromyou P, Wongdee J, Greetatorn T, Inthaisong S, Tantasawat PA, Teamtisong K, Tittabutr P, et al. Enhancing Resistance to Cercospora Leaf Spot in Mung Bean (Vigna radiata L.) through Bradyrhizobium sp. DOA9 Priming: Molecular Insights and Bio-Priming Potential. Plants. 2024; 13(17):2495. https://doi.org/10.3390/plants13172495
Chicago/Turabian StyleSongsaeng, Apisit, Pakpoom Boonchuen, Phongkeat Nareephot, Pongdet Piromyou, Jenjira Wongdee, Teerana Greetatorn, Sukanya Inthaisong, Piyada Alisha Tantasawat, Kamonluck Teamtisong, Panlada Tittabutr, and et al. 2024. "Enhancing Resistance to Cercospora Leaf Spot in Mung Bean (Vigna radiata L.) through Bradyrhizobium sp. DOA9 Priming: Molecular Insights and Bio-Priming Potential" Plants 13, no. 17: 2495. https://doi.org/10.3390/plants13172495