Assessment of Self-Activation and Inhibition of Wheat Coiled-Coil Domain Containing NLR Immune Receptor Yr10CG
Abstract
:1. Introduction
2. Results
2.1. Yr10CG Is a CC-Type NLR Immune Receptor
2.2. Neither the Overexpression of Yr10CG nor Its CC Domain Triggers Cell Death
2.3. Autoactive Mutant Yr10CG-D502G Induces Cell Death
2.4. CC Domain of Yr10CG Does Not Involve Recognizing the Effector, but for Activating the Downstream Immunity Mechanism
3. Discussion
4. Materials and Methods
4.1. Plasmid Construction
4.2. Agrobacteria-Mediated Transient Expression in Nicotiana benthamiana
4.3. Hypersensitive Response Assay
4.4. Bioinformatics Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef]
- Yu, X.; Feng, B.; He, P.; Shan, L. From chaos to harmony: Responses and signaling upon microbial pattern recognition. Annu. Rev. Phytopathol. 2017, 55, 109–137. [Google Scholar] [CrossRef] [PubMed]
- DeFalco, T.A.; Zipfel, C. Molecular mechanisms of early plant pattern-triggered immune signaling. Mol. Cell 2021, 81, 3449–3467. [Google Scholar] [CrossRef] [PubMed]
- Heath, M.C. Hypersensitive response-related death. Plant Mol. Biol. 2000, 44, 321–334. [Google Scholar] [CrossRef] [PubMed]
- Caplan, J.; Padmanabhan, M.; Dinesh-Kumar, S.P. Plant NB-LRR immune receptors: From recognition to transcriptional reprogramming. Cell Host Microbe 2008, 3, 126–135. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.; Tsuda, K.; Parker, J.E. Effector-triggered immunity: From pathogen perception to robust defense. Annu. Rev. Plant Biol. 2015, 66, 487–511. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.M.; Zhang, Y. Plant immunity: Danger perception and signaling. Cell 2020, 181, 978–989. [Google Scholar] [CrossRef]
- Sánchez-Martín, J.; Keller, B. NLR immune receptors and diverse types of non-NLR proteins control race-specific resistance in Triticeae. Curr. Opin. Plant Biol. 2021, 62, 102053. [Google Scholar] [CrossRef] [PubMed]
- Shao, Z.Q.; Xue, J.Y.; Wu, P.; Zhang, Y.M.; Wu, Y.; Hang, Y.Y.; Wang, B.; Chen, J.Q. Large-scale analyses of angiosperm nucleotide-binding site-leucine-rich repeat genes reveal three anciently diverged classes with distinct evolutionary patterns. Plant Physiol. 2016, 170, 2095–2109. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Wan, L. Molecular insights into the biochemical functions and signalling mechanisms of plant NLRs. Mol. Plant Pathol. 2022, 23, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Förderer, A.; Kourelis, J. NLR immune receptors: Structure and function in plant disease resistance. Biochem. Soc. Trans. 2023, 51, 1473–1483. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.F.; Ji, J.; El-Kasmi, F.; Dangl, J.L.; Johal, G.; Balint-Kurti, P.J. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity. PLoS Pathog. 2015, 11, e1004674. [Google Scholar]
- Casey, L.W.; Lavrencic, P.; Bentham, A.R.; Cesari, S.; Ericsson, D.J.; Croll, T.; Turk, D.; Anderson, P.A.; Mark, A.E.; Dodds, P.N.; et al. The CC domain structure from the wheat stem rust resistance protein Sr33 challenges paradigms for dimerization in plant NLR proteins. Proc. Natl. Acad. Sci. USA 2016, 113, 12856–12861. [Google Scholar] [CrossRef] [PubMed]
- Cesari, S.; Moore, J.; Chen, C.; Webb, D.; Periyannan, S.; Mago, R.; Bernoux, M.; Lagudah, E.S.; Dodds, P.N. Cytosolic activation of cell death and stem rust resistance by cereal MLA-family CC-NLR proteins. Proc. Natl. Acad. Sci. USA 2016, 113, 10204–10209. [Google Scholar] [CrossRef]
- Baudin, M.; Hassan, J.A.; Schreiber, K.J.; Lewis, J.D. Analysis of the ZAR1 immune complex reveals determinants for immunity and molecular interactions. Plant Physiol. 2017, 174, 2038–2053. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.B.; Lee, H.Y.; Choi, E.H.; Park, E.; Kim, J.H.; Moon, K.B.; Kim, H.S.; Choi, D. The coiled-coil and leucine-rich repeat domain of the potyvirus resistance protein Pvr4 has a distinct role in signaling and pathogen recognition. Mol. Plant Microbe Interact. 2018, 31, 906–913. [Google Scholar] [CrossRef]
- Ade, J.; DeYoung, B.J.; Golstein, C.; Innes, R.W. Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease. Proc. Natl. Acad. Sci. USA 2007, 104, 2531–2536. [Google Scholar] [CrossRef] [PubMed]
- Collier, S.M.; Hamel, L.P.; Moffett, P. Cell death mediated by the N-terminal domains of a unique and highly conserved class of NB-LRR protein. Mol. Plant Microbe Interact. 2011, 24, 918–931. [Google Scholar] [CrossRef]
- El Kasmi, F.; Chung, E.H.; Anderson, R.G.; Li, J.; Wan, L.; Eitas, T.K.; Gao, Z.; Dangl, J.L. Signaling from the plasma-membrane localized plant immune receptor RPM1 requires self-association of the full-length protein. Proc. Natl. Acad. Sci. USA 2017, 114, E7385–E7394. [Google Scholar] [CrossRef] [PubMed]
- Zou, S.; Wang, H.; Li, Y.; Kong, Z.; Tang, D. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol. 2018, 218, 298–309. [Google Scholar] [CrossRef] [PubMed]
- Bolus, S.; Akhunov, E.; Coaker, G.; Dubcovsky, J. Dissection of cell death induction by wheat stem rust resistance protein Sr35 and its matching effector AvrSr35. Mol. Plant Microbe Interact. 2020, 33, 308–319. [Google Scholar] [CrossRef]
- Takken, F.L.; Albrecht, M.; Tameling, W.I. Resistance proteins: Molecular switches of plant defence. Curr. Opin. Plant Biol. 2006, 9, 383–390. [Google Scholar] [CrossRef]
- Tameling, W.I.; Vossen, J.H.; Albrecht, M.; Lengauer, T.; Berden, J.A.; Haring, M.A.; Cornelissen, B.J.; Takken, F.L. Mutations in the NB-ARC domain of I-2 that impair ATP hydrolysis cause autoactivation. Plant Physiol. 2006, 140, 1233–1245. [Google Scholar] [CrossRef] [PubMed]
- Lukasik, E.; Takken, F.L. STANDing strong, resistance proteins instigators of plant defence. Curr. Opin. Plant Biol. 2009, 12, 427–436. [Google Scholar] [CrossRef] [PubMed]
- Sukarta, O.C.A.; Slootweg, E.J.; Goverse, A. Structure-informed insights for NLR functioning in plant immunity. Semin. Cell Dev. Biol. 2016, 56, 134–149. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wang, J.; Hu, M.; Wu, S.; Qi, J.; Wang, G.; Han, Z.; Qi, Y.; Gao, N.; Wang, H.W.; et al. Ligand-triggered allosteric ADP release primes a plant NLR complex. Science 2019, 364, eaav5868. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Hu, M.; Wang, J.; Qi, J.; Han, Z.; Wang, G.; Qi, Y.; Wang, H.W.; Zhou, J.M.; Chai, J. Reconstitution and structure of a plant NLR resistosome conferring immunity. Science 2019, 364, eaav5870. [Google Scholar] [CrossRef] [PubMed]
- Williams, S.J.; Sornaraj, P.; deCourcy-Ireland, E.; Menz, R.I.; Kobe, B.; Ellis, J.G.; Dodds, P.N.; Anderson, P.A. An autoactive mutant of the M flax rust resistance protein has a preference for binding ATP, whereas wild-type M protein binds ADP. Mol. Plant Microbe Interact. 2011, 24, 897–906. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Chen, T.; Han, M.; Qian, L.; Li, J.; Wu, M.; Han, T.; Cao, J.; Nagalakshmi, U.; Rathjen, J.P.; et al. Plant NLR immune receptor Tm-22 activation requires NB-ARC domain-mediated self-association of CC domain. PLoS Pathog. 2020, 16, e1008475. [Google Scholar] [CrossRef]
- Xiong, Y.; Han, Z.; Chai, J. Resistosome and inflammasome: Platforms mediating innate immunity. Curr. Opin. Plant Biol. 2020, 56, 47–55. [Google Scholar] [CrossRef]
- Hu, Z.; Chai, J. Assembly and architecture of NLR resistosomes and inflammasomes. Annu. Rev. Biophys. 2023, 52, 207–228. [Google Scholar] [CrossRef] [PubMed]
- Bi, G.; Su, M.; Li, N.; Liang, Y.; Dang, S.; Xu, J.; Hu, M.; Wang, J.; Zou, M.; Deng, Y.; et al. The ZAR1 resistosome is a calcium-permeable channel triggering plant immune signaling. Cell 2021, 184, 3528–3541. [Google Scholar] [CrossRef] [PubMed]
- Tameling, W.I.; Elzinga, S.D.; Darmin, P.S.; Vossen, J.H.; Takken, F.L.; Haring, M.A.; Cornelissen, B.J. The tomato R gene products I-2 and Mi-1 are functional ATP binding proteins with ATPase activity. Plant Cell 2002, 14, 2929–2939. [Google Scholar] [CrossRef]
- Bendahmane, A.; Farnham, G.; Moffett, P.; Baulcombe, D.C. Constitutive gain-of-function mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. Plant J. 2002, 32, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Howles, P.; Lawrence, G.; Finnegan, J.; McFadden, H.; Ayliffe, M.; Dodds, P.; Ellis, J. Autoactive alleles of the flax L6 rust resistance gene induce non-race-specific rust resistance associated with the hypersensitive response. Mol. Plant Microbe Interact. 2005, 18, 570–582. [Google Scholar] [CrossRef]
- van Ooijen, G.; Mayr, G.; Kasiem, M.M.; Albrecht, M.; Cornelissen, B.J.; Takken, F.L. Structure-function analysis of the NB-ARC domain of plant disease resistance proteins. J. Exp. Bot. 2008, 59, 1383–1397. [Google Scholar] [CrossRef]
- Bai, S.; Liu, J.; Chang, C.; Zhang, L.; Maekawa, T.; Wang, Q.; Xiao, W.; Liu, Y.; Chai, J.; Takken, F.L.; et al. Structure-function analysis of barley NLR immune receptor MLA10 reveals its cell compartment specific activity in cell death and disease resistance. PLoS Pathog. 2012, 8, e1002752. [Google Scholar] [CrossRef]
- Roberts, M.; Tang, S.; Stallmann, A.; Dangl, J.L.; Bonardi, V. Genetic requirements for signaling from an autoactive plant NB-LRR intracellular innate immune receptor. PLoS Genet. 2013, 9, e1003465. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; An, C.; Lawson, A.W.; Cao, Y.; Sun, Y.; Tan, E.Y.J.; Pan, J.; Jirschitzka, J.; Kümmel, F.; Mukhi, N.; et al. Oligomerization-mediated autoinhibition and cofactor binding of a plant NLR. Nature 2024, 632, 869–876. [Google Scholar] [CrossRef]
- Michael Weaver, L.; Swiderski, M.R.; Li, Y.; Jones, J.D. The Arabidopsis thaliana TIR-NB-LRR R-protein, RPP1A; protein localization and constitutive activation of defence by truncated alleles in tobacco and Arabidopsis. Plant J. 2006, 47, 829–840. [Google Scholar] [CrossRef] [PubMed]
- Qi, D.; DeYoung, B.J.; Innes, R.W. Structure-function analysis of the coiled-coil and leucine-rich repeat domains of the RPS5 disease resistance protein. Plant Physiol. 2012, 158, 1819–1832. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.; McAdams, S.A.; Bryan, G.T.; Hershey, H.P.; Valent, B. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 2000, 19, 4004–4014. [Google Scholar] [CrossRef]
- Ma, S.; Lapin, D.; Liu, L.; Sun, Y.; Song, W.; Zhang, X.; Logemann, E.; Yu, D.; Wang, J.; Jirschitzka, J.; et al. Direct pathogen-induced assembly of an NLR immune receptor complex to form a holoenzyme. Science 2020, 370, eabe3069. [Google Scholar] [CrossRef] [PubMed]
- Martin, R.; Qi, T.; Zhang, H.; Liu, F.; King, M.; Toth, C.; Nogales, E.; Staskawicz, B.J. Structure of the activated ROQ1 resistosome directly recognizing the pathogen effector XopQ. Science 2020, 370, eabd9993. [Google Scholar] [CrossRef] [PubMed]
- Förderer, A.; Li, E.; Lawson, A.W.; Deng, Y.N.; Sun, Y.; Logemann, E.; Zhang, X.; Wen, J.; Han, Z.; Chang, J.; et al. A wheat resistosome defines common principles of immune receptor channels. Nature 2022, 610, 532–539. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.B.; Liu, M.X.; Chen, T.T.; Ma, X.; Li, Z.K.; Zheng, Z.; Zheng, S.R.; Chen, L.; Li, Y.Z.; Tang, L.R.; et al. Pathogen effector AvrSr35 triggers Sr35 resistosome assembly via a direct recognition mechanism. Sci. Adv. 2022, 8, eabq5108. [Google Scholar] [CrossRef] [PubMed]
- Bi, G.; Zhou, J.M. Regulation of cell death and signaling by pore-forming resistosomes. Annu. Rev. Phytopathol. 2021, 59, 239–263. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Frick, M.; Huel, R.; Nykiforuk, C.L.; Wang, X.; Gaudet, D.A.; Eudes, F.; Conner, R.L.; Kuzyk, A.; Chen, Q.; et al. The stripe rust resistance gene Yr10 encodes an evolutionary-conserved and unique CC-NBS-LRR sequence in wheat. Mol. Plant 2014, 7, 1740–1755. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.; Wu, J.; Yan, B.; Hao, Q.; Zhang, C.; Lyu, B.; Ni, F.; Caplan, A.; Wu, J.; Fu, D. Remapping of the stripe rust resistance gene Yr10 in common wheat. Theor. Appl. Genet. 2018, 131, 1253–1262. [Google Scholar] [CrossRef]
- Ni, F.; Zheng, Y.; Liu, X.; Yu, Y.; Zhang, G.; Epstein, L.; Mao, X.; Wu, J.; Yuan, C.; Lv, B.; et al. Sequencing trait-associated mutations to clone wheat rust-resistance gene YrNAM. Nat. Commu. 2023, 14, 4353. [Google Scholar] [CrossRef] [PubMed]
- Dibley, K.; Jost, M.; McIntosh, R.; Lagudah, E.; Zhang, P. The wheat stripe rust resistance gene YrNAM is Yr10. Nat. Commun. 2024, 15, 3291. [Google Scholar] [CrossRef] [PubMed]
- Duggan, C.; Moratto, E.; Savage, Z.; Hamilton, E.; Adachi, H.; Wu, C.H.; Leary, A.Y.; Tumtas, Y.; Rothery, S.M.; Maqbool, A.; et al. Dynamic localization of a helper NLR at the plant-pathogen interface underpins pathogen recognition. Proc. Natl. Acad. Sci. USA 2021, 118, e2104997118. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Wu, X.; Sun, K.; Gao, Z. Structure and function analysis of a CC-NBS-LRR protein AT1G12290. Biochem. Biophys. Res. Commun. 2021, 534, 206–211. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Jia, A.; Ma, S.; Sun, Y.; Chang, X.; Han, Z.; Chai, J. NLR signaling in plants: From resistosomes to second messengers. Trends Biochem. Sci. 2023, 48, 776–787. [Google Scholar] [CrossRef]
- Madhuprakash, J.; Toghani, A.; Contreras, M.P.; Posbeyikian, A.; Richardson, J.; Kourelis, J.; Bozkurt, T.O.; Webster, M.W.; Kamoun, S. A disease resistance protein triggers oligomerization of its NLR helper into a hexameric resistosome to mediate innate immunity. Sci. Adv. 2024, 10, eadr2594. [Google Scholar] [CrossRef] [PubMed]
- Maruta, N.; Burdett, H.; Lim, B.Y.J.; Hu, X.; Desa, S.; Manik, M.K.; Kobe, B. Structural basis of NLR activation and innate immune signalling in plants. Immunogenetics 2022, 74, 5–26. [Google Scholar] [CrossRef] [PubMed]
- Tamborski, J.; Seong, K.; Liu, F.; Staskawicz, B.J.; Krasileva, K.V. Altering specificity and autoactivity of plant immune receptors Sr33 and Sr50 via a rational engineering approach. Mol. Plant Microbe Interact. 2023, 36, 434–446. [Google Scholar] [CrossRef]
- Rim, E.Y.; Garrett, O.D.; Howard, A.J.; Shim, Y.; Li, Y.; Dyke, J.E.V.; Packer, R.C.; Ho, N.; Jain, R.S.; Stewart, V.J.; et al. Directed evolution of a plant immune receptor for broad spectrum recognition of pathogen effectors. bioRxiv 2024. [Google Scholar] [CrossRef]
- Rioja, C.; Van Wees, S.C.; Charlton, K.A.; Pieterse, C.M.; Lorenzo, O.; García-Sánchez, S. Wide screening of phage-displayed libraries identifies immune targets in planta. PLoS ONE 2013, 8, e54654. [Google Scholar] [CrossRef] [PubMed]
- Landry, D.; Mila, I.; Sabbagh, C.R.R.; Zaffuto, M.; Pouzet, C.; Tremousaygue, D.; Dabos, P.; Deslandes, L.; Peeters, N. An NLR integrated domain toolkit to identify plant pathogen effector targets. Plant J. 2023, 115, 1443–1457. [Google Scholar] [CrossRef] [PubMed]
- Shao, W.; Shi, G.; Chu, H.; Du, W.; Zhou, Z.; Wuriyanghan, H. Development of an NLR-ID toolkit and identification of novel disease-resistance genes in soybean. Plants 2024, 13, 668. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Upadhyaya, N.M.; Ortiz, D.; Sperschneider, J.; Li, F.; Bouton, C.; Breen, S.; Dong, C.; Xu, B.; Zhang, X.; et al. Loss of AvrSr50 by somatic exchange in stem rust leads to virulence for Sr50 resistance in wheat. Science 2017, 358, 1607–1610. [Google Scholar] [CrossRef] [PubMed]
- Heckman, K.L.; Pease, L.R. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat. Protoc. 2007, 2, 924–932. [Google Scholar] [CrossRef]
- Sparkes, I.A.; Runions, J.; Kearns, A.; Hawes, C. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat. Protoc. 2006, 1, 2019–2025. [Google Scholar] [CrossRef] [PubMed]
- Kanawati, B.; Bertic, M.; Moritz, F.; Habermann, F.; Zimmer, I.; Mackey, D.; Schmitt-Kopplin, P.; Schnitzler, J.P.; Durner, J.; Gaupels, F. Blue-green fluorescence during hypersensitive cell death arises from phenylpropanoid deydrodimers. Plant Direct 2023, 7, e531. [Google Scholar] [CrossRef]
- Daudi, A.; O’Brien, J.A. Detection of hydrogen peroxide by DAB staining in Arabidopsis leaves. Bio Protoc. 2012, 2, e263. [Google Scholar] [CrossRef]
- Madeira, F.; Madhusoodanan, N.; Lee, J.; Eusebi, A.; Niewielska, A.; Tivey, A.R.N.; Lopez, R.; Butcher, S. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 2024, 52, W521–W525. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v6: Recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024, 52, W78–W82. [Google Scholar] [CrossRef] [PubMed]
- Robert, X.; Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef]
- Martin, E.C.; Spiridon, L.; Goverse, A.; Petrescu, A.J. NLRexpress-A bundle of machine learning motif predictors-Reveals motif stability underlying plant Nod-like receptors diversity. Front. Plant Sci. 2022, 13, 975888. [Google Scholar] [CrossRef]
- Mirdita, M.; Schütze, K.; Moriwaki, Y.; Heo, L.; Ovchinnikov, S.; Steinegger, M. ColabFold: Making protein folding accessible to all. Nat. Methods 2022, 19, 679–682. [Google Scholar] [CrossRef]
- Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef] [PubMed]
- DeLano, W.L. The PyMOL Molecular Graphics System; Delano Scientific: San Carlos, CA, USA, 2002. [Google Scholar]
Primers | Sequence (5′-3′) | |
---|---|---|
PCR product for TOPO cloning reaction | CACC-Yr10CG/CCYr10CG F | caccatggaggtcgtgaccggg |
Yr10CG R | gcgtggagttaccttcaccgt | |
CCYr10CG R | gtcactgacctccttgatgcggc | |
CACC-Sr50 F | caccatgaatattgtcacgggggccatg | |
Sr50 R | gttctcctcacacaaatcatcatcacgag | |
CACC-AvrSr50ΔSP F | caccatggctaggagccttgtcaaaattg | |
AvrSr50ΔSP R | cctgtgttggcgccttgc | |
Site-directed mutagenesis on pENTR TOPO-Yr10CG | Yr10CG-L11E F | atgagcacggaactgcccttg |
Yr10CG-L11E R | caagggcagttccgtgctcat | |
Yr10CG-E44K F | gagagcatgaaggctgccctcatcaagatc | |
Yr10CG-E44K R | agggcagccttcatgctctccagctctg | |
Yr10CG-F99E F | gccacacagcgaaatgggtttcatccacaa | |
Yr10CG-F99E R | tgaaacccatttcgctgtgtggcttcttttgt | |
Yr10CG-K207R F | gcttagggagaacaactcttgctaacgtggta | |
Yr10CG-K207R R | caagagttgttctccctaagcctccaaagcc | |
Yr10CG-D502G F | gtacacggaatggtgcttgaccttatcac | |
Yr10CG-D502G R | gcaccattccgtgtacacggacagagctc | |
Yr10CG-V500G/H501A/D502G F | tctgtccgtggagctggaatggtgcttgacct | |
Yr10CG-V500G/H501A/D502G R | agcaccattccagctccacggacagagctcg |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, N.; Jiang, W.; Xiang, Z.; Asghar, R.; Akkaya, M.S. Assessment of Self-Activation and Inhibition of Wheat Coiled-Coil Domain Containing NLR Immune Receptor Yr10CG. Plants 2025, 14, 278. https://doi.org/10.3390/plants14020278
Wu N, Jiang W, Xiang Z, Asghar R, Akkaya MS. Assessment of Self-Activation and Inhibition of Wheat Coiled-Coil Domain Containing NLR Immune Receptor Yr10CG. Plants. 2025; 14(2):278. https://doi.org/10.3390/plants14020278
Chicago/Turabian StyleWu, Nan, Wanqing Jiang, Zhaoxia Xiang, Raheel Asghar, and Mahinur S. Akkaya. 2025. "Assessment of Self-Activation and Inhibition of Wheat Coiled-Coil Domain Containing NLR Immune Receptor Yr10CG" Plants 14, no. 2: 278. https://doi.org/10.3390/plants14020278
APA StyleWu, N., Jiang, W., Xiang, Z., Asghar, R., & Akkaya, M. S. (2025). Assessment of Self-Activation and Inhibition of Wheat Coiled-Coil Domain Containing NLR Immune Receptor Yr10CG. Plants, 14(2), 278. https://doi.org/10.3390/plants14020278