Unraveling Quinoa (Chenopodium quinoa Willd.) Defense Against Downy Mildew (Peronospora variabilis): Comparative Molecular Analysis of Resistant “Hualhuas” and Susceptible “Real” Cultivars
Abstract
:1. Introduction
2. Results
2.1. Disease Symptoms, Incidence, Severity, and Susceptibility Index
2.2. Hydrogen Peroxide Localization and Contents
2.3. Enzyme Activity
2.4. Expression of Quinoa Defense Genes
3. Discussion
4. Materials and Methods
4.1. Plant Materials, Growth Conditions, Experimental Setup, and Plant Inoculation
4.2. Assessment of Disease Incidence, Severity, and Susceptibility Index
4.3. Histochemical Localization of Hydrogen Peroxide (H2O2)
4.4. Hydrogen Peroxide (H2O2) Content
4.5. Extraction and Assay of Peroxidase (POX) Activity
4.6. Extraction and Assay of Phenylalanine Ammonia-Lyase (PAL) Activity
4.7. Gene Expression Levels of PAL, POX, and PR-10
4.8. Gel Electrophoresis Image Analysis Method
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Daoud, S.; Elbrik, K.; Tachbibi, N.; Bouqbis, L.; Brakez, M.; Harrouni, M.C. The Potential Use of Halophytes for the Development of Marginal Dry Areas in Morocco. In Halophytes for Food Security in Dry Lands; Khan, M.A., Ozturk, M., Gul, B., Ahmed, M.Z., Eds.; Academic Press: Cambridge, MA, USA, 2016; pp. 141–156. [Google Scholar]
- Maradini, F.A.; Pirozi, M.; Borges, J.; Pinheiro-Sant’Ana, H.; Chaves, J.; Coimbra, J. Quinoa: Nutritional, Functional and Antinutritional Aspects. Crit. Rev. Food Sci. Nutr. 2015, 57, 1618–1630. [Google Scholar]
- Ruiz, K.B.; Aloisi, I.; Duca, S.D.; Canelo, V.; Torrigiani, P.; Silva, H.; Biondi, S. Salares versus coastal ecotypes of quinoa: Salinity responses in Chilean landraces from contrasting habitats. Plant Physiol. Biochem. 2016, 101, 1–13. [Google Scholar] [CrossRef]
- Hussin, S.A.; Ali, S.H.; Lotfy, M.E.; Abd El-Samad, E.; Eid, M.; Abdelkader, A.; Eisa, S. Morpho-physiological mechanisms of two different quinoa ecotypes to resist salt stress. BMC Plant Biol. 2023, 23, 374. [Google Scholar] [CrossRef]
- Pulvento, C.; Riccardi, M.; Lavini, A.; d’Andria, R.; Iafelice, G.; Marconi, E. Field trial evaluation of two Chenopodium quinoa genotypes grown under rain-fed conditions in a typical Mediterranean environment in south Italy. J. Agron. Crop Sci. 2010, 196, 407–411. [Google Scholar] [CrossRef]
- Munir, H.; Basra, S.M.A.; Cheema, M.A.; Wahid, A. Phenotypic flexibility in exotic quinoa (Chenopodium quinoa Willd.) germplasm for seedling vigor and viability. Pak. J. Agric. Sci. 2011, 48, 255–261. [Google Scholar]
- Bazile, D.; Jacobsen, S.-E.; Verniau, A. The global expansion of quinoa: Trends and limits. Front. Plant Sci. 2016, 7, 622. [Google Scholar] [CrossRef]
- Barakat, H.; Khalifa, I.; Ghazal, G.; Shams, A.; Denev, P. Chemical composition and nutritional value of seeds from new quinoa accessions, cultivated in Egypt. Bulg. Chem. Commun. 2017, 49, 231–238. [Google Scholar]
- Danielsen, S.; Bonifacio, A.; Ames, T. Diseases of quinoa (Chenopodium quinoa). Food Rev. Int. 2003, 19, 43–59. [Google Scholar] [CrossRef]
- Dřímalková, M. Mycoflora of Chenopodium quinoa Willd. seeds. Plant Prot. Sci. 2003, 39, 146–150. [Google Scholar]
- Danielsen, S.; Mercado, V.H.; Munk, L.; Ames, T. Seed transmission of downy mildew (Peronospora farinosa f. sp. chenopodii) in quinoa and effect of relative humidity on seedling infection. Seed Sci. Technol. 2004, 32, 91–98. [Google Scholar] [CrossRef]
- Choi, Y.J.; Danielsen, S.; Lübeck, M.; Hong, S.B.; Delhey, R.; Shin, H.D. Morphological and molecular characterization of the causal agent of downy mildew on Quinoa (Chenopodium quinoa). Mycopathologia 2010, 169, 403–412. [Google Scholar] [CrossRef]
- Khalifa, W.; Thabet, M. Variation in downy mildew (Peronospora variabilis Gäum) resistance of some quinoa (Chenopodium quinoa Willd) cultivars under Egyptian conditions. Middle East J. Agric. Res. 2018, 7, 671–682. [Google Scholar]
- Danielsen, S.; Ames, T. Mildew (Peronospora farinosa) of Quinua (Chenopodium quinoa) in the Andean Region: Practical Manual for the Study of the Disease and Pathogen; International Potato Center: Lima, Peru, 2004. [Google Scholar]
- Garcia, R.G. Fitopatologia Agricola del Peru; Estacion Agricola de La Molina, Ministerio de Agricultura: Lima, Peru, 1947. [Google Scholar]
- Tewari, J.P.; Boyetchko, S.M. Occurrence of Peronospora farinosa f. sp. chenopodii on quinoa in Canada. Can. Plant Dis. Surv. 1947, 70, 127–128. [Google Scholar]
- Kumar, A.; Bhargava, A.; Shukla, S.; Singh, H.B.; Ohri, D. Screening of exotic Chenopodium quinoa accessions for downy mildew resistance under mid-eastern conditions of India. Crop Prot. 2006, 25, 879–889. [Google Scholar] [CrossRef]
- Testen, A.L.; McKemy, J.M.; Backman, P.A. First Report of Quinoa Downy Mildew Caused by Peronospora Variabilis in the United States. Plant Dis. 2012, 96, 146. [Google Scholar] [CrossRef]
- El-Assiuty, E.M.; Taha, E.M.; Fahmy, Z.M.; Fahmy, G.M. Histological and Molecular Detections of Peronospora Variabilis Gäum Oospores in Seeds of Quinoa (Chenopodium quinoa Willd). Egypt. J. Exp. Biol. 2019, 15, 197–203. [Google Scholar]
- Mhada, M.; Ezzahiri, B.; Benlhabib, O. Assessment of Downy mildew Resistance (Peronospora farinosa) in a Quinoa (Chenopodium quinoa Willd) Germplasm. IJBMR 2015, 6, 4748–4752. [Google Scholar]
- Kitz, L. Evaluation of Downy Mildew (Peronospora farinosa f. sp. chenopodii) Resistance among Quinoa Genotypes and Investigation of P. farinosa Growth Using Scanning Electron Microscopy. Ph.D. Thesis, Brigham Young University, Provo, UT, USA, 2008. [Google Scholar]
- Danielsen, S. Heterothallism in Peronospora farinosa f. sp. chenopodii, the Causal Agent of Downy Mildew of Quinoa (Chenopodium quinoa). J. Basic Microbiol. 2001, 41, 305–309. [Google Scholar] [CrossRef]
- Danielsen, S.; Munk, L. Evaluation of Disease Assessment Methods in Quinoa for Their Ability to Predict Yield Loss Caused by Downy Mildew. Crop Prot. 2004, 23, 219–228. [Google Scholar] [CrossRef]
- Gechev, T.S.; Hille, J. Hydrogen peroxide as a signal controlling plant programmed cell death. J. Cell Biol. 2005, 168, 17–20. [Google Scholar] [CrossRef] [PubMed]
- Testen, A.L.; del Mar Jiménez-Gasco, M.; Ochoa, J.B.; Backman, P.A. Molecular Detection of Peronospora Variabilis in Quinoa Seed and Phylogeny of the Quinoa Downy Mildew Pathogen in South America and the United States. Phytopathology 2014, 104, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Ochoa, J.; Frinking, H.D.; Jacobs, T. Postulation of virulence groups and resistance factors in the quinoa/downy mildew pathosystem using material from Ecuador. Plant Pathol. 1999, 48, 425–430. [Google Scholar] [CrossRef]
- Swenson, E.M. Genetic Diversity of Bolivian Peronospora farinosa f. sp. chenopodii (Downy Mildew) and Quinoa’s Resistance Response. Ph.D. Thesis, Brigham Young University, Provo, UT, USA, 2006. [Google Scholar]
- Rollano-Peñaloza, O.M.; Palma-Encinas, V.; Widell, S.; Mollinedo, P.; Rasmusson, A.G. The Disease Progression and Molecular Defense Response in Chenopodium Quinoa Infected with Peronospora Variabilis, the Causal Agent of Quinoa Downy Mildew. Plants 2022, 11, 2946. [Google Scholar] [CrossRef] [PubMed]
- Aydogdu, M.; Koc, A. Screening quinoa (Chenopodium quinoa) germplasm for resistance to downy mildew (Peronospora variabilis) in Turkey. Crop Pasture Sci. 2021, 72, 416–425. [Google Scholar]
- Colque-Little, C.; Abondano, M.C.; Lund, O.S.; Amby, D.B.; Piepho, H.P.; Andreasen, C.; Schmöckel, S.; Schmid, K. Genetic Variation for Tolerance to the Downy Mildew Pathogen Peronospora Variabilis in Genetic Resources of Quinoa (Chenopodium quinoa). BMC Plant Biol. 2021, 21, 41. [Google Scholar] [CrossRef] [PubMed]
- Fuentes, F.F.; Martinez, E.A.; Hinrichsen, P.V.; Jellen, E.N.; Maughan, P.J. Assessment of genetic diversity patterns in Chilean quinoa (Chenopodium quinoa Willd.) germplasm using multiplex fluorescent microsatellite markers. Conserv. Genet. 2009, 10, 369–377. [Google Scholar] [CrossRef]
- Gandarillas, A.; Saravia, R.; Plata, G.; Quispe, R.; Ortiz-Romero, R. State of the Art Report on Quinoa Around the World in 2013; FAO & CIRAD: Rome, Italy, 2015. [Google Scholar]
- Fondevilla, S.; Calderón-González, Á.; Rojas-Panadero, B.; Cruz, V.; Matías, J. Genome-wide association study, combined with bulk segregant analysis, identify plant receptors and defense related genes as candidate genes for downy mildew resistance in quinoa. BMC Plant Biol. 2024, 24, 594. [Google Scholar] [CrossRef]
- Shetty, N.P.; Jørgensen, H.J.L.; Jensen, J.D.; Collinge, D.B.; Shetty, H.S. Roles of reactive oxygen species in interactions between plants and pathogens. Eur. J. Plant Pathol. 2008, 121, 267–280. [Google Scholar] [CrossRef]
- Bolwell, G.P. Role of active oxygen species and NO in plant defence responses. Curr. Opin. Plant Biol. 1999, 2, 287–294. [Google Scholar] [CrossRef]
- Patykowski, J.; Urbanek, H. Activity of enzymes related to H2O2 generation in leaf apoplastic fraction of tomato leaves infected with Botrytis cinerea. J. Phytopathol. 2003, 151, 153–161. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive Oxygen Species: Metabolism, Oxidative Stress, and Signal Transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed]
- Baker, C.; Orlandi, E. Active oxygen in plant pathogenesis. Annu. Rev. Phytopathol. 1995, 33, 299–321. [Google Scholar] [CrossRef] [PubMed]
- Costet, L.; Dorey, S.; Fritig, B.; Kauffmann, S. A pharmacological approach to test the diffusible signal activity of reactive oxygen intermediates in elicitor-treated tobacco leaves. Plant Cell Physiol. 2002, 43, 91–98. [Google Scholar] [CrossRef]
- Mehdy, M.C. Active Oxygen Species in Plant Defense against Pathogens. Plant Physiol. 1994, 105, 467–472. [Google Scholar] [CrossRef] [PubMed]
- Király, L.; Künstler, A.; Fattinger, M.; Höller, K.; Juhász, C.; Müller, M.; Gullner, G.; Zechmann, B. Sulfate supply influences compartment specific glutathione metabolism and confers enhanced resistance to tobacco mosaic virus during a hypersensitive response. Plant Physiol. Biochem. 2012, 59, 44–54. [Google Scholar] [CrossRef] [PubMed]
- Wojtaszek, P. Oxidative burst: A plant’s early response against infection. Biochem. J. 1997, 322, 681–692. [Google Scholar] [CrossRef]
- Chittoor, J.M.; Leach, J.E.; White, F.F. Induction of peroxidase during defense against pathogens. In Pathogenesis Related Proteins in Plants; Datta, S.K., Muthukrishnan, S., Eds.; CRC Press: Boca Raton, FL, USA, 1999; pp. 171–193. [Google Scholar]
- Irisarri, P.; Zhebentyayeva, T.; Errea, P.; Pina, A. Differential expression of phenylalanine ammonia lyase (PAL) genes implies distinct roles in development of graft incompatibility symptoms in Prunus. Sci. Hortic. 2016, 204, 16–24. [Google Scholar] [CrossRef]
- Vogt, T. Phenylpropanoid biosynthesis. Mol. Plant. 2010, 3, 2–20. [Google Scholar] [CrossRef]
- Wang, Q.; Ge, X.; Tian, X.; Zhang, Y.; Zhang, J.; Zhang, P. Soy isoflavone: The multipurpose phytochemical (Review). Biomed. Rep. 2013, 1, 697–701. [Google Scholar] [CrossRef]
- Kamalipourazad, M.; Sharifi, M.; Zare, M.H.; Behmanesh, M.; Ahmadian, C.N. Induction of aromatic amino acids and phenylpropanoid compounds in Scrophularia striata Boiss. cell culture in response to chitosan-induced oxidative stress. Plant Physiol. Biochem. 2016, 107, 374–384. [Google Scholar] [CrossRef] [PubMed]
- Han, C.; Jin, P.; Li, M.L.; Wang, L.; Zheng, Y.H. Physiological and Transcriptomic Analysis Validates Previous Findings of Changes in Primary Metabolism for the Production of Phenolic Antioxidants in Wounded Carrots. J. Agric. Food Chem. 2017, 65, 7159–7167. [Google Scholar] [CrossRef]
- Way, H.M.; Kazan, K.; Mitter, N.; Goulter, K.C.; Birch, R.G.; Manners, J.M. Constitutive expression of a phenylalanine ammonia-lyase gene from Stylosanthes humilis in transgenic tobacco leads to enhanced disease resistance but impaired plant growth. Physiol. Mol. Plant Pathol. 2002, 60, 275–282. [Google Scholar] [CrossRef]
- Mould, M.J.; Xu, T.; Barbara, M.; Iscove, N.N.; Heath, M.C. cDNAs generated from individual epidermal cells reveal that differential gene expression predicting subsequent resistance or susceptibility to rust fungal infection occurs prior to the fungus entering the cell lumen. Mol. Plant Microbe Interact. 2003, 16, 835–845. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.D.; Backhouse, D. Induction of defence responses in roots and mesocotyls of sorghum seedlings by inoculation with Fusarium thapsinum and F. proliferatum. J. Phytopathol. 2005, 153, 522–529. [Google Scholar]
- Lozovaya, V.V.; Waranyuwat, A.; Widholm, J.M. β-l,3-glucanase and resistance to Aspergillus flavus infection in maize. Crop. Sci. 1998, 38, 1255–1260. [Google Scholar] [CrossRef]
- Van Loon, L.C.; Van Strien, E.A. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol. 1999, 55, 85–297. [Google Scholar] [CrossRef]
- McDowell, J.M.; Dangl, J.L. Signal transduction in the plant immune response. Trends Biochem. Sci. 2000, 25, 79–82. [Google Scholar] [CrossRef]
- Calderón-González, Á.; Matías, J.; Cruz, V.; Molinero-Ruiz, L.; Fondevilla, S. Identification and Characterization of Sources of Resistance to Peronospora variabilis in Quinoa. Agronomy 2023, 13, 284. [Google Scholar] [CrossRef]
- Bonifacio, A. Chenopodium spp.: Genetic resources, ethnobotany, and geographic distribution. Food Rev. Int. 2003, 19, 1–7. [Google Scholar] [CrossRef]
- Mellersh, D.G.; Foulds, I.V.; Higgens, V.J.; Heath, M.C. H2O2 plays different roles in determining penetration failure in three diverse plant–fungal interactions. Plant J. 2002, 29, 257–268. [Google Scholar] [CrossRef] [PubMed]
- Gabriel, J.; Luna, N.; Vargas, A.; Magne, J.; Angulo, A.; La Torre, J.; Bonifacio, A. Quinua de Valle (Chenopodium quinoa Willd.): Fuente Valiosa de Resistencia Genética al Mildiu (Peronospora farinosa Willd.). J. Selva Andin. Res. Soc. 2012, 3, 27–44. [Google Scholar] [CrossRef]
- Sharma, R.; Sindhu, S.; Sindhu, S.S. Suppression of Alternaria blight disease and plant growth promotion of mustard (Brassica juncea L.) by antagonistic rhizosphere bacteria. Appl. Soil Ecol. 2018, 129, 145–150. [Google Scholar] [CrossRef]
- Posmyk, M.M.; Kontek, R.; Janas, K.M. Antioxidant enzymes activities and phenolic compounds content in red cabbage seedlings exposed copper stress. Ecotoxicol. Environ. Saf. 2009, 72, 596–602. [Google Scholar] [CrossRef] [PubMed]
- Rivero, R.M.; Kojima, M.; Gepstein, A.; Sakakibara, H.; Mittler, R.; Gepstein, S.; Blumwald, E. Delayed leaf senescence induces extreme drought tolerance in a flowering plant. Proc. Natl. Acad. Sci. USA 2007, 104, 19631–19636. [Google Scholar] [CrossRef] [PubMed]
- Papadakis, A.; Roubelakis-Angelakis, K. The generation of active oxygen species differs in tobacco and grapevine mesophyll protoplasts. Plant Physiol. 1999, 121, 197–205. [Google Scholar] [CrossRef]
- Hücklehoven, R. Cell wall-associated mechanisms of disease resistance and susceptibility. Annu. Rev. Phytopathol. 2007, 45, 101–127. [Google Scholar] [CrossRef]
- Maksimov, I.V.; Abizgildina, P.P.; Sorokan, A.V.; Burkhanova, G.F. Regulation of Peroxidase Activity under the Influence of Signaling Molecules and Bacillus subtilis 26D in Potato Plants Infected with Phytophthora infestans. Appl. Biochem. Microbiol. 2014, 50, 173–178. [Google Scholar] [CrossRef]
- Mydlarz, L.D.; Harvell, C.D. Peroxidase activity and inducibility in the see fan coral exposed to a fungal pathogen. Comp. Biochem. Physiol. Part A 2007, 146, 54–62. [Google Scholar] [CrossRef]
- Khalifa, W.; Thabet, M. Biochar amendment enhances tomato resistance to some soilborne pathogens. Middle East J. Agric. Res. 2015, 4, 1088–1100. [Google Scholar]
- Apostol, I.; Heinstein, P.F.; Low, P.S. Rapid stimulation of an oxidative burst during elicitation of cultured plant cells. Plant Physiol. 1989, 90, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Bradley, D.J.; Kjellbom, P.; Lamb, C.J. Elicitor- and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: A novel, rapid defense response. Cell 1992, 10, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Brisson, L.F.; Tenhaken, R.; Lamb, C.J. Function of oxidative cross-linking of cell wall structural proteins in plant disease resistance. Plant Cell 1994, 6, 1703–1712. [Google Scholar] [CrossRef]
- Wu, S.C.; Ham, K.S.; Darvill, A.G.; Albersheim, P. Deletion of Two Endo-β-1,4-Xylanase Genes Reveals Additional Isozymes Secreted by the Rice Blast Fungus. Mol. Plant Microbe Interact. 1997, 10, 700–708. [Google Scholar] [CrossRef]
- Ros Barceló, A. Xylem parenchyma cells deliver the H2O2 necessary for lignification in differentiating xylem vessels. Planta 2005, 220, 747–756. [Google Scholar] [CrossRef]
- Molinero-Ruiz, M.L.; Melero-Vara, J.M.; Domínguez, J. Inheritance of resistance to race 330 of Plasmopara halstedii in three sunflower lines. Plant Breed. 2002, 121, 61–65. [Google Scholar] [CrossRef]
- Pieterse, C.M.J.; Leon-Reyes, A.; Van der Ent, S.; Van Wees, S.C.M. Networking by small-molecule hormones in plant immunity. Nat. Chem. Biol. 2009, 5, 308–316. [Google Scholar] [CrossRef] [PubMed]
- Golkari, S.; Gilbert, J.; Ban, T.; Procunier, J.D. QTL-specific microarray gene expression analysis of wheat resistance to fusarium head blight in sumai-3 and two susceptible NILs. Genome 2009, 52, 409–418. [Google Scholar] [CrossRef]
- Jain, D.; Khurana, J.P. Role of pathogenesis-related (PR) proteins in plant defense mechanism. In Molecular Aspects of Plant-Pathogen Interaction; Singh, A., Singh, I., Eds.; Springer: Singapore, 2018. [Google Scholar]
- Sliwiak, J.; Sikorski, M.; Jaskolski, M. PR-10 proteins as potential mediators of melatonin-cytokinin cross-talk in plants: Crystallographic studies of LlPR-10.2B isoform from yellow lupine. FEBS J. 2018, 285, 1907–1922. [Google Scholar] [CrossRef]
- Kattupalli, D.; Srinivasan, A.; Soniya, E.V. A genome-wide analysis of pathogenesis-related protein-1 (PR-1) genes from piper nigrum reveals its critical role during Phytophthora capsici infection. Genes 2021, 12, 1007. [Google Scholar] [CrossRef]
- Steiner-Lange, S.; Fischer, A.; Boettcher, A.; Rouhara, I.; Liedgens, H.; Schmelzer, E.; Knogge, W. Differential defense reactions in leaf tissues of barley in response to infection by Rhynchosporium secalis and to treatment with a fungal avirulence gene product. Mol. Plant Microbe Interact. 2003, 16, 893–902. [Google Scholar] [CrossRef]
- Zierold, U.; Scholz, U.; Schweizer, P. Transcriptome analysis of mlo-mediated resistance in the epidermis of barley. Mol. Plant Pathol. 2005, 6, 139–151. [Google Scholar] [CrossRef] [PubMed]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Circ. Calif. Agric. Exp. Stn. 1938, 347, 39. [Google Scholar]
- Wan, Y.; Schwaninger, H.; He, P.; Wang, Y. Comparison of resistance to powdery mildew and downy mildew in Chinese wild grapes. Vitis 2007, 46, 132–136. [Google Scholar]
- Staudt, D.; Kassemeyer, H.H. Evaluation of downy mildew resistance in various accessions of wild Vitis species. Vitis 1995, 34, 225–228. [Google Scholar]
- Shetty, N.P.; Kristensen, B.K.; Newman, M.A.; Møller, K.; Gregersen, P.L.; Jørgensen, H.J.L. Association of hydrogen peroxide with restriction of Septoria tritici in resistant wheat. Physiol. Mol. Plant Pathol. 2003, 62, 333–346. [Google Scholar] [CrossRef]
- Junglee, S.; Urban, L.; Huguette, S.; Lopez, F. Optimized Assay for Hydrogen Peroxide Determination in Plant Tissue Using Potassium Iodide. Am. J. Analyt. Chem. 2014, 5, 730–736. [Google Scholar] [CrossRef]
- Biles, C.L.; Martyn, R.D. Peroxidase, polyphenoloxidase and shikimate dehydrogenase isozymes in relation to the tissue type, maturity and pathogen induction of watermelon seedlings. Plant Physiol. Biochem. 1993, 31, 499–506. [Google Scholar]
- Hammerschmidt, R.; Nuckles, E.M.; Kuc, J. Association of enhanced peroxidase activity with induced systemic resistance of cucumber of Colletotrichum lagenarium. Physiol. Mol. Plant Pathol. 1982, 20, 73–82. [Google Scholar] [CrossRef]
- Solecka, D.; Kacperska-Palacz, A. Phenylpropanoid deficiency affects the course of plant acclimation to cold. Physiol. Plant 2003, 119, 253–262. [Google Scholar] [CrossRef]
Cultivar | Treatments | Disease Incidence | Susceptibility Index |
Hualhuas | Non-inoculated | 0.000 ± 0.000 | 0.000 ± 0.000 a |
Inoculated | 0.000 ± 0.000 a | 0.000 ± 0.000 a | |
Real | Non-inoculated | 0.000 ± 0.000 a | 0.000 ± 0.000 a |
Inoculated | 65.863 ± 4.363 b | 66.015 ± 0.264 b |
Gene | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
---|---|---|
POX | GGTCAGGTAATCCAGTGTTGC | GCTCTCCGGGGCTCAC |
PAL | AAGCTGATGTTCGCGCAGTTCT | AAACCATAGTCCAAGCTCGG |
PR10 | AAGGAGATGTTCTTGGAGACAAACTTG | AGCGTAGACAGAAGGATTGGCG |
Actin | TCATACGGTCAGCAATAC | ATGTGGATATCAGGAAGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khalifa, W.; Khalil, H.B.; Thabet, M. Unraveling Quinoa (Chenopodium quinoa Willd.) Defense Against Downy Mildew (Peronospora variabilis): Comparative Molecular Analysis of Resistant “Hualhuas” and Susceptible “Real” Cultivars. Plants 2024, 13, 3344. https://doi.org/10.3390/plants13233344
Khalifa W, Khalil HB, Thabet M. Unraveling Quinoa (Chenopodium quinoa Willd.) Defense Against Downy Mildew (Peronospora variabilis): Comparative Molecular Analysis of Resistant “Hualhuas” and Susceptible “Real” Cultivars. Plants. 2024; 13(23):3344. https://doi.org/10.3390/plants13233344
Chicago/Turabian StyleKhalifa, Walaa, Hala Badr Khalil, and Marian Thabet. 2024. "Unraveling Quinoa (Chenopodium quinoa Willd.) Defense Against Downy Mildew (Peronospora variabilis): Comparative Molecular Analysis of Resistant “Hualhuas” and Susceptible “Real” Cultivars" Plants 13, no. 23: 3344. https://doi.org/10.3390/plants13233344
APA StyleKhalifa, W., Khalil, H. B., & Thabet, M. (2024). Unraveling Quinoa (Chenopodium quinoa Willd.) Defense Against Downy Mildew (Peronospora variabilis): Comparative Molecular Analysis of Resistant “Hualhuas” and Susceptible “Real” Cultivars. Plants, 13(23), 3344. https://doi.org/10.3390/plants13233344