Genome-Wide Identification of the COMT Gene Family in Juglans regia L. and Response to Drought Stress
Abstract
:1. Introduction
2. Results
2.1. Gene Identification of the JrCOMT Family
2.2. Bioinformatics of JrCOMT Family
2.3. Expression Analysis of JrCOMTs under Drought Stress
2.4. Bioinformatics Analysis of JrCOMT19 Gene
2.5. Cloning of JrCOMT19 Gene and Identification of Transgenic Arabidopsis thaliana
2.6. Phenotype Observation and Index Determination of Arabidopsis thaliana with 10% PEG 6000
3. Materials and Methods
3.1. Genome Identification of JrCOMT Genes in Walnut
3.2. Analysis of the JrCOMT Family Members
3.3. Expression Characteristics of JrCOMT Gene Family under Drought Stress
3.4. Cloning and Bioinformatics Analysis of JrCOMT19
3.5. Agrobacterium Mediated Transformation of Arabidopsis thaliana and Determination of Related Physiological Indexes
3.6. Statistical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Waris, I.; Saleem, M.; Sher, N.; Shahid, M.; Jahanzeb, M.; Usman, S.; Mutie, M.U.; Noor, H. The Regulation of Stress Responses in Fruit Crops is Influenced by Plant Hormones: A Review. Asian J. Res. Agric. For. 2024, 10, 72–78. [Google Scholar] [CrossRef]
- Tabur, S.; Ozmen, S.; Birol, O.S. Promoter role of putrescine for molecular and biochemical processes under drought stress in barley. Sci. Rep. 2024, 14, 19202. [Google Scholar] [CrossRef] [PubMed]
- Lou, H.; Wang, F.; Zhang, J.; Wei, G.; Hu, H.; Wang, K.; Wang, Z.; Huang, Y. JrGA20ox1-transformed rootstocks deliver drought response signals to wild-type scions in grafted walnut. Hortic. Res. 2024, 11, 143. [Google Scholar] [CrossRef] [PubMed]
- Uddin, N.; Li, X.; Ullah, W.M.; Sethupathy, S.; Ma, K.; Elboughdiri, N.; Khan, K.A. Lignin developmental patterns and Casparian strip as apoplastic barriers: A review. Int. J. Biol. Macromol. 2024, 260, 129595. [Google Scholar] [CrossRef]
- Vincent, N.; Yan, J.; Yang, T.; James, Z.; Matthias, S.; Nikolai, K.; Zeng, H. Lignin and Its Pathway-Associated Phytoalexins Modulate Plant Defense against Fungi. J. Fungi 2022, 9, 52. [Google Scholar] [CrossRef]
- Pallavi, D.; Nitika, R.; Shubham, B.; Sudhakaran, S.S.; Kumar, A.; Raturi, G.; Chakraborty, K.; Gupta, O.P.; Devanna, B.N.; Tripathi, D.K.; et al. Fascinating role of silicon to combat salinity stress in plants: An updated overview. Plant Physiol. Biochem. 2021, 162, 110–123. [Google Scholar]
- Ge, L.; Yang, X.; Liu, Y.; Tang, H.; Wang, Q. Improvement of Seed Germination under Salt Stress via Overexpressing Caffeic Acid O-methyltransferase 1 (SlCOMT1) in Solanum lycopersicum L. Int. J. Mol. Sci. 2023, 24, 734. [Google Scholar] [CrossRef]
- Chen, Y.; Yang, X.; Tian, S. Response of upland cotton GhCOMT28 to drought stress. Chin. J. Agric. Sci. Technol. 2024, 10, 2756. [Google Scholar]
- Rogers, E.R.; Zalesny, R.S.; Lin, C.; Vinhal, R.A. Intrinsic and extrinsic factors influencing Populus water use: A literature review. J. Environ. Manag. 2023, 348, 119180. [Google Scholar] [CrossRef]
- Yao, Z.; Zhang, X.; Liang, Y.; Zhang, J.; Xu, Y.; Chen, S.; Zhao, D. NtCOMT1 responsible for phytomelatonin biosynthesis confers drought tolerance in Nicotiana tabacum. Phytochemistry 2022, 202, 113306. [Google Scholar] [CrossRef]
- Getachew, G.; Ibáñez, A.; Pittroff, W.; Dandekar, M.; McCaslin, S.; Goyal, P.; Reisen, E.J.; DePeters, D.H. A comparative study between lignin down regulated alfalfa lines and their respective unmodified controls on the nutritional characteristics of hay. Anim. Feed. Sci. Technol. 2011, 170, 192–200. [Google Scholar] [CrossRef]
- Pehlivan, S.; Aydın, P.; Aytaç, H.; Mehmet, U.; Sever, L.; Pehlivan, M. Investigation of Catechol-O-Methyltransferase and Cannabinoid Receptor 2 gene variants in tobacco use disorder or tobacco use disorder and schizophrenia comorbidity. Anatol. J. Psychiatry 2020, 21, 1. [Google Scholar] [CrossRef]
- Azam, M.; Usman, M.; Manzoor, A.M.; Yao, L.; Ma, X.; Zhang, Y.; Iftikhar, H.S.; Asad, R.; Muhammad, S.M.; Junming, S.; et al. Comprehensive characterization and expression profiling of BBX gene family in soybean in response to UV-B stress. Plant Stress 2024, 13, 100560. [Google Scholar] [CrossRef]
- Wu, Z.; Wang, N.; Hisano, H.; Cao, Y.; Wu, F.; Liu, W.; Bao, Y.; Wang, Z.; Fu, C. Simultaneous regulation of F5H in COMT-RNAi transgenic switchgrass alters effects of COMT suppression on syringyl lignin biosynthesis. Plant Biotech. J. 2019, 17, 836–845. [Google Scholar] [CrossRef]
- Liang, S.; Xu, S.; Qu, D.; Yang, L.; Wang, J.; Liu, H.; Xin, W.; Zou, D.; Zheng, H. Identification and Functional Analysis of the Caffeic Acid O-Methyltransferase (COMT) Gene Family in Rice (Oryza sativa L.). Int. J. Mol. Sci. 2022, 23, 8491. [Google Scholar] [CrossRef]
- Jauhal, A.A.; Constantine, R.; Newcomb, R. Conservation and selective pressures shaping baleen whale olfactory receptor genes supports their use of olfaction in the marine environment. Mol. Ecol. 2024, 33, e17497. [Google Scholar] [CrossRef]
- Niu, H.; Li, P.; Zhang, M.; Han, M.; Hu, W.; Yan, W.; Liu, D.; Dou, J.; Yang, S.; Zhu, H.; et al. Genome-wide identification of ClSPL gene family and functional characterization of ClSPL9 in watermelon. Sci. Hortic. 2024, 337, 113539. [Google Scholar] [CrossRef]
- Bhardwaj, E.; Pokhriyal, E.; Jain, A.; Mukund, L.; Megha, K.; Komal, J.; Sandip, D. The non-canonically organized members of MIR395 gene family in Brassica juncea are associated with developmentally regulated, sulfate-stress responsive bidirectional promoters that exhibit orientation-dependent differential transcriptional activity. Plant Sci. Inter. J. Exp. Plant Biol. 2024, 348, 112214. [Google Scholar] [CrossRef]
- Ma, X.; Gao, Y.; Zhang, Z.; Wang, Y. Identification and expression analysis of Jr4CLs gene family based on transcriptome and physiological data in Walnut (Juglans regia). Plant Growth Regul. 2024, 1–18. [Google Scholar] [CrossRef]
- Ducloy, A.; Azzopardi, M.; Ivsic, C.; Gwendal, C.; Delphine, S.; Delphine, C.; Jean, L.C. A transcriptomic dataset for investigating the Arabidopsis Unfolded Protein Response under chronic, proteotoxic endoplasmic reticulum stress. Data Brief. 2024, 53, 110243. [Google Scholar] [CrossRef]
- Luan, Y.; Chen, Z.; Meng, J.; Tao, J.; Zhao, D. PoWRKY17 promotes drought tolerance in Paeonia ostii by modulating lignin accumulation. Ind. Crop. Prod. 2023, 204, 117228. [Google Scholar] [CrossRef]
- Han, S.; Noh, W.; Han, H. Enhanced drought and salt tolerance by expression of AtGSK1 gene in poplar. Plant Biotechnol. Rep. 2013, 7, 39–47. [Google Scholar] [CrossRef]
- Mehboob, I.; Baig, S.; Siddique, M.; Shan, X.; Ayesha, B.; Mohammad, M.S.; Irum, S.; Zhao, H.; Shamyla, N.; Samina, K. Deciphering the role of SlWRKY36 and SlWRKY51 in salt stress tolerance via modulating ion homeostasis and proline biosynthesis. Curr. Plant Biol. 2024, 39, 100380. [Google Scholar] [CrossRef]
- Rani, R.K.; Hindu, V.; Anil, G.; Rayalacheruvu, U. Variability in drought stress-induced physiological, biochemical responses and expression of DREB2A, NAC4 and HSP70 genes in groundnut (Arachis hypogaea L.). S. Afr. J. Bot. 2022, 144, 448–457. [Google Scholar]
- Chaitanya, P.; Vijayaraghavareddy, P.; Lekshmy, S.; Spoorthi, N.; Math, R.G.; Shinde, D.D.; Struik, P.C.; Sreeman, S. Molecular basis of distinct responses to drought between rice and wheat genotypes. Environ. Exp. Bot. 2024, 221, 105734. [Google Scholar] [CrossRef]
- Liu, X.; Wang, R.; Chen, L.; Xun, W.; Shi, Y.; Man, S.; Jia, Y.; Wang, X.; You, C. MdTPR16, an apple tetratricopeptide repeat (TPR)-like superfamily gene, positively regulates drought stress in apple. Plant Physiol. Biochem. 2024, 210, 108572. [Google Scholar] [CrossRef]
- Li, B.; Liu, R.; Liu, J.; Zhang, H.; Tian, Y.; Chen, T.; Li, J.; Jiao, F.; Jia, T.; Li, Y.; et al. ZmMYB56 regulates stomatal closure and drought tolerance in maize seedlings through the transcriptional regulation. New Crop. 2024, 1, 100012. [Google Scholar] [CrossRef]
- Liu, Q.; Zheng, L.; Wang, Y.; Zhou, Y.; Gao, F. AmDHN4, a winter accumulated SKn-type dehydrin from Ammopiptanthus mongolicus, and regulated by AmWRKY45, enhances the tolerance of Arabidopsis to low temperature and osmotic stress. Int. J. Biol. Macromol. 2024, 266, 131020. [Google Scholar] [CrossRef]
- Li, S.; Zhou, Z.; Yang, Y.; Zhou, X.; Diya, L.; He, R.; Zhang, J.; Lin, Y.; Wang, Y.; Li, M.; et al. R2R3-MYB transcription factor PbMYB5-like positively regulates the biosynthesis of phenylalanine-related metabolites in pear (Pyrus bretschneideri). J. Agric. Food Res. 2024, 18, 101328. [Google Scholar] [CrossRef]
- Azizi, A.; Bagnazari, M.; Mohammadi, M. Seaweed and phosphate-solubilizing bacteria biofertilizers ameliorate physiochemical traits and essential oil content of Calendula officinalis L. under drought stress. Sci. Hortic. 2024, 328, 112653. [Google Scholar] [CrossRef]
- Zhou, H.; Wang, Y.; Wang, X.; Cheng, R.; Zhang, H.; Yang, L. Genome-wide characterization of DELLA gene family in blueberry (Vaccinium darrowii) and their expression profiles in development and response to abiotic stress. BMC Genom. 2024, 25, 815. [Google Scholar] [CrossRef] [PubMed]
- Zhu, R.; An, S.; Fu, J.; Liu, S.; Fu, Y.; Zhang, Y.; Wang, R.; Zhao, Y.; Wang, M. Genome-wide identification and characterization of SLEEPER, a transposon-derived gene family and their expression pattern in Brassica napus L. BMC Plant Biol. 2024, 24, 810. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Feng, S.; Zhang, Y.; Xu, L.; Luo, Y.; Yuan, Y.; Yang, Q.; Feng, B. Genome-wide identification and expression analysis of the plant-specific PLATZ gene family in Tartary buckwheat (Fagopyrum tataricum). BMC Plant Biol. 2022, 22, 160. [Google Scholar] [CrossRef]
- Yang, M.; Chen, J.; Liu, T.; Xiang, L.; Zhou, B. Genome-Wide Identification and Expression Analysis of Calmodulin-Like Gene Family in Paspalums vaginatium Revealed Their Role in Response to Salt and Cold Stress. Curr. Issues Mol. Biol. 2023, 45, 1693–1711. [Google Scholar] [CrossRef]
- Dai, H.; Huang, X.; Wang, Y.; Zhu, S.; Li, J.; Xu, Z.; Zheng, J. Overexpression of forage millet (Setaria italica) SiER genes enhances drought resistance of Arabidopsis thaliana. Funct. Plant Biol. 2024, 51, FP23238. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Huang, Y.; Khadr, A.; Wang, Y.; Xu, Z.; Xiong, A. DcDREB1A, a DREB-binding transcription factor from Daucus carota, enhances drought tolerance in transgenic Arabidopsis thaliana and modulates lignin levels by regulating lignin-biosynthesis-related genes. Environ. Exp. Bot. 2020, 169, 103896. [Google Scholar] [CrossRef]
- Pham, H.; Tian, X.; Zhao, H.; Li, T.; Lu, L. Genome-wide characterization of COMT family and regulatory role of CsCOMT19 in melatonin synthesis in Camellia sinensis. BMC Plant Biol. 2024, 24, 51. [Google Scholar] [CrossRef]
- Jindal, P.; Kant, K.; Kaur, N. Melatonin: Discovery, biosynthesis, phytohormones crosstalk, and roles in agricultural crops under abiotic stress conditions. Environ. Exp. Bot. 2024, 226, 105942. [Google Scholar] [CrossRef]
- Li, S.; Xu, Y.; Bi, Y.; Shen, S.; Jiang, T.; Zheng, X. Melatonin treatment inhibits gray mold and induces disease resistance in cherry tomato fruit during postharvest. Postharvest Biol. Technol. 2019, 157, 110962. [Google Scholar] [CrossRef]
- Li, H.; Kong, F.; Tang, T.; Luo, Y.; Gao, H.; Xu, J.; Xing, G.; Li, L. Physiological and Transcriptomic Analyses Revealed That Humic Acids Improve Low-Temperature Stress Tolerance in Zucchini (Cucurbita pepo L.) Seedlings. Plants 2023, 12, 548. [Google Scholar] [CrossRef]
- Xu, K.; Wang, P. Transcriptome-wide identification of the Hsp70 gene family in Pugionium cornutum and functional analysis of PcHsp70-5 under drought stress. Planta 2024, 260, 84. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Liu, H.; Yang, R.; Xu, X.; Liu, X.; Xu, J. Over-expression of PttEXPA8 gene showed various resistances to diverse stresse. Int. J. Biol. Macromol. 2019, 130, 50–57. [Google Scholar] [CrossRef] [PubMed]
Accession No. | Gene Name | Size (aa) | Molecular Weight (D) | Isoelectric Point | Grand Average of Hydropathicity (GRAVY) | Aliphatic Index |
---|---|---|---|---|---|---|
JreChr01G10207 | JrCOMT1 | 366 | 40,160.30 | 6.06 | −0.104 | 83.39 |
JreChr01G10220 | JrCOMT2 | 378 | 41,851.29 | 6.07 | −0.117 | 83.84 |
JreChr01G10229 | JrCOMT3 | 368 | 40,843.32 | 5.75 | 0.046 | 92.17 |
JreChr01G10230 | JrCOMT4 | 368 | 40,824.26 | 5.95 | −0.013 | 89.91 |
JreChr01G10232 | JrCOMT5 | 343 | 37,863.87 | 6.32 | −0.028 | 88.98 |
JreChr02G10946 | JrCOMT6 | 340 | 38,366.60 | 9.00 | −0.127 | 87.44 |
JreChr03G10911 | JrCOMT7 | 306 | 33,721.43 | 9.22 | 0.309 | 107.45 |
JreChr03G10972 | JrCOMT8 | 327 | 35,517.03 | 5.99 | 0.097 | 97.52 |
JreChr03G10984 | JrCOMT9 | 355 | 38,815.00 | 6.16 | 0.097 | 96.99 |
JreChr03G10985 | JrCOMT10 | 355 | 38,797.97 | 6.07 | 0.109 | 97.01 |
JreChr04G10415 | JrCOMT11 | 355 | 39,716.25 | 5.77 | 0.009 | 95.61 |
JreChr04G10555 | JrCOMT12 | 379 | 42,720.38 | 5.26 | −0.019 | 96.25 |
JreChr04G10568 | JrCOMT13 | 367 | 41,338.97 | 5.53 | 0.029 | 98.34 |
JreChr05G11501 | JrCOMT14 | 365 | 39,962.32 | 5.88 | 0.029 | 90.55 |
JreChr05G11714 | JrCOMT15 | 372 | 41,426.89 | 5.84 | −0.046 | 96.96 |
JreChr05G12697 | JrCOMT16 | 354 | 39,010.38 | 5.30 | −0.026 | 92.06 |
JreChr05G12699 | JrCOMT17 | 1312 | 146,348.37 | 6.00 | −0.036 | 95.71 |
JreChr06G11870 | JrCOMT18 | 373 | 40,786.08 | 5.95 | 0.028 | 92.60 |
JreChr06G12011 | JrCOMT19 | 365 | 39,746.97 | 5.42 | 0.064 | 91.89 |
JreChr09G11939 | JrCOMT20 | 359 | 39,799.46 | 5.59 | −0.207 | 85.01 |
JreChr09G12161 | JrCOMT21 | 363 | 40,507.72 | 5.67 | −0.076 | 94.79 |
JreChr09G12162 | JrCOMT22 | 292 | 33,269.04 | 9.02 | 0.049 | 87.50 |
JreChr09G12163 | JrCOMT23 | 361 | 40,904.29 | 5.91 | −0.162 | 88.01 |
JreChr10G10468 | JrCOMT24 | 185 | 20,978.67 | 6.06 | −0.007 | 96.38 |
JreChr10G10485 | JrCOMT25 | 365 | 40,194.37 | 5.31 | −0.016 | 98.08 |
JreChr10G10488 | JrCOMT26 | 365 | 40,209.45 | 5.32 | 0.010 | 99.40 |
JreChr10G11800 | JrCOMT27 | 486 | 54,381.39 | 5.82 | −0.227 | 94.22 |
JreChr10G12207 | JrCOMT28 | 192 | 20,936.49 | 6.18 | 0.105 | 100.05 |
JreChr10G12210 | JrCOMT29 | 355 | 38,962.39 | 6.04 | 0.103 | 96.70 |
JreChr12G10775 | JrCOMT30 | 369 | 40,530.62 | 5.59 | 0.018 | 95.58 |
JreChr12G10776 | JrCOMT31 | 369 | 40,443.67 | 5.62 | 0.054 | 95.37 |
JreChr12G10777 | JrCOMT32 | 369 | 40,364.29 | 5.69 | −0.017 | 92.44 |
JreChr12G10778 | JrCOMT33 | 207 | 23,474.06 | 8.75 | −0.197 | 82.37 |
Purpose | Primer | Primer Sequence (5′–3′) |
---|---|---|
Reference gene | 18S | F:ACACGGGGAGGTAGTGACAA R:CCTCCAATGGATCCTCGTTA |
Quantitative real-time PCR | JrCOMT6 | F:AGGAGGAAGAGTACATTGAATGGTTTG R:AGCCATGCCGACGGACAC |
JrCOMT14 | F:CAACAGAGCCTACGGAATGACAG R:TGGTTTGACATTGCTTGGTTGAATAC | |
JrCOMT15 | F:TGAATGTATTCTTCCAGTAGCACCAG R:AACTCCTTCTCTGTCCTCTCCTTC | |
JrCOMT16 | F:CCGTCTCCTCAATGAAGCAATGG R:CCTCTGGACAACCTTGAAGAATCG | |
JrCOMT17 | F:ATACAACAAGCCATCCGCATCTC R:CATCTTCTTATCTACACTGCTCCTCTC | |
JrCOMT19 | F:TCTCTGACGAAGAAGCCAACCTC R:GCCCAGCCTTTGCGATGATG | |
JrCOMT20 | F:GGGAAGGGATCAACTTTGACTTACC R:TGGCATCAGCAGAAGGAATAGAATG | |
JrCOMT31 | F:GATCTTGGTGTGCTTGTGATTATTGG R:GGTTGGCGTTGCTGTGAGTG | |
JrCOMT33 | F:GTTGTCAAGTGTCGGCAGTTCC R:CACATCCACAAGCGACTTCAGG | |
Gene clone | JrCOMT19 | F:ATGGGCTCCACCGGAGAA R:TCAAAGCTTTTTAATGAATTCCATG |
Quantitative real-time PCR | C3H | F:GAACTGATTGGAAAGCTCGGAAACATC R:GCGAGTTCAACGGAGTGCTGTAG |
C4H | F:ACACCATCATCGTCATCACACTCATC R:TCCAAGCTCTTCTTCACCAGTTGC | |
4CL | F:ACACCATCATCGTCATCACACTCATC R:TCCAAGCTCTTCTTCACCAGTTGC | |
CCR | F:CGAGCCACCCAAGCAAGACTATATC R:ACTTTCATCCTTTCGCTGATCTTCTCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, X.; Luo, H.; Li, J.; Wei, Z.; Gao, Y.; Zhang, Z.; Wang, Y. Genome-Wide Identification of the COMT Gene Family in Juglans regia L. and Response to Drought Stress. Plants 2024, 13, 2690. https://doi.org/10.3390/plants13192690
Ma X, Luo H, Li J, Wei Z, Gao Y, Zhang Z, Wang Y. Genome-Wide Identification of the COMT Gene Family in Juglans regia L. and Response to Drought Stress. Plants. 2024; 13(19):2690. https://doi.org/10.3390/plants13192690
Chicago/Turabian StyleMa, Xiaolan, Hongjia Luo, Jianhong Li, Zhiyue Wei, Yanlong Gao, Zhongxing Zhang, and Yanxiu Wang. 2024. "Genome-Wide Identification of the COMT Gene Family in Juglans regia L. and Response to Drought Stress" Plants 13, no. 19: 2690. https://doi.org/10.3390/plants13192690