A Physiological and Molecular Focus on the Resistance of “Filippo Ceo” Almond Tree to Xylella fastidiosa
Abstract
:1. Introduction
2. Results
2.1. Plant Health and Physiological Characterisation
2.2. Gene Expression Analysis
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Relative Water Content (RWC)
4.3. Free Proline Determination
4.4. Total RNA Isolation, cDNA Synthesis, and Real-Time PCR Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zandalinas, S.I.; Balfagón, D.; Gómez-Cadenas, A.; Mittler, R. Plant responses to climate change: Metabolic changes under combined abiotic stresses. J. Exp. Bot. 2022, 73, 3339–3354. [Google Scholar] [CrossRef] [PubMed]
- Rivero, R.M.; Mittler, R.; Blumwald, E.; Zandalinas, S.I. Developing climate-resilient crops: Improving plant tolerance to stress combination. Plant J. 2022, 109, 373–389. [Google Scholar] [CrossRef]
- Aung, K.; Jiang, Y.; He, S.Y. The role of water in plant–microbe interactions. Plant J. 2018, 93, 771–780. [Google Scholar] [CrossRef]
- Cheng, Y.T.; Zhang, L.; He, S.Y. Plant-microbe interactions facing environmental challenge. Cell Host Microbe 2019, 26, 183–192. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.K.; Iandolino, A.; Da Silva, F.G.; Cook, D.R. Water deficit modulates the response of vitis vinifera to the Pierce’s disease pathogen xylella fastidiosa. Mol. Plant-Microbe Interact. 2013, 26, 643–657. [Google Scholar] [CrossRef] [PubMed]
- Dossa, G.S.; Torres, R.; Henry, A.; Oliva, R.; Maiss, E.; Cruz, C.V.; Wydra, K. Rice response to simultaneous bacterial blight and drought stress during compatible and incompatible interactions. Eur. J. Plant Pathol. 2017, 147, 115–127. [Google Scholar] [CrossRef]
- Johansen, T.J.; Dees, M.W.; Hermansen, A. High soil moisture reduces common scab caused by Streptomyces turgidiscabies and Streptomyces europaeiscabiei in potato. Acta Agric. Scand. Sect. B Soil. Plant Sci. 2015, 65, 193–198. [Google Scholar]
- Achuo, E.A.; Prinsen, E.; Höfte, M. Influence of drought, salt stress and abscisic acid on the resistance of tomato to Botrytis cinerea and Oidium neolycopersici. Plant Pathol. 2006, 55, 178–186. [Google Scholar] [CrossRef]
- Hatmi, S.; Gruau, C.; Trotel-Aziz, P.; Villaume, S.; Rabenoelina, F.; Baillieul, F.; Eullaffroy, P.; Clément, C.; Ferchichi, A.; Aziz, A. Drought stress tolerance in grapevine involves activation of polyamine oxidation contributing to improved immune response and low susceptibility to Botrytis cinerea. J. Exp. Bot. 2015, 66, 775–787. [Google Scholar] [CrossRef]
- Carluccio, G.; Greco, D.; Sabella, E.; Vergine, M.; De Bellis, L.; Luvisi, A. Xylem Embolism and Pathogens: Can the Vessel Anatomy of Woody Plants Contribute to X. fastidiosa Resistance? Pathogens 2023, 12, 825. [Google Scholar] [CrossRef]
- De Pascali, M.; Vergine, M.; Sabella, E.; Aprile, A.; Nutricati, E.; Nicol, F.; Buja, I.; Negro, C.; Miceli, A.; Rampino, P.; et al. Molecular Effects of Xylella fastidiosa and Drought Combined Stress in Olive Trees. Plants 2019, 8, 437. [Google Scholar] [CrossRef]
- De Pascali, M.; Vergine, M.; Negro, C.; Greco, D.; Vita, F.; Sabella, E.; De Bellis, L.; Luvisi, A. Xylella fastidiosa and Drought Stress in Olive Trees: A Complex Relationship Mediated by Soluble Sugars. Biology 2022, 11, 112. [Google Scholar] [CrossRef] [PubMed]
- Sabella, E.; Aprile, A.; Genga, A.; Siciliano, T.; Nutricati, E.; Nicolì, F.; Vergine, M.; Negro, C.; De Bellis, L.; Luvisi, A. Xylem cavitation susceptibility and refilling mechanisms in olive trees infected by Xylella fastidiosa. Sci. Rep. 2019, 9, 9602. [Google Scholar] [CrossRef] [PubMed]
- Rampino, P.; De Pascali, M.; De Caroli, M.; Luvisi, A.; De Bellis, L.; Piro, G.; Perrotta, C. Td4IN2: A drought-responsive durum wheat (Triticum durum Desf.) gene coding for a resistance like protein with serine/threonine protein kinase, nucleotide binding site and leucine rich domains. Plant Physiol. Biochem. 2017, 120, 223–231. [Google Scholar] [CrossRef]
- Singh, B.; Bohra, A.; Mishra, S.; Joshi, R.; Pandey, S. Embracing new-generation ‘omics’ tools to improve drought tolerance in cereal and food-legume crops. Biol. Plant 2015, 59, 413–428. [Google Scholar] [CrossRef]
- Jain, D.; Khurana, J.P. Role of Pathogenesis-Related (PR) Proteins in Plant Defense Mechanism. In Molecular Aspects of Plant-Pathogen Interaction; Singh, A., Singh, I.K., Eds.; Springer: Singapore, 2018; pp. 265–281. [Google Scholar]
- Baillo, E.H.; Kimotho, R.N.; Zhang, Z.; Xu, P. Transcription factors associated with abiotic and biotic stress tolerance and their potential for crops improvement. Genes 2019, 10, 771. [Google Scholar] [CrossRef]
- Xiang, Y.; Tang, N.; Du, H.; Ye, H.; Xiong, L. Characterization of OsbZIP23 as a key player of the basic leucine zipper transcription factor family for conferring abscisic acid sensitivity and salinity and drought tolerance in rice. Plant Physiol. 2008, 148, 1938–1952. [Google Scholar] [CrossRef]
- Seo, P.J.; Park, C.M. A membrane-bound NAC transcription factor as an integrator of biotic and abiotic stress signals. Plant Signal Behav. 2010, 5, 481–483. [Google Scholar] [CrossRef]
- Nakashima, K.; Ito, Y.; Yamaguchi-Shinozaki, K. Transcriptional Regulatory Networks in Response to Abiotic Stresses in Arabidopsis and Grasses. Plant Physiol. 2009, 149, 88–95. [Google Scholar] [CrossRef]
- Li, B.; Feng, Y.; Zong, Y.; Zhang, D.; Hao, X.; Li, P. Elevated CO2-induced changes in photosynthesis, antioxidant enzymes and signal transduction enzyme of soybean under drought stress. Plant Physiol. Biochem. 2020, 154, 105–114. [Google Scholar] [CrossRef]
- Fang, Y.; Liao, K.; Du, H.; Xu, Y.; Song, H.; Li, X.; Xiong, L. A stress-responsive NAC transcription factor SNAC3 confers heat and drought tolerance through modulation of reactive oxygen species in rice. J. Exp. Bot. 2015, 66, 6803–6817. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, B.; Li, M.J.; Yin, X.M.; Huang, L.F.; Cui, Y.C.; Wang, M.L.; Xia, X. OsMSR15 encoding a rice C2H2-type zinc finger protein confers enhanced drought tolerance in transgenic Arabidopsis. J. Plant Biol. 2016, 59, 271–281. [Google Scholar] [CrossRef]
- Zhang, A.; Liu, D.; Hua, C.; Yan, A.; Liu, B.; Wu, M.; Liu, Y.; Huang, L.; Ali, I.; Gan, Y. The arabidopsis gene zinc finger protein 3(ZFP3) is involved in salt stress and osmotic stress response. PLoS ONE 2016, 11, e0168367. [Google Scholar] [CrossRef] [PubMed]
- Erpen, L.; Devi, H.S.; Grosser, J.W.; Dutt, M. Potential use of the DREB/ERF, MYB, NAC and WRKY transcription factors to improve abiotic and biotic stress in transgenic plants. Plant Cell Tissue Organ. Cult. 2018, 132, 1–25. [Google Scholar] [CrossRef]
- Greco, D.; Aprile, A.; De Bellis, L.; Luvisi, A. Diseases Caused by Xylella fastidiosa in Prunus Genus: An Overview of the Research on an Increasingly Widespread Pathogen. Front. Plant Sci. 2021, 12, 712452. [Google Scholar] [CrossRef] [PubMed]
- Cao, T.; Connell, J.H.; Wilhelm, M.; Kirkpatrick, B.C. Influence of inoculation date on the colonization of Xylella fastidiosa and the persistence of almond leaf scorch disease among almond cultivars. Plant Dis. 2011, 95, 158–165. [Google Scholar] [CrossRef] [PubMed]
- Sisterson, M.S.; Chen, J.; Viveros, M.A.; Civerolo, E.L.; Ledbetter, C.; Groves, R.L. Effects of almond leaf scorch disease on almond yield: Implications for management. Plant Dis. 2008, 92, 409–414. [Google Scholar] [CrossRef] [PubMed]
- Amanifar, N.; Taghavi, M.; Salehi, M. Xylella fastidiosa from almond in Iran: Overwinter recovery and effects of antibiotics. Phytopathol. Mediterr. 2016, 55, 337–345. [Google Scholar] [CrossRef]
- Moralejo, E.; Gomila, M.; Montesinos, M.; Borràs, D.; Pascual, A.; Nieto, A.; Adrover, F.; Gost, P.A.; Seguí, G.; Busquets, A.; et al. Phylogenetic inference enables reconstruction of a long-overlooked outbreak of almond leaf scorch disease (Xylella fastidiosa) in Europe. Commun. Biol. 2020, 3, 560. [Google Scholar] [CrossRef]
- Marco-Noales, E.; Barbe, S.; Monterde, A.; Navarro-Herrero, I.; Ferrer, A.; Dalmau, V.; Aure, C.M.; Domingo-Calap, M.L.; Landa, B.B.; Rosello, M. Evidence that Xylella fastidiosa is the Causal Agent of Almond Leaf Scorch Disease in Alicante, Mainland Spain (Iberian Peninsula). Plant Dis. 2021, 105, 3349–3352. [Google Scholar] [CrossRef]
- Amanifar, N.; Luvisi, A. Resistance of almond (Prunus dulcis) to Xylella fastidiosa: A comparative study on cultivars. Plant Dis. 2022, 106, 2625–2630. [Google Scholar] [CrossRef]
- Saponari, M.; Boscia, D.; Altamura, G.; Loconsole, G.; Zicca, S.; D’Attoma, G.; Morelli, M.; Palmisano, F.; Saponari, A.; Tavano, D.; et al. Isolation and pathogenicity of Xylella fastidiosa associated to the olive quick decline syndrome in southern Italy. Sci. Rep. 2017, 7, 17723. [Google Scholar] [CrossRef]
- Semeraro, T.; Buccolieri, R.; Vergine, M.; De Bellis, L.; Luvisi, A.; Emmanuel, R.; Marwan, N. Analysis of olive grove destruction by Xylella fastidiosa bacterium on the land surface temperature in Salento detected using satellite images. Forests 2021, 12, 1266. [Google Scholar] [CrossRef]
- Commissione Europea. Regolamento di esecuzione (UE) 2020/1201 della commissione del 14 agosto 2020 relativo alle misure per prevenire l’introduzione e la diffusione nell’Unione della Xylella fastidiosa (Wells et al.). 2020; 17. [Google Scholar]
- Torrecillas, A.; Alarcón, J.J.; Domingo, R.; Planes, J.; Sánchez-Blanco, M.J. Strategies for drought resistance in leaves of two almond cultivars. Plant Sci. 1996, 118, 135–143. [Google Scholar] [CrossRef]
- Abobatta, W.F. Drought adaptive mechanisms of plants—A review. Adv. Agric. Environ. Sci. 2019, 2, 62–65. [Google Scholar] [CrossRef]
- Alzahrani, Y.; Kuşvuran, A.; Alharby, H.F.; Kuşvuran, S.; Rady, M.M. The defensive role of silicon in wheat against stress conditions induced by drought, salinity or cadmium. Ecotoxicol. Environ. Saf. 2018, 154, 187–196. [Google Scholar] [CrossRef] [PubMed]
- Mahmood, T.; Abdullah, M.; Ahmar, S.; Yasir, M.; Iqbal, M.S.; Yasir, M.; Rehman, S.U.; Ahmed, S.; Rana, R.M.; Ghafoor, A.; et al. Incredible role of osmotic adjustment in grain yield sustainability under water scarcity conditions in wheat (Triticum aestivum L.). Plants 2020, 9, 1208. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; He, M.; Zhu, Z.; Li, S.; Xu, Y.; Zhang, C.; Singer, D.S.; Wang, Y. Identification of the dehydrin gene family from grapevine species and analysis of their responsiveness to various forms of abiotic and biotic stress. BMC Plant Biol. 2012, 12, 140. [Google Scholar] [CrossRef] [PubMed]
- Turco, E.; Close, T.J.; Fenton, R.D.; Ragazzi, A. Synthesis of dehydrin-like proteins in Quercus ilex L. and Quercus cerris L. seedlings subjected to water stress and infection with Phytophthora cinnamomi. Physiol. Mol. Plant Pathol. 2004, 65, 137–144. [Google Scholar] [CrossRef]
- Kaur, J.; Fellers, J.; Adholeya, A.; Velivelli, S.L.S.; El-Mounadi, K.; Nersesian, N.; Clemente, T.; Shah, D. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat. Transgenic Res. 2017, 26, 37–49. [Google Scholar] [CrossRef] [PubMed]
- Mackintosh, C.A.; Lewis, J.; Radmer, L.E.; Shin, S.; Heinen, S.J.; Smith, L.A.; Wyckoff, M.N.; Dill-Macky, R.; Evans, C.K.; Kravchenko, S.; et al. Overexpression of defense response genes in transgenic wheat enhances resistance to Fusarium head blight. Plant Cell Rep. 2007, 26, 479–488. [Google Scholar] [CrossRef]
- Ali, S.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Chandrashekar, N.; Yadav, P.; Rawat, S.; Sultana, M.; Grover, A. Isolation and characterization of systemic acquired resistance marker gene PR1 and its promoter from Brassica juncea. 3 Biotech. 2018, 8, 10. [Google Scholar] [CrossRef] [PubMed]
- Gupta, P.; Ravi, I.; Sharma, V. Induction of β-1,3-glucanase and chitinase activity in the defense response of Eruca sativa plants against the fungal pathogen Alternaria brassicicola. J. Plant Interact. 2013, 8, 155–161. [Google Scholar] [CrossRef]
- Jiang, L.; Wu, J.; Fan, S.; Li, W.; Dong, L.; Cheng, Q.; Xu, P.; Zhang, S. Isolation and characterization of a novel pathogenesis-related protein gene (GmPRP) with induced expression in soybean (Glycine max) during infection with Phytophthora sojae. PLoS ONE 2015, 10, e0129932. [Google Scholar] [CrossRef] [PubMed]
- Sinclair, B.J.; Ferguson, L.V.; Salehipour-Shirazi, G.; Macmillan, H.A. Cross-tolerance and cross-talk in the cold: Relating low temperatures to desiccation and immune stress in insects. Integr. Comp. Biol. 2013, 53, 545–556. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.A.; Li, M.Z.; Wang, S.M.; Yin, H.J. Revisiting the role of plant transcription factors in the battle against abiotic stress. Int. J. Mol. Sci. 2018, 19, 1634. [Google Scholar] [CrossRef] [PubMed]
- Grant, J.J.; Chini, A.; Basu, D.; Loake, G.J. Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADR1, conveys resistance to virulent pathogens. Mol. Plant-Microbe Interact. 2003, 16, 669–680. [Google Scholar] [CrossRef] [PubMed]
- Chini, A.; Grant, J.J.; Seki, M.; Shinozaki, K.; Loake, G.J. Drought tolerance established by enhanced expression of the CC-NBS-LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1. Plant J. 2004, 38, 810–822. [Google Scholar] [CrossRef] [PubMed]
- Zaini, P.A.; Nascimento, R.; Gouran, H.; Cantu, D.; Chakraborty, S.; Phu, M.; Goulart, L.R.; Dandekar, A.M. Molecular profiling of pierce’s disease outlines the response circuitry of vitis vinifera to xylella fastidiosa infection. Front. Plant Sci. 2018, 9, 771. [Google Scholar] [CrossRef]
- Hrmova, M.; Hussain, S.S. Plant transcription factors involved in drought and associated stresses. Int. J. Mol. Sci. 2021, 22, 5662. [Google Scholar] [CrossRef]
- Puranik, S.; Sahu, P.P.; Srivastava, P.S.; Prasad, M. NAC proteins: Regulation and role in stress tolerance. Trends Plant Sci. 2012, 17, 369–381. [Google Scholar] [CrossRef]
- Bian, Z.; Gao, H.; Wang, C. NAC transcription factors as positive or negative regulators during ongoing battle between pathogens and our food crops. Int. J. Mol. Sci. 2021, 22, 81. [Google Scholar] [CrossRef]
- Moll, L.; Baró, A.; Montesinos, L.; Badosa, E.; Bonaterra, A.; Montesinos, E. Induction of Defense Responses and Protection of Almond Plants Against Xylella fastidiosa by Endotherapy with a Bifunctional Peptide. Phytopathology 2022, 112, 1907–1916. [Google Scholar] [CrossRef]
- Bai, Y.; Sunarti, S.; Kissoudis, C.; Visser, R.G.F.; van der Linden, C.G. The role of tomato WRKY genes in plant responses to combined abiotic and biotic stresses. Front. Plant Sci. 2018, 9, 801. [Google Scholar] [CrossRef]
- Lee, H.; Cha, J.; Choi, C.; Choi, N.; Ji, H.S.; Park, S.R.; Lee, S.; Hwang, D.J. Rice wrky11 plays a role in pathogen defense and drought tolerance. Rice 2018, 11, 5. [Google Scholar] [CrossRef] [PubMed]
- Noman, A.; Aqeel, M.; Khalid, N.; Islam, W.; Sanaullah, T.; Anwar, M.; Khan, S.; Ye, W.; Lou, Y. Zinc finger protein transcription factors: Integrated line of action for plant antimicrobial activity. Microb. Pathog. 2019, 132, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Moulick, D.; Bhutia, K.L.; Sarkar, S.; Roy, A.; Mishra, U.N.; Pramanick, B.; Maitra, S.; Shankar, T.; Hazra, S.; Skalicky, M.; et al. The intertwining of Zn-finger motifs and abiotic stress tolerance in plants: Current status and future prospects. Front. Plant Sci. 2023, 13, 1083960. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Sun, S.J.; Xu, D.Q.; Yang, X.; Bao, Y.M.; Wang, Z.F.; Tang, H.J.; Zhang, H. Increased tolerance of rice to cold, drought and oxidative stresses mediated by the overexpression of a gene that encodes the zinc finger protein ZFP245. Biochem. Biophys. Res. Commun. 2009, 389, 556–561. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.K.; Rai, A.K.; Kanwar, S.S.; Sharma, T.R. Comparative analysis of zinc finger proteins involved in plant disease resistance. PLoS ONE 2012, 7, e42578. [Google Scholar] [CrossRef] [PubMed]
- European Commission. Commission Implementing Decision (EU) 2015/789 of 18 May 2015 as Regards Measures to Prevent the Introduction into and the Spread within the Union of Xylella fastidiosa (Wells et al.). Official Journal of the European Union. 2015. L 125 February 2014. pp. 36–53. Available online: http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=uriserv:OJ.L_.2015.125.01.0036.01.ENG (accessed on 22 January 2024).
- Olmos, A.; Bertolini, E.; Gil, M.; Cambra, M. Real-time assay for quantitative detection of non-persistently transmitted Plum pox virus RNA targets in single aphids. J. Virol. Methods 2005, 128, 151–155. [Google Scholar] [CrossRef] [PubMed]
- Luvisi, A.; Aprile, A.; Sabella, E.; Vergine, M.; Nutricati, E.; Miceli, A.; Negro, C.; De Bellis, L. Xylella fastidiosa subsp. pauca (CoDiRO strain) infection in four olive (Olea europaea L.) cultivars: Profile of phenolic compounds in leaves and progression of leaf scorch symptoms. Phytopathol. Mediterr. 2017, 56, 259–273. [Google Scholar]
- Harper, S.J.; Ward, L.I.; Clover, G.R.G. Development of LAMP and Real-Time PCR Methods for the Rapid Detection of Xylella fastidiosa for Quarantine and Field Applications. Phytopathology 2010, 100, 1282–1288. [Google Scholar] [CrossRef]
- D’attoma, G.; Morelli, M.; Saldarelli, P.; Saponari, M.; Giampetruzzi, A.; Boscia, D.; Savino, V.N.; De La Fuente, L.; Cobine, P.A. Ionomic differences between susceptible and resistant olive cultivars infected by Xylella fastidiosa in the outbreak area of salento, Italy. Pathogens 2019, 8, 272. [Google Scholar] [CrossRef] [PubMed]
- Bates, L.S.; Waldre, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil. 1973, 39, 205. [Google Scholar] [CrossRef]
- Gambino, G.; Perrone, I.; Gribaudo, I. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 2008, 19, 520–525. [Google Scholar] [CrossRef]
- Leida, C.; Conesa, A.; Llácer, G.; Badenes, M.L.; Ríos, G. Histone modifications and expression of DAM6 gene in peach are modulated during bud dormancy release in a cultivar-dependent manner. New Phytol. 2012, 193, 67–80. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Zhang, D.; Zeng, B.; Liu, X.; Yang, J.; Gao, W.; Ma, X. Characterization of the WRKY gene family reveals its contribution to the adaptability of almond (Prunus dulcis). Peer J. 2022, 10, e13491. [Google Scholar] [CrossRef] [PubMed]
- Rubio, M.; Martinez-Garcia, P.J.; Nikbakht-Dehkordi, A.; Prudencio, A.S.; Gómez, E.; Rodamilans, B.; Dicenta, F.; García, J.A.; Martínez-Gómez, P. Gene Expression Analysis of Induced Plum pox virus (Sharka) Resistance in Peach (Prunus persica) by Almond (P. dulcis) Grafting. Int. J. Mol. Sci. 2021, 22, 3585. [Google Scholar] [CrossRef] [PubMed]
- Zhuo, X.; Zheng, T.; Zhang, Z.; Zhang, Y.; Jiang, L.; Ahmad, S.; Sun, L.; Wang, J.; Cheng, T.; Zhang, Q. Genome-Wide Analysis of the NAC Transcription Factor Gene Family Reveals Differential Expression Patterns and Cold-Stress Responses in the Woody Plant Prunus mume. Genes 2018, 9, 494. [Google Scholar] [CrossRef]
- Bielsa, B.; Leida, C.; Rubio-Cabetas, M.J. Physiological characterization of drought stress response and expression of two transcription factors and two LEA genes in three Prunus genotypes. Sci. Hortic. 2016, 213, 260–269. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Quackenbush, J. Microarray data normalization and transformation. Nat. Genet. 2002, 32, 496–501. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Forward (5′ to 3′ Sequence) | Reverse (5′ to 3′ Sequence) | Primer Reference |
---|---|---|---|
Dehydrin | GTACTCTCATGACACCCACAAAACTAC | CCCGGCCCCACCGTAAGCTCCAGTT | [69] |
LEA protein | GCAAAAGGTAGGGCAAACAG | TGGCTTTGCTTCTTTGGTCT | [69] |
Zn Finger | ACACAGGCTTCCTCTACTCCATCTTT | GAACCCTCATTCCGAGACATTTATCAG | [69] |
WRKY | GCCGAGAAATCACCGACTTC | GTTGTCTGAGGCTTGGGTTG | [70] |
PR | GGAGATGCCTTTGATGTGGGA | AGCTTGAACTCGCCTTCTGG | [71] |
NAC | GATAACCCAACTACCACTACCAC | GACAACTCCCAGATACCACG | [72] |
b-ZIP | GGGTTGAAACACCCAAAAGA | GCGATTCGACAACATCCTCT | [73] |
Actin | CAGATCATGTTTGAGACCTTCAATGT | CATCACCAGAGTCCAGCACAAT | [73] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Pascali, M.; Greco, D.; Vergine, M.; Carluccio, G.; De Bellis, L.; Luvisi, A. A Physiological and Molecular Focus on the Resistance of “Filippo Ceo” Almond Tree to Xylella fastidiosa. Plants 2024, 13, 576. https://doi.org/10.3390/plants13050576
De Pascali M, Greco D, Vergine M, Carluccio G, De Bellis L, Luvisi A. A Physiological and Molecular Focus on the Resistance of “Filippo Ceo” Almond Tree to Xylella fastidiosa. Plants. 2024; 13(5):576. https://doi.org/10.3390/plants13050576
Chicago/Turabian StyleDe Pascali, Mariarosaria, Davide Greco, Marzia Vergine, Giambattista Carluccio, Luigi De Bellis, and Andrea Luvisi. 2024. "A Physiological and Molecular Focus on the Resistance of “Filippo Ceo” Almond Tree to Xylella fastidiosa" Plants 13, no. 5: 576. https://doi.org/10.3390/plants13050576