Azolla as a Safe Food: Suppression of Cyanotoxin-Related Genes and Cyanotoxin Production in Its Symbiont, Nostoc azollae
Abstract
1. Introduction
- The presence of genes coding for microcystin, nodularin, cylindrospermopsin, and saxitoxin.
- The presence of the anatoxin-a/homoanatoxin-a gene cluster by bioinformatic tools.
- The presence of BMAA.
2. Results
2.1. The Cyanotoxins Microcystin, Nodularin, Saxitoxin, Cylindrospermopsin and Anatoxin-a
2.2. Detection of BMAA (β-N-Methylamino-L-Alanine)
3. Discussion
4. Materials and Methods
4.1. Azolla Accessions and Culturing
4.2. Isolation of Nostoc azollae from Azolla Accessions
4.3. Detection and Analysis of BMAA (β-N-Methylamino-L-Alanine)
4.3.1. Method 1
4.3.2. Method 2
4.4. Cyanotoxin Genes in Azolla Accessions and Nostoc Azollae
DNA Extraction
Gene | Primer | Sequence Primer (5′ → 3′) | Size (bp) | Reference |
---|---|---|---|---|
Saxitoxin (sxt) | SXT683F | GGATCTCAAACATGATCCCA | 195 | [57] |
SXT877R | GCCAAACGCAGTACCACTT | |||
Cylindrospermopsin (cyl) (poliketide synthase) | K18F | CCTCGCACATAGCCATTTGC | 422 | [58] |
M4R | GAAGCTCTGGAATCCGGTAA | |||
Cylindrospermopsin (cyl) (peptide synthase) | M13 | GGCAAATTGTGATAGCCACGAGC | 597 | [59] |
M14 | GATGGAACATCGCTCACTGGTG | [58] | ||
Microcystin/Nodularin synthetase (mcyE/ndaF) | HepF | TTTGGGGTTAACTTTTTTGGCCATAGTC | 472 | [60] |
HepR | AATTCTTGAGGCTGTAAATCGGGTTT | |||
Microcystin synthetase (mcy A) | mcyA-Cd1F | AAAATTAAAAGCCGTATCAAA | 297 | [61] |
mcyA-Cd1R | AAAAGTGTTTTATTAGCGGCTCAT | |||
Microcystin synthetase (mcy B) | 2959F | TGGGAAGATGTTCTTCAGGTATCCAA | 350 | [62] |
3278R | AGAGTGGAAACAATATGATAAGCTAC | |||
Microcystin (mcy C) | FAA | CTATGTTATTTATACATCAGG | 758 | [63] |
RAA | CTCAGCTTAACTTGATTATC | |||
Microcystin (mcy B, domain A) | 2156F | ATCACTTCAATCTAACGACT | 955 | [64] |
3111R | GTTGCTGCTGTAAGAAA | |||
Microcystin (mcy C, domain A) | PSCF1 | GCAACATCCCAAGAGCAAAG | 674 | [65] |
PSCR1 | CCGACAACATCACAAAGGC | |||
Microcystin (mcy D, domain ACP) | PKDF1 | GACGCTCAAATGATGAAACT | 647 | [65] |
PKDR1 | GCAACCGATAAAAACTCCC | |||
Microcystin (mcy D, domain KS) | PKDF2 | AGTTATTCTCCTCAAGCC | 859 | [65] |
PKDR2 | CATTCGTTCCACTAAATCC | |||
Microcystin (mcy E, domain GSA-AMT) | PKEF1 | CGCAAACCCGATTTACAG | 755 | [65] |
PKER1 | CCCCTACCATCTTCATCTTC | |||
Microcystin (mcy G, domain CM) | PKGF1 | ACTCTCAAGTTATCCTCCCTC | 425 | [65] |
PKGR1 | AATCGCTAAAACGCCACC |
Gene | Initial Denaturation | Denaturation | Annealing | Extension | Final Extension | Reference |
---|---|---|---|---|---|---|
sxt | 94 °C; 3 min | 35 cycles | 72 °C; 7 min | [57] | ||
94 °C; 10 s | 52 °C; 20 s | 72 °C; 1 min | ||||
cyl | 94 °C; 10 min | 30 cycles | 72 °C; 7 min | [59] | ||
94 °C; 30 s | 55 °C; 30 s | 72 °C; 7 min | ||||
mcyE/ndaF | 92 °C; 2 min | 35 cycles | 72 °C; 5 min | [60] | ||
92 °C; 20 s | 56 °C; 30 s | 72 °C; 1 min | ||||
mcy A | 95 °C; 2 min | 35 cycles | 72 °C; 7 min | [61] | ||
95 °C; 90 s | 56 °C; 30 s | 72 °C; 50 s | ||||
mcy B | 94 °C; 2 min | 35 cycles | 72 °C; 5 min | [62] | ||
94 °C; 30 s | 59 °C; 45 s | 72 °C; 1 min | ||||
mcy C | 94 °C; 2 min | 35 cycles | 72 °C; 7 min | [63] | ||
94 °C; 10 s | 50 °C; 20 s | 72 °C; 1 min | ||||
mcy B, domain A | 94 °C; 4 min | 30 cycles | 72 °C; 7 min | [64] | ||
95 °C; 30 s | 52 °C; 30 s | 72 °C; 1 min | ||||
mcy C, domain A | 94 °C; 5 min | 35 cycles | 72 °C; 7 min | [65] | ||
95 °C; 1 min | 52 °C; 30 s | 72 °C; 1 min | ||||
mcy D, domain ACP | 94 °C; 5 min | 35 cycles | 72 °C; 7 min | [65] | ||
95 °C; 1 min | 52 °C; 30 s | 72 °C; 1 min | ||||
mcy D, domain KS | 94 °C; 5 min | 35 cycles | 72 °C; 7 min | [65] | ||
95 °C; 1 min | 52 °C; 30 s | 72 °C; 1 min | ||||
mcy E, domain GST-AMT | 94 °C; 5 min | 35 cycles | 72 °C; 7 min | [65] | ||
95 °C; 1 min | 52 °C; 30 s | 72 °C; 1 min | ||||
mcy G, domain CM | 94 °C; 5 min | 35 cycles | 72 °C; 7 min | [65] | ||
95 °C; 1 min | 52 °C; 30 s | 72 °C; 1 min |
4.5. BLAST of Anatoxin-a Genes against Nostoc azollae
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Carrapiço, F. Azolla as a Superorganism. Its Implication in Symbiotic Studies. In Symbioses and Stress: Joint Ventures in Biology; Seckbach, J., Grube, M., Eds.; Springer: Dordrecht, The Netherlands, 2010; pp. 225–241. ISBN 978-90-481-9449-0. [Google Scholar]
- Singh, P.; Khan, A.; Srivastava, A. Chapter 16—Heterocyst and Akinete Differentiation in Cyanobacteria: A View toward Cyanobacterial Symbiosis. In Advances in Cyanobacterial Biology; Singh, P.K., Kumar, A., Singh, V.K., Shrivastava, A.K., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 235–248. ISBN 978-0-12-819311-2. [Google Scholar]
- Bujak, J.P.; Bujak, A.A. Origin and Evolution of the Azolla Superorganism. Plants 2024, 13, 2106. [Google Scholar] [CrossRef] [PubMed]
- Ekman, M.; Tollbäck, P.; Klint, J.; Bergman, B. Protein Expression Profiles in an Endosymbiotic Cyanobacterium Revealed by a Proteomic Approach. Mol. Plant-Microbe Interact. 2006, 19, 1251–1261. [Google Scholar] [CrossRef]
- Ekman, M.; Tollbäck, P.; Bergman, B. Proteomic Analysis of the Cyanobacterium of the Azolla Symbiosis: Identity, Adaptation, and NifH Modification. J. Exp. Bot. 2008, 59, 1023–1034. [Google Scholar] [CrossRef] [PubMed]
- Larsson, J.; Nylander, J.A.; Bergman, B. Genome Fluctuations in Cyanobacteria Reflect Evolutionary, Developmental and Adaptive Traits. BMC Evol. Biol. 2011, 11, 187. [Google Scholar] [CrossRef] [PubMed]
- Ran, L.; Larsson, J.; Vigil-Stenman, T.; Nylander, J.A.A.; Ininbergs, K.; Zheng, W.-W.; Lapidus, A.; Lowry, S.; Haselkorn, R.; Bergman, B. Genome Erosion in a Nitrogen-Fixing Vertically Transmitted Endosymbiotic Multicellular Cyanobacterium. PLoS ONE 2010, 5, e11486. [Google Scholar] [CrossRef]
- Bujak, J.; Bujak, A. The Azolla Story: A Message from the Future; The Azolla Foundation: Blackpool, UK, 2020; ISBN 1-5272-8335-6. [Google Scholar]
- Bujak, A.; Bujak, J. Azolla’s Use as a Biofertilizer and Livestock Feed. In Ferns; Marimuthu, J., Fernández, H., Kumar, A., Thangaiah, S., Eds.; Springer: Singapore, 2022; pp. 671–695. ISBN 9789811661693. [Google Scholar]
- Watanabe, I.; Berja, N.S. The Growth of Four Species of Azolla as Affected by Temperature. Aquat. Bot. 1983, 15, 175–185. [Google Scholar] [CrossRef]
- Ansari, M.A.; Sharma, V.P. Role of Azolla in Controlling Mosquito Breeding in Ghaziabad District Villages (U.P.). Indian J. Malariol. 1991, 28, 51–54. [Google Scholar]
- Mwingira, V.; Mayala, B.; Senkoro, K.; Rumisha, S.; Shayo, H.; Elizabeth Mlozi, P.; Mboera, L. Mosquito Larval Productivity in Rice-Fields Infested with Azolla in Mvomero District, Tanzania. Tanzan. J. Health Res. 2009, 11, 17–22. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, R.; Reuben, R. Evaluation of the Water Fern Azolla microphylla for Mosquito Population Management in the Rice-Land Agro-Ecosystem of South India. Med. Vet. Entomol. 1991, 5, 299–310. [Google Scholar] [CrossRef] [PubMed]
- Bharati, K. Influence of Incorporation or Dual Cropping of Azolla on Methane Emission from a Flooded Alluvial Soil Planted to Rice in Eastern India. Agric. Ecosyst. Environ. 2000, 79, 73–83. [Google Scholar] [CrossRef]
- Mujiyo; Sunarminto, B.; Hanudin, E.; Widada, J.; Syamsiyah, J. Methane Emission on Organic Rice Experiment Using Azolla. Int. J. Appl. Environ. Sci. 2016, 11, 295–308. [Google Scholar]
- Xu, H.; Zhu, B.; Liu, J.; Li, D.; Yang, Y.; Zhang, K.; Jiang, Y.; Hu, Y.; Zeng, Z. Azolla Planting Reduces Methane Emission and Nitrogen Fertilizer Application in Double Rice Cropping System in Southern China. Agron. Sustain. Dev. 2017, 37, 29. [Google Scholar] [CrossRef]
- Winstead, D.; Di Gioia, F.; Jauregui, M.; Jacobson, M. Nutritional Properties of Raw and Cooked Azolla caroliniana Willd., an Aquatic Wild Edible Plant. Food Sci. Nutr. 2024, 12, 2050–2060. [Google Scholar] [CrossRef] [PubMed]
- Bláha, L.; Babica, P.; Maršálek, B. Toxins Produced in Cyanobacterial Water Blooms—Toxicity and Risks. Interdiscip. Toxicol. 2009, 2, 36–41. [Google Scholar] [CrossRef] [PubMed]
- Burton, B.; Collins, K.; Brooks, J.; Marx, K.; Renner, A.; Wilcox, K.; Moore, E.; Osowski, K.; Riley, J.; Rowe, J.; et al. The Biotoxin BMAA Promotes Dysfunction via Distinct Mechanisms in Neuroblastoma and Glioblastoma Cells. PLoS ONE 2023, 18, e0278793. [Google Scholar] [CrossRef] [PubMed]
- Chorus, I.; Bartram, J. Toxic Cyanobacteria in Water: A Guide to Their Public Health Consequences, Monitoring and Management; CRC Press: Boca Raton, FL, USA, 1999. [Google Scholar]
- Chorus, I.; Welker, M. Toxic Cyanobacteria in Water, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2021; ISBN 978-1-00-308144-9. [Google Scholar]
- Merel, S.; Walker, D.; Chicana, R.; Snyder, S.; Baurès, E.; Thomas, O. State of Knowledge and Concerns on Cyanobacterial Blooms and Cyanotoxins. Environ. Int. 2013, 59, 303–327. [Google Scholar] [CrossRef]
- Funari, E.; Testai, E. Human Health Risk Assessment Related to Cyanotoxins Exposure. Crit. Rev. Toxicol. 2008, 38, 97–125. [Google Scholar] [CrossRef]
- Cox, P.A.; Banack, S.A.; Murch, S.J.; Rasmussen, U.; Tien, G.; Bidigare, R.R.; Metcalf, J.S.; Morrison, L.F.; Codd, G.A.; Bergman, B. Diverse Taxa of Cyanobacteria Produce β-N-Methylamino-l-Alanine, a Neurotoxic Amino Acid. Proc. Natl. Acad. Sci. USA 2005, 102, 5074–5078. [Google Scholar] [CrossRef]
- Esterhuizen, M.; Downing, T.G. Beta-N-Methylamino-L-Alanine (BMAA) in Novel South African Cyanobacterial Isolates. Ecotoxicol. Environ. Saf. 2008, 71, 309–313. [Google Scholar] [CrossRef] [PubMed]
- Vega, A.; Bell, E.A. α-Amino-β-Methylaminopropionic Acid, a New Amino Acid from Seeds of Cycas circinalis. Phytochemistry 1967, 6, 759–762. [Google Scholar] [CrossRef]
- Al-Sammak, M.A.; Hoagland, K.D.; Cassada, D.; Snow, D.D. Co-Occurrence of the Cyanotoxins BMAA, DABA and Anatoxin-a in Nebraska Reservoirs, Fish, and Aquatic Plants. Toxins 2014, 6, 488–508. [Google Scholar] [CrossRef] [PubMed]
- Hammerschlag, N.; Davis, D.A.; Mondo, K.; Seely, M.S.; Murch, S.J.; Glover, W.B.; Divoll, T.; Evers, D.C.; Mash, D.C. Cyanobacterial Neurotoxin BMAA and Mercury in Sharks. Toxins 2016, 8, 238. [Google Scholar] [CrossRef] [PubMed]
- Holtcamp, W. The Emerging Science of BMAA: Do Cyanobacteria Contribute to Neurodegenerative Disease? Environ. Health Perspect. 2012, 120, a110–a116. [Google Scholar] [CrossRef]
- Masseret, E.; Banack, S.; Boumédiène, F.; Abadie, E.; Brient, L.; Pernet, F.; Juntas-Morales, R.; Pageot, N.; Metcalf, J.; Cox, P.; et al. Dietary BMAA Exposure in an Amyotrophic Lateral Sclerosis Cluster from Southern France. PLoS ONE 2013, 8, e83406. [Google Scholar] [CrossRef]
- Jiang, L.; Eriksson, J.; Lage, S.; Jonasson, S.; Shams, S.; Mehine, M.; Ilag, L.L.; Rasmussen, U. Diatoms: A Novel Source for the Neurotoxin BMAA in Aquatic Environments. PLoS ONE 2014, 9, e84578. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Ilag, L. Detection of Endogenous BMAA in Dinoflagellate (Heterocapsa triquetra) Hints at Evolutionary Conservation and Environmental Concern. PubRaw Sci. 2014, 1, 1–8. [Google Scholar]
- Lage, S.; Costa, P.R.; Moita, T.; Eriksson, J.; Rasmussen, U.; Rydberg, S.J. BMAA in Shellfish from Two Portuguese Transitional Water Bodies Suggests the Marine Dinoflagellate Gymnodinium catenatum as a Potential BMAA Source. Aquat. Toxicol. Amst. Neth. 2014, 152, 131–138. [Google Scholar] [CrossRef]
- Kaasalainen, U.; Fewer, D.P.; Jokela, J.; Wahlsten, M.; Sivonen, K.; Rikkinen, J. Cyanobacteria Produce a High Variety of Hepatotoxic Peptides in Lichen Symbiosis. Proc. Natl. Acad. Sci. USA 2012, 109, 5886–5891. [Google Scholar] [CrossRef] [PubMed]
- Kaasalainen, U.; Fewer, D.P.; Jokela, J.; Wahlsten, M.; Sivonen, K.; Rikkinen, J. Lichen Species Identity and Diversity of Cyanobacterial Toxins in Symbiosis. New Phytol. 2013, 198, 647–651. [Google Scholar] [CrossRef] [PubMed]
- Gehringer, M.M.; Adler, L.; Roberts, A.A.; Moffitt, M.C.; Mihali, T.K.; Mills, T.J.; Fieker, C.; Neilan, B.A. Nodularin, a Cyanobacterial Toxin, Is Synthesized in Planta by Symbiotic Nostoc Sp. ISME J. 2012, 6, 1834–1847. [Google Scholar] [CrossRef]
- Koksharova, O.A.; Safronova, N.A. Non-Proteinogenic Amino Acid β-N-Methylamino-L-Alanine (BMAA): Bioactivity and Ecological Significance. Toxins 2022, 14, 539. [Google Scholar] [CrossRef] [PubMed]
- Rouhiainen, L.; Vakkilainen, T.; Siemer, B.L.; Buikema, W.; Haselkorn, R.; Sivonen, K. Genes Coding for Hepatotoxic Heptapeptides (Microcystins) in the Cyanobacterium anabaena Strain 90. Appl. Environ. Microbiol. 2004, 70, 686–692. [Google Scholar] [CrossRef]
- Méjean, A.; Paci, G.; Gautier, V.; Ploux, O. Biosynthesis of Anatoxin-a and Analogues (Anatoxins) in Cyanobacteria. Toxicon 2014, 91, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Kurland, L.T.; Mulder, D.W. Epidemiologic Investigations of Amyotrophic Lateral Sclerosis. 2. Familial Aggregations Indicative of Dominant Inheritance Part I. Neurology 1955, 5, 182–196. [Google Scholar] [CrossRef] [PubMed]
- Kurland, L.T.; Mulder, D.W. Epidemiologic Investigations of Amyotrophic Lateral Sclerosis. 2. Familial Aggregations Indicative of Dominant Inheritance Part II. Neurology 1955, 5, 249–268. [Google Scholar] [CrossRef] [PubMed]
- Cox, P.A.; Banack, S.A.; Murch, S.J. Biomagnification of Cyanobacterial Neurotoxins and Neurodegenerative Disease among the Chamorro People of Guam. Proc. Natl. Acad. Sci. USA 2003, 100, 13380–13383. [Google Scholar] [CrossRef] [PubMed]
- Murch, S.J.; Cox, P.A.; Banack, S.A. A Mechanism for Slow Release of Biomagnified Cyanobacterial Neurotoxins and Neurodegenerative Disease in Guam. Proc. Natl. Acad. Sci. USA 2004, 101, 12228–12231. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Basile, M.; Mash, D.C. Cerebral Uptake and Protein Incorporation of Cyanobacterial Toxin β-N-Methylamino-L-Alanine. NeuroReport 2013, 24, 779. [Google Scholar] [CrossRef] [PubMed]
- Lobner, D.; Piana, P.M.T.; Salous, A.K.; Peoples, R.W. Beta-N-Methylamino-L-Alanine Enhances Neurotoxicity through Multiple Mechanisms. Neurobiol. Dis. 2007, 25, 360–366. [Google Scholar] [CrossRef]
- Rush, T.; Liu, X.; Lobner, D. Synergistic Toxicity of the Environmental Neurotoxins Methylmercury and β-N-Methylamino-L-Alanine. Neuroreport 2012, 23, 216–219. [Google Scholar] [CrossRef]
- Weiss, J.H.; Koh, J.Y.; Choi, D.W. Neurotoxicity of Beta-N-Methylamino-L-Alanine (BMAA) and Beta-N-Oxalylamino-L-Alanine (BOAA) on Cultured Cortical Neurons. Brain Res. 1989, 497, 64–71. [Google Scholar] [CrossRef] [PubMed]
- Dunlop, R.A.; Cox, P.A.; Banack, S.A.; Rodgers, K.J. The Non-Protein Amino Acid BMAA Is Misincorporated into Human Proteins in Place of L-Serine Causing Protein Misfolding and Aggregation. PLoS ONE 2013, 8, e75376. [Google Scholar] [CrossRef] [PubMed]
- Pravadali-Cekic, S.; Vojvodic, A.; Violi, J.P.; Mitrovic, S.M.; Rodgers, K.J.; Bishop, D.P. Simultaneous Analysis of Cyanotoxins β-N-Methylamino-L-Alanine (BMAA) and Microcystins-RR, -LR, and -YR Using Liquid Chromatography–Tandem Mass Spectrometry (LC-MS/MS). Molecules 2023, 28, 6733. [Google Scholar] [CrossRef] [PubMed]
- Faassen, E.J.; Gillissen, F.; Lürling, M. A Comparative Study on Three Analytical Methods for the Determination of the Neurotoxin BMAA in Cyanobacteria. PLoS ONE 2012, 7, e36667. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.L.; Monteiro, B.; Azevedo, J.; Campos, A.; Osório, H.; Vasconcelos, V. Effects of the Naturally-Occurring Contaminant Microcystins on the Azolla filiculoides–Anabaena azollae Symbiosis. Ecotoxicol. Environ. Saf. 2015, 118, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Santos, C.; Azevedo, J.; Campos, A.; Vasconcelos, V.; Pereira, A.L. Biochemical and Growth Performance of the Aquatic Macrophyte Azolla filiculoides to Sub-Chronic Exposure to Cylindrospermopsin. Ecotoxicology 2015, 24, 1848–1857. [Google Scholar] [CrossRef]
- Pereira, A.; Carrapico, F. Culture of Azolla filiculoides in Artificial Conditions. Plant Biosyst. 2009, 2009, 431–434. [Google Scholar] [CrossRef]
- Peters, G.A.; Mayne, B.C. The Azolla, Anabaena azollae Relationship: I. Initial Characterization of the Association. Plant Physiol. 1974, 53, 813–819. [Google Scholar] [CrossRef]
- Rai, A.K.; Rai, V. Effect of NaCl on Growth, Nitrate Uptake and Reduction and Nitrogenase Activity of Azolla pinnata–Anabaena azollae. Plant Sci. 2003, 164, 61–69. [Google Scholar] [CrossRef]
- Baptista, M.S.; Vasconcelos, R.G.W.; Ferreira, P.C.; Almeida, C.M.R.; Vasconcelos, V.M. Assessment of the Non-Protein Amino Acid BMAA in Mediterranean Mussel Mytilus galloprovincialis after Feeding with Estuarine Cyanobacteria. Environ. Sci. Pollut. Res. 2015, 22, 12501–12510. [Google Scholar] [CrossRef]
- Lopes, V.R.; Ramos, V.; Martins, A.; Sousa, M.; Welker, M.; Antunes, A.; Vasconcelos, V.M. Phylogenetic, Chemical and Morphological Diversity of Cyanobacteria from Portuguese Temperate Estuaries. Mar. Environ. Res. 2012, 73, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Schembri, M.A.; Neilan, B.A.; Saint, C.P. Identification of Genes Implicated in Toxin Production in the Cyanobacterium Cylindrospermopsis raciborskii. Env. Toxicol. 2001, 16, 413–421. [Google Scholar] [CrossRef] [PubMed]
- Fergusson, K.M.; Saint, P.C. Multiplex PCR Assay for Cylindrospermopsis raciborskii and Cylindrospermopsin-Producing Cyanobacteria. Env. Toxicol. 2003, 18, 120–125. [Google Scholar] [CrossRef]
- Jungblut, A.-D.; Neilan, B.A. Molecular Identification and Evolution of the Cyclic Peptide Hepatotoxins, Mycrocystin and Nodularin Synthetases Genes in the Three Orders of Cyanobacteria. Arch. Microbiol. 2006, 185, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Hisbergues, M.; Christiansen, G.; Rouhiainen, L.; Sivonen, K.; Börner, T. PCR-Based Identification of Microcystin-Producing Genotypes of Different Cyanobacterial Genera. Arch. Microbiol. 2003, 180, 402–410. [Google Scholar] [CrossRef] [PubMed]
- Nonneman, D.; Zimba, P.V. A PCR-Based Test to Assess the Potential for Microcystin Occurrence in Channel Catfish Production Ponds. J. Phycol. 2002, 38, 230–233. [Google Scholar] [CrossRef]
- Neilan, B.A.; Dittmann, E.; Rouhiainen, L.; Bass, R.A.; Schaub, V.; Sivonen, K.; Börner, T. Nonribosomal Peptide Synthesis and Toxigenicity of Cyanobacteria. J. Bacteriol. 1999, 181, 4089–4097. [Google Scholar] [CrossRef]
- Mikalsen, B.; Boison, G.; Skulberg, O.M.; Fastner, J.; Davies, W.; Gabrielsen, T.M.; Rudi, K.; Jakobsen, K.S. Natural Variation in the Microcystin Synthetase Operon mcyABC and Impact on Microcystin Production in Microcystis Strains. J. Bacteriol. 2003, 185, 2774–2785. [Google Scholar] [CrossRef]
- Ouahid, Y.; Pérez-Silva, G.; del Campo, F.F. Identification of Potentially Toxic Environmental Microcystis by Individual and Multiple PCR Amplification of Specific Microcystin Synthetase Gene Regions. Env. Toxicol. 2005, 20, 235–242. [Google Scholar] [CrossRef]
- Méjean, A.; Mann, S.; Maldiney, T.; Vassiliadis, G.; Lequin, O.; Ploux, O. Evidence That Biosynthesis of the Neurotoxic Alkaloids Anatoxin-a and Homoanatoxin-a in the Cyanobacterium Oscillatoria PCC 6506 Occurs on a Modular Polyketide Synthase Initiated by L -Proline. J. Am. Chem. Soc. 2009, 131, 7512–7513. [Google Scholar] [CrossRef]
Accession a | Species Name | Origin and Harvest Year | Source b/ Collector |
---|---|---|---|
PI1 *,$ | A. pinnata subsp. imbricata | Philippines, Sto Domingo, Albay, 1975 | IRRI |
PI2 | Malaysia, Bumbong Lima, Butterworth, 1977 | IRRI | |
PI23 | India, Cuttack, Orissa, 1978 | CRRI | |
PI68 | Sri Lanka, Tissa, 1984 | S. Kulasooriya | |
PI102 | Japan, Okinawa, 1987 | O. Mochida | |
PI503 | Australia, Murdoch, 1978 | M. Dilworth | |
PI531 | Indonesia, Bali, 1983 | - | |
PI540 | China, Putian, 1989 | C. van Hove | |
FI1001 * | A. filiculoides | East Germany (ex-GDR), 1979 | IB China |
FI1008 | USA, Cranmore Road, Sutter Co., California, 1981 | D. Rains | |
FI1010 | Peru, PUFFI, Lima, 1982 | CIAT | |
FI1042 | Brazil, Parana, 1987 | I. Watanabe | |
FI1052 | South of France, North of Lyon, 1989 | P. Roger | |
FI1090 | Japan, Tanabe-cho, 1992 | S. Kitoh | |
FI1501 | Belgian, Harchies, 1987 | A. Lawalree | |
FI1505 | South Africa, Verwoerd dam, 1987 | D. Toerien | |
FI1507 $ | Colombia, Zipaquira, 1987 | Y. Lopez | |
FI1522 | Switzerland, Zurich Botanical Garden, 1987 | - | |
FI-BGLU | Botanical Garden of Lisbon University, 2009 | A.L. Pereira | |
FI-BGM | Botanical Garden of Madeira, Funchal, 2010 | C. Lobo | |
ME2001 * | A. mexicana | USA, Graylodge, California, 1978 | D. Rains |
ME2008 | Colombia, CIAT, Cali, 1982 | CIAT | |
ME2011 | Japan, Osaka, 1984 | T. Lumpkin | |
ME2026 $ | Brazil, Solimoes river, Pacencia Island, Iranduba, Amazonas (BLCC 18), 1984 | T. Lumpkin | |
CA3001 *,$ | A. caroliniana | USA, Ohio, 1978 | D. Rains |
CA3017 | Brazil, Rio Grande do Sul, 1987 | I. Watanabe | |
CA3502 | Egypt, Moshtohr University, 1987 | C. Myttenaere | |
CA3507 | Suriname, Boxel, 1987 | H. Lardinois | |
CA3513 | Zimbabwe, Causeway Botanical Garden, 1987 | T. Muller | |
CA3524 | Holland, 1987 | E. Ohoto | |
CA3525 | Ruanda, Cyili Rice Research Center, 1987 | C. van Hove | |
MI4018 * | A. microphylla | Paraguay, 1981 | D. Rains |
MI4021 $ | Equator, Santa Cruz Island, Galapagos, 1982 | T. Lumpkin | |
MI4028 | Philippines, hybrid (MI4018xFI1001), 1985 | Do Van Cat | |
MI4054 | Brazil, Baía, 1987 | I. Watanabe | |
MI4510 | Philippines, Los Baños, IRRI, 1987 | C. van Hove | |
NI5001 *,$ | A. nilotica | Sudan, Kosti, 1982 | T. Lumpkin |
NI5002 # | Sudan, Kosti, 1989 | T. Lumpkin | |
NI5501 | Burundi, Bujumbura, 1987 | J. Bouharmont | |
RU6010 * | A. rubra | New Zealand, Nouville, 1986 | C. van Hove |
RU6502 | Australia, Victoria (37.40 S–144.40 E), 1985 | - | |
RU6503 | New Zealand, between Lumdsen and Kingston, 1986 | C. van Hove | |
PP7001 *,$ | A. pinnata subsp. pinnata | Australia, Kakadu Northern Park Northern Territory, 1982 | Yatazawa |
PP7506 | Sierra Leone, 1982 | C Dixon | |
PP7509 | Nigeria, Moor plantation, 987 | C. van Hove | |
PP7511 | Guinea-Bissau, Contuboel, 1987 | H. Diara | |
PP7512 | Zaire, Kisantu, 1987 | B. Bruyneel | |
PP7546 | Madagascar, Antsahavory, East zone, 1991 | C. van Hove |
Target | Retention Time (min) | Derivatized Ion Precursor (m/z) | CID Fragments (m/z) | CID Colission Energy (V) | Calibration: Curve and Linear Interval (µg/L) | LOD (µg/L) | LOQ (µg/L) |
---|---|---|---|---|---|---|---|
BMAA | 13.92 ± 0.08 | 459.00 | 320, 315, 289, 258, 171, 145 | 35 | y = 1377.4x − 2154.1 r2 = 0.9947 3-250 | 7.99 | 24.2 |
AEG | 13.22 ± 0.11 | 459.00 | 320, 315, 289, 272, 171, 145 | 35 | y = 889.91x + 4972.2 r2 = 0.9993 3-150 | 57.4 | 174 |
2,4-DAB | 14.93 ± 0.15 | 459.00 | 320, 315, 289, 271, 171, 145 | 35 | y = 2785x + 5538.1 r2 = 0.9934 7-250 | 70 | 212 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bujak, J.P.; Pereira, A.L.; Azevedo, J.; Bujak, A.A.; Leshyk, V.; Pham Gia, M.; Stadtlander, T.; Vasconcelos, V.; Winstead, D.J. Azolla as a Safe Food: Suppression of Cyanotoxin-Related Genes and Cyanotoxin Production in Its Symbiont, Nostoc azollae. Plants 2024, 13, 2707. https://doi.org/10.3390/plants13192707
Bujak JP, Pereira AL, Azevedo J, Bujak AA, Leshyk V, Pham Gia M, Stadtlander T, Vasconcelos V, Winstead DJ. Azolla as a Safe Food: Suppression of Cyanotoxin-Related Genes and Cyanotoxin Production in Its Symbiont, Nostoc azollae. Plants. 2024; 13(19):2707. https://doi.org/10.3390/plants13192707
Chicago/Turabian StyleBujak, Jonathan P., Ana L. Pereira, Joana Azevedo, Alexandra A. Bujak, Victor Leshyk, Minh Pham Gia, Timo Stadtlander, Vitor Vasconcelos, and Daniel J. Winstead. 2024. "Azolla as a Safe Food: Suppression of Cyanotoxin-Related Genes and Cyanotoxin Production in Its Symbiont, Nostoc azollae" Plants 13, no. 19: 2707. https://doi.org/10.3390/plants13192707
APA StyleBujak, J. P., Pereira, A. L., Azevedo, J., Bujak, A. A., Leshyk, V., Pham Gia, M., Stadtlander, T., Vasconcelos, V., & Winstead, D. J. (2024). Azolla as a Safe Food: Suppression of Cyanotoxin-Related Genes and Cyanotoxin Production in Its Symbiont, Nostoc azollae. Plants, 13(19), 2707. https://doi.org/10.3390/plants13192707