Next Article in Journal
Natural Variations and Dynamic Changes of Nitrogen Indices throughout Growing Seasons for Twenty Tea Plant (Camellia sinensis) Varieties
Next Article in Special Issue
Linkage Map Development by EST-SSR Markers and QTL Analysis for Inflorescence and Leaf Traits in Chrysanthemum (Chrysanthemum morifolium Ramat.)
Previous Article in Journal
Antibacterial, Mutagenic Properties and Chemical Characterisation of Sugar Bush (Protea caffra Meisn.): A South African Native Shrub Species
Previous Article in Special Issue
The Influence of a Seedling Recruitment Strategy and a Clonal Architecture on a Spatial Genetic Structure of a Salvia brachyodon (Lamiaceae) Population
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 9
Issue 10
10.3390/plants9101332
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chloroplast Genome Analysis of Two Medicinal Coelogyne spp. (Orchidaceae) Shed Light on the Genetic Information, Comparative Genomics, and Species Identification

by
Kai Jiang
1,2,3,
Li-Yuan Miao
1,4,
Zheng-Wei Wang
1,
Zi-Yi Ni
1,
Chao Hu
1,2,
Xin-Hua Zeng
1,2 and
Wei-Chang Huang
1,2,4,5,*
1
Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences, Chenshan Botanical Garden, Shanghai 201602, China
2
Shanghai Key Laboratory of Plant Functional Genomics and Resources, Shanghai Chenshan Botanical Garden, Shanghai 201602, China
3
School of Ecological and Environmental Sciences, Shanghai Key Lab of Urban Ecological Processes and Eco-Restoration, East China Normal University, Shanghai 200241, China
4
College of Life, Shanghai Normal University, Shanghai 200234, China
5
College of Landscape Architecture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
Plants 2020, 9(10), 1332; https://doi.org/10.3390/plants9101332
Submission received: 8 September 2020 / Revised: 1 October 2020 / Accepted: 5 October 2020 / Published: 9 October 2020
(This article belongs to the Special Issue Applications of DNA Markers in Plant Science)
Browse Figures
Versions Notes

Abstract

:
Although the medicinal properties of Coelogyne spp. have been previously studied, there is little genomic information providing a valuable tool for the plant taxonomy, conservation, and utilization of this genus. This study used the next-generation MiSeq sequencing platform to characterize the chloroplast (cp) genomes of Coelogyne fimbriata and Coelogyne ovalis. The Maximum Likelihood (ML) and Bayesian (BI) methods were employed to confirm the phylogenetic position of two Coelogyne species based on the whole chloroplast genome sequences. Additionally, we developed eight new primers based on the two cp genomes’ medium variable regions and evaluated the transferability to another 16 Coelogyne species. We constructed phylogenetic trees including 18 Coelogyne species and four outgroup species using the chloroplast fragments with the ML method. Our results showed that the cp genomes of C. fimbriata and C. ovalis contained a small single-copy region (18,839 and 18,851 bp, respectively) and a large single-copy region (87,606 and 87,759 bp, respectively), separated by two same-length inverted-repeat regions (26,675 bp in C. fimbriata and 26,715 bp C. ovalis, respectively). They all contained 86 protein-coding genes, 38 tRNA genes, and eight rRNA genes, revealing strong structure and gene content similarities. The phylogenetic analysis indicated a close relationship between the genera Coelogyne and Pleione. The newly developed primers revealed good transferability among the Coelogyne taxa and provided enough variable sites to distinguish C. fimbriata and C. ovalis. The two complete cp genomes and the eight new primers of Coelogyne provide new genomic data for further studies on phylogenomics, population genetics, and evolutionary history of Coelogyne taxa.

Graphical Abstract

1. Introduction

Chloroplasts (cps) are photosynthetic organelles that play an essential role in providing energy for green plants [1]. The chloroplasts have their own genome. With a few exceptions, most chloroplast genomes consist of a single, large, circular DNA molecule, ranging in length from 120 to 160 Kb, which contains two inverted repeats (IRs) that divide the molecule into a large single-copy section (LSC) and a small single-copy section (SSC) [2]. About 100–130 genes encode about 79 proteins, 30 transfer RNAs, and four ribosomal RNAs. The cp genomes show highly conserved gene content and order [3]. Furthermore, maternal inheritance is the primary mechanism for transferring chloroplastic genetic material between generations in most angiosperms [4]. No complicated recombination events occur in the chloroplast genome. Because of its haploid nature, its high conservation in terms of gene content and order, and its simple inheritance mode, the cp genome has been employed extensively in the study of phylogeography and in addressing evolutionary questions in plants.
Coelogyne Lindl. (Epidendroideae; Orchidaceae) is a genus comprising more than 200 species. It is widely distributed throughout Asia, including China, India, Indonesia, and the Fiji Islands. Its main centers of diversity are in the Himalayas, Sumatra, and Borneo [5]. Most species grow in tropical montane and lowland forest areas. Some species, which grow under cooler conditions, such as Coelogyne fimbriata and Coelogyne ovalis, prefer higher altitudes on mountains. These two species are epiphytic and grow on rocks or tree trunks, with slender and creeping rhizomes. They reproduce both sexually and by vegetative growth. One or two flowers can be found on a given scape. The flowers are nectarless and attract pollinators through fragrance. According to Cheng et al.’s report in 2009, C. fimbriata is food-deceptive and pollinated by worker wasps [6].
A few species in this genus have been identified as medicinal plants [7,8,9]. Especially in China, India, Nepal, and Thailand, people use Coelogyne species as traditional medicines. For example, an alcoholic extract of pseudobulbs from C. ovalis contained the phenanthrenoids, coelogin, and flavidin, with these substances showing spasmolytic activity [10]. Moreover, the whole plant of C. fimbriata is used to reduce “heat” (primarily, inflammation) [11]. However, there are many taxonomic issues to be addressed in the genus Coelogyne [12]. It is still debated as to whether the two species mentioned above should be merged into one species. To better understand the phylogeny and Coelogyne’s species delimitations, we characterized the complete chloroplast genome sequences of C. fimbriata and C. ovalis. Using the two genomes, we developed eight primers for phylogenetic and delimited marker resources for future studies. Furthermore, we used these primers to amplify 18 Coelogyne species (including C. fimbriata and C. ovalis) to test the newly developed markers’ efficacy and construct a robust phylogenetic tree to improve our understanding of Coelogyne species’ relationship.

2. Results

2.1. Genome Sequencing and Assembly

Through the Illumina MiSeq sequencing, we obtained 3,041,719 and 3,624,370 clean reads from the Coelogyne fimbriata and Coelogyne ovalis’s total chloroplast DNA. There were 2,804,465, and 3,374,288 reads the can map to the reference genome Calanthe sylvatica. The results indicated similar chloroplast content and structure between the Coelogyne and Calanthe chloroplast genome. The complete cp genome sequences of C. fimbriata (GenBank: MK946948) and C. ovalis (GenBank: MK946949) were 159,795 bp and 160,040 bp in length, respectively. Based on the C. sylvatica reference cp genome, the four junctions between LSC/IRs and SSC/IRs of the two Coelogyne species were validated by PCR-based Sanger sequencing, using four pairs of primers.

2.2. The Organization of the Coelogyne Chloroplast Genome

The chloroplast (cp) genomes of C. fimbriata and C. ovalis exhibited a typical quadripartite structure, consisting of a pair of inverted repeats (IRs) with similar length (26,7675 bp and 26,715 bp, respectively), separated by the Large single-copy (LSC) (87,606 and 87,6759 bp, respectively) and Small single-copy (SSC) (18,839 and 18,851bp, respectively) regions. The whole cp genomes of the two species, showing the guanine-cytosine (GC) contents of the LSC, SSC, and IR regions, are shown in Figure 1. In C. fimbriata and C. ovalis, GC content was very similar at 37.4% and 37.3%, respectively. However, the GC contents of the LSC and SSC regions in C. fimbriata (35.3% and 30.5%, respectively) and C. ovalis (35.2%, and 30.4%, respectively) were markedly lower than those of the IR regions (43.3% for both species).
Both cp genomes contained 86 protein-coding, 38 tRNA, and eight rRNA genes (Table 1). A total of 132 predicted functional genes were found through the annotation by DOGMA of the cp genome sequences of each of these two Coelogyne species. Of these, 115 genes were unique, including 81 protein-coding, 30 tRNA genes, and four rRNA genes (Figure 1, Table 2). The LSC region comprised 61 protein-coding genes and 21 tRNA genes, whereas 12 protein-coding genes and one tRNA gene were found in the SSC region. Eight protein-coding and eight tRNA genes were repeated in the IR regions. Among the 18 duplicated genes in the IR regions, six were protein-coding genes (ndhB, rpl2, rpl23, rps7, rps19, and ycf2), eight encoded tRNAs (trnH-GUG, trnI-CAU, trnL-CAA, trnV-GAC, trnI-GAU, trnA-UGC, trnR-ACG, and trnN-GUU) and four encoded rRNA (rrn16, rrn5, rrn4.5 and rrn23) (Table 1). Furthermore, the number of genes with introns was 16, including ten protein-coding genes and six tRNA-coding genes (Table 2). Among them, three of these genes contained two introns: the clpP, ycf3, rps12 genes, and a trans-spliced gene, rps12, with the 5′ end exon the LSC region and the intron 3′ end exon situated in the IR region (Table 3).

2.3. Sequence Repeats

The distribution, number, and type of microsatellites detected in the two cp genomes were analyzed. A total of 50 SSRs were found in C. fimbriata, of which 31 were in the LSC regions, whereas six and 13 were in the IR and SSC regions, respectively. On the other hand, in C. ovalis, there were 48 SSRs, with 34, four, and ten SSRs distributed in the LSC, IR, and SSC regions, respectively (Figure 2a). In addition, seven SSRs were discovered in the coding sequences (CDSs), 35 in intergenic spacers (IGSs), and eight in intron regions of the C. fimbriata cp genome, whereas the corresponding numbers in the C. ovalis cp genome were five in CDS, 32 in IGS and 11 in intron regions (Figure 2b). Among these SSRs in C. fimbriata and C. ovalis, mononucleotide repeats were the most frequent, accounting for 78% and 79%, respectively, whereas dinucleotide repeats accounted for 20% and 19%, respectively, with trinucleotide repeats accounting for 2% and 2%, respectively (Figure 2c).
Furthermore, 43 repeat sequences with different types and locations were identified in each of the two cp genomes. There were ten repeat sequences with motifs of one and ten with motifs of two in C. fimbriata, compared with 11 and six with motifs of one and two, respectively, in C. ovalis. The number of forward repeats was eight, and the number of palindrome repeats was 11, and there were no reverse or complementary repeats in C. fimbriata, whereas there were four, 11, and two forward, palindrome and reverse repeats, respectively, in C. ovalis. Of these repeats, 65% were in the same regions of the two species, with the remainder of them existing in different regions in C. fimbriata and C. ovalis.

2.4. Comparative Genome Analysis

A total of 271 polymorphic sites can be found by comparing C. fimbriata and C. ovalis cp genomes. The nucleotide diversity (Pi) was 0.0017 between the above cp genomes. According to the comparison among the six Orchidaceae species representing Apostasioideae, Vanilloideae, Cypridoideae, Orchidoideae, and Epidendroideae, we found that Apostasioideae is very different from the other Orchidaceae species in genomic structure and gene contents. However, other species except Apostasia shenzhenica showed similar genomic structure and gene contents (Figure 3). We chose C. sylvatica to be the reference genome. The mVISTA tool was used to perform the comparative analysis of cp genome sequences in three species: C. fimbriata, C. ovalis, and C. sylvatica (Figure A1). From the results, we could see that the IRs showed higher sequence conservation between species than did the LSC and SSC regions.
Furthermore, the non-coding regions were revealed to be less highly conserved than the coding regions, with most of the divergences being in the IGSs. The boundary regions of these three species were also compared (Figure 4). The rpl22 gene extended from the LSC to the inverted repeat region B (IRb) region by 76 bp in C. sylvatica but by 37 bp in both C. fimbriata and C. ovalis. At the boundary of IRb/SSC, the main part of the ndhF gene in C. sylvatica was in the SSC region, with 60 bp located in the IRb region, compared with 68 bp in each of the other two Coelogyne species. The ycf1 gene was 1031 bp and 16 bp from the borderline between SSC and the inverted repeat region A (IRa) in C. sylvatica and C. fimbriata, respectively, whereas it was present in the SSC region in C. ovalis, at 348 bp from the SSC/IRa borderline. The rps19 and psbA genes were distributed in the edge regions of the IRa/LSC boundary line in all three species, with the distance from these two genes, rps19 and psbA, to the boundary line between IRa and LSC being 259 bp and 103 bp, respectively, in C. sylvatica, 128 bp and 103 bp in C. fimbriata, and 122 bp and 109 bp in C. ovalis. With C. sylvatica as the reference genome, we found that the rpl22 gene moved away from LSC/IRb boundary line to the LSC region, whereas the ycf1 gene shifted from the SSC/IRa boundary line to the SSC region, with genes like ndhF and rps19 moving to the boundary line of IRb/SSC and IRa/LSC, respectively. Moreover, the psbA gene made a slight (6 bp) movement back to the LSC region in C. ovalis, compared with C. fimbriata and C. ovalis (Figure 4).

2.5. Phylogenetic Position of Coelogyne in Orchidaceae

To gain a clear insight into the phylogenetic position of C. fimbriata and C. ovalis, we carried out a phylogenetic analysis, with an aligned data matrix of the complete cp genome sequences of 67 orchid species. After removing ambiguous sites, we used 44,582 nucleotides to construct a phylogenetic tree using the Maximum Likelihood and Bayesian methods. Both results of the two methods indicated the same systematic relationship within Orchidaceae (e.g., (Vanilloideae [Orchidoideae, Epidendroideae])). It also showed the close relationship among Pleione, Bletilla, and Coelogyne with high bootstrap support (100) and posterior probability (1.00), which belong to the subtribe Coelogyninae Benth (Figure 5).

2.6. Primer Verification and Transferability

We developed eight primers based on the medium variable regions within the LSC regions to compare the whole chloroplast genomes between C. fimbriata and C. ovalis. These primers were verified in 18 species of Coelogyne, including C. fimbriata and C. ovalis. Most Coelogyne species can be amplified using the eight primers (Table A1). All the sequences which were successfully amplified have been submitted to GenBank (Table A1).

2.7. Phylogenetic Relationship within Coelogyne

The alignments were 2858 bp and 5719 bp in the four- and eight-sequence matrix, respectively. When we considered the gap and missing data, a total of 128 and 302 polymorphic sites can be found, and the nucleotide diversity (Pi) was 0.0133 and 0.0099 in the four- and eight-sequence matrix among the 18 Coelogyne species. There were 42 parsimony informative sites within the above two alignments. According to Coelogyne’s phylogenetic tree results based on four and eight fragments, two clades can be clustered with high bootstrap support (Figure 6). However, the interspecies relationship was conflicted between the two trees. Furthermore, we found that C. fimbriata and C. ovalis have the closest evolutionary relationship of all the species investigated (Figure 6). Using more Coelogyne species based only on matK sequence, a phylogenetic tree showed a low bootstrap support. In addition, the relationship between C. fimbriata and C. ovalis is still close (Figure A2).

3. Discussion

3.1. Coelogyne Chloroplast Genome Structure and Characterization

In the angiosperms, most cp genomes are ordinarily conserved with a length of 120–160 kb and a content of 100–130 genes, but some Orchidaceae species’ chloroplast genomes lost genes and rearrange structures [13]. In the current study, the cp genomes of C. fimbriata and C. ovalis each had 132 genes, consisting of 86 protein-coding genes, 38 tRNA genes, and eight rRNA genes. Moreover, the cp genome lengths of C. fimbriata and C. ovalis were 159,795 bp and 160,040 bp, respectively. This length was consistent with most angiosperms, including the Orchidaceae. There are 74 protein-coding genes shared by all angiosperms, while several other genes, such as ycf1, ycf2, ycf4, rpl22, rpl23, rps16, ndhF, accD, and infA, are present in only some other species [14,15,16,17,18], with variation also observed in the Orchidaceae. We found that genes with a high frequency of absence from orchid species were usually ndhK, ndhF, ndhE, ndhI, ndhA, ycf15, ycf1, and psbG, whereas genes with a low frequency of absence from orchid species were ndhG, ndhD, and infA [19,20,21,22]. Compared with other Epidendroideae species, the psbG gene was absent from the C. fimbriata and C. ovalis cp genomes [23]. The previous study showed that the ndh genes were present in the common ancestor of orchids but have experienced independent, significant losses at least eight times in Orchidaceae [24]. This loss may be correlated in part with the unusual life history of orchids [24]. In this study, it is unknown whether the psbG gene was successfully transferred to the nucleus or completely lost from the entire cell of these two species, nor was this known for the other lost genes listed above. Combined with the reason of loss in other Epidendroideae species, we speculate that this may be related to the long-term evolution of genes to adapt to extreme living environments and climatic conditions, such as high altitude for C. ovalis and C. fimbriata, which could provide us with useful information concerning the dynamics of genetic evolution.
Repeat sequences could be used to study genome recombination and rearrangement [25]. In the present study, 43 repeat sequences were detected in the cp genome of both Coelogyne spp. Of the four types of repetition possible, most of those in C. fimbriata and C. ovalis were palindromic (P) repeats and forward (F) repeats, with percentages of 58% and 42%, respectively, in C. fimbriata, and 60% and 30%, respectively, in C. ovalis. Repeat sequence analysis of some other orchid species takes into account only these two repeat types (P and F) regardless of the other ones (C and R) [26]. This type suggests that palindromic and forward repeats are not only typical but representative in plants. Most repeat motifs existed in the IGS regions that play an essential role in the dynamic historical analysis of plant populations [27]. Furthermore, these data will provide us with specific insights into the phylogeny and evolutionary process of these Coelogyne species.
SSRs are widely distributed in eukaryotic genomes, consisting of tandem repeated sequences of 1–6 nucleotide motifs as the basic repeat unit. We identified 50 SSR loci in C. fimbriata, among which 86% were in the non-coding regions, with 35 in the IGS and eight in intron regions. In C. ovalis, on the other hand, a total of 48 SSR loci were detected, among which 90% were present in the non-coding regions, with 32 in IGS and 11 in intron regions. These results indicated that most of the polymorphisms were within the IGS regions, a finding which was consistent with earlier studies showing that the cp genome repeats were often present in non-coding regions, especially in IGS regions [28,29]. These data will provide us with tremendous help in further studying genetic diversity and population structure in the Orchidaceae.
The contraction and expansion of the SSC and IR boundary regions have been regarded as mechanisms by which the length difference within the angiosperm cp genome was achieved [30]. In the current study, a comparison of IR boundaries in two Coelogyne species was carried out, using C. sylvatica, which we had sequenced before, as a reference genome (Figure A1). The results showed that those genes close to the boundary line experienced shifts to different extents, which were mainly caused by the expansion of the four regions, which, in turn, were associated with differences in genome length comparisons among these three cp genomes (Figure 4). Moreover, the length of these genes has also changed. For example, the gene of rpl22 and ycf1 had shortened, whereas the length of the ndhF gene had increased (Figure A1). According to others, this expansion and contraction usually tended to be slight and even caused the duplication of parts of or even entire genes, which usually produced pseudogenes at the boundary of IR/SSC [30]. However, this situation did not occur in the cp genomes of C. fimbriata and C. ovalis. The related data are still preliminary, and it will be necessary to obtain more information to elucidate the mechanism by which variation in gene length occurred.

3.2. Phylogenetic Analysis of Inter- and Intra- Coelogyne

With the rise of the high-throughput sequencing and accurate assembly technology, chloroplast genomes are inexpensive and easy to obtain [31]. Phylogenomic studies using chloroplast genomes shed light on a more innovative and profound view than single or multiple genes in the systematic evolution [30]. To construct the phylogeny tree and determine Coelogyne’s systematic position, we ultimately chose 67, from 28 genera, out of 122 species in the Orchidaceae, for which the full cp genome sequencing had been accomplished and officially published in the database of the NCBI. The results showed that the main relationship was the same as other studies among Vanilloideae, Orchidoideae, and Epidendroideae [32]. Within Epidendroideae, the relationship among tribes was ultimately the same as other studies using chloroplast genome CDS (coding sequence) [32]. These results showed that a systematic evolutionary relationship was robust using chloroplast genomes. Our focus genus Coelogyne and the Pleione form a high support clade (1.00 and 100 for BS and ML analysis) (Figure 5). The above clade and Bletilla clustered into a monophyletic tribe Arethuseae. The three genera’s systematic relationship was in line with the previous study using the restriction fragment length polymorphism (RFLP), matK, and ITS markers, but our phylogenomic tree showed higher support [12]. Based on the above analysis, we inferred the close relationship between the Coelogyne and Pleione.
Within Coelogyne, we used the eight chloroplast fragments to construct a phylogenetic tree, including 18 Coelogyne species and four outgroup species. The eight newly developed primers showed high transferability, identifying high levels of variation among Coelogyne (Figure A1). The results revealed two high-support clades within Coelogyne (Clade1 and Clade2 in Figure 6, 100 bootstrap support for ML analysis), consistent with previous studies [12]. However, the relationship among the species within each clade was different from the earlier studies [12]. On one side, there are only four shared species between ours and the previous research. It was hard to compare the different phylogenetic trees with distinct species. On the other side, most clades have high support in our analysis using the ML method. In the future, more Coelogyne species can be added into the phylogenetic tree using the eight chloroplast fragments, which will provide a global view of the evolutionary relationship of Coelogyne.
Combining NCBI data and our new sequencing matK, we constructed a phylogenetic tree, including 82 Coelogyne species. However, bootstrap support is very low in most nodes (Figure A2). The results indicated the low resolution if only one chloroplast fragment is used. More chloroplast fragments are needed to construct a robust phylogenetic tree. Chloroplast genome resources provide a potential molecular marker for the study of systematic evolution.

4. Materials and Methods

4.1. Plant Sampling and DNA Extraction

We collected fresh leaves of Coelogyne fimbriata and Coelogyne ovalis from Jiangxi and Yunnan Provinces in China, respectively (Table A2). Approximately 50 g of fresh leaves of each species were sterilized with 75% ethanol and clean with distilled water, and then these materials were stored in a 4 °C refrigerator prior to further processing. The total chloroplast genomic DNA was extracted according to the high-salt methods provided by Shi et al. 2012 [33]. Approximately 1 μg of DNA was prepared and processed to construct a DNA library according to the Illumina Sample Preparation Instructions using UltraTM DNA Library Prep Kit (New England Biolabs Inc., Ipswich, MA, USA). The cpDNA sample from each species was subjected to single-read sequencing with insertion lengths of 500 bp, using the Illumina MiSeq system (Illumina, San Diego, CA, USA). In addition, we collected leaf material of another 16 Coelogyne species from Shanghai Chenshan Botanical Garden (Table A2). Total DNA were extracted from the leaves using the Plant Genomic DNA Kit (TIANGEN Co., Ltd., Beijing, China).

4.2. Genome Assembly and Annotation

For each of the two species, low-quality reads were discarded from the raw reads, using Trimmomatic v0.39 [34] and Kmernator v1.0 software [35]. We mapped the clean reads to the reference cp genome of Calanthe sylvatica (GenBank accession no. MK736029) [36] with Burrows-Wheeler Aligner (BWA) v0.6 software [37]. The consensus sequences were extracted, and gaps were filled by polymerase chain reaction (PCR), with the primers designed based on the conserved sequences. According to the reference cp genome, the four LSC/IRs and SSC/IRs junctions of each of the two Coelogyne individuals were validated by PCR-based Sanger sequencing, using four pairs of primers. We used Dual Organellar GenoMe Annotator (DOGMA) software to initially annotate the chloroplast genomes [38]. These annotations were manually corrected for a start and stop codons and intron/exon boundaries by comparison with homologous genes in the Calanthe sylvatica cp genome. The tRNA genes were also verified by tRNAscan-SE v2.0 [39]. MAFFT v7.45 software [40] was employed to align the two Coelogyne cp genomes by comparing the structure and gene content. The online OGDRAW v1.3.1 program [41] was used to draw the two Coelogyne species’ circular cp genomes.

4.3. Repeat Sequence Analysis

Perl script MISA v2.1 [42] was used to detect microsatellites, including mono-, di-, tri-, tetra-, penta-, and hexa-nucleotide repeats. We set the thresholds at ten repeat units for mononucleotide microsatellites or simple sequence repeats (SSRs) and five repeat units for di-, tri-, tetra-, penta-, and hexa-nucleotide SSRs. The REPuter software [43] was employed to visualize forward, palindrome, reverse, and complementary sequences. The criteria of a minimum repeat size were set as 30 bp, and the sequence identity was set as higher than 90%.

4.4. Comparative Genome Analysis

To identify divergence hotspots within Coelogyne cp genomes, we conducted a sliding window analysis to evaluate the nucleotide diversity (Pi) over the genomes, using DnaSP v5.10 software [44]. The window length and the step size were set to 600 and 200 bp, respectively. Genome, protein-coding gene, intron, and spacer sequence divergences were evaluated using DnaSP v5.10 [44], after alignment using MAFFT v7.45 software [40]. The chloroplast genome comparison between the two species was performed with the mVISTA program [45].

4.5. Phylogenetic Position of the Two Coelogyne Species

To determine the two Coelogyne species’ systematic position, we performed a phylogenetic analysis using the whole cp genomes. In addition to the two Coelogyne cp genomes, we obtained another 65 cp genome sequences, representing different lineages of Orchidaceae from the National Center for Biotechnology Information (NCBI) Organelle Genome Resource database. Three species in the genus Apostasia were set as the outgroups among these 67 taxa. First, we used MAFFT v.7.45 software [40] to align the 67 chloroplast genomes, setting the gap open penalty and offset value as 1.53 and 0.12, respectively. Second, Gblocks v0.91b software [46] was used to refine the alignment with allowed gap positions set as none. This software can eliminate poorly aligned positions and divergent regions. After selecting the best-fitting model of nucleotide substitution for the entire dataset (GTRGAMA) (Table A3), as determined by the Akaike Information Criterion (AIC) in MEGA X [47], the Maximum Likelihood (ML) and Bayesian (BI) analyses were performed in RAxML-HPC v8.2.11 software [48] and MrBayes v3.2 software [49], respectively. The ML analysis searches for the best trees, starting from 1000 random trees, and bootstrap percentages were obtained with 1000 non-parametric bootstrap replicates. In the BI analysis, we run the Markov chain Monte Carlo (MCMC) algorithm with two independent chains using a random starting tree and default priors for 1,000,000 generations, with trees sampled every 1000 generations. We assumed the convergence of the MCMC chains after the average standard deviation of split frequencies reached 0.01 or less. We performed ML and BI analysis on the Cyberinfrastructure for Phylogenetic Research (CIPRES) Science Gateway website v3.3 (http://www.phylo.org/).

4.6. Primers Design and Verification in Other Coelogyne Species

To develop more effective primers for medicinal plant identification and phylogeny analysis, we designed eight pairs of primers (Figure 7, Table 4), based on the conserved sequences on both sides of the medium variable regions within the large single-copy (LSC) regions. These primers were used to amplify and carry out Sanger sequencing of the two species and another 16 Coelogyne species (Table A2). First, we used these sequences to validate the two cp genomes’ accuracy by comparing eight fragments and genome sequences. Second, the efficiency of the newly developed markers was tested using these 18 Coelogyne species.

4.7. Phylogenetic Relationship within Coelogyne

To determine the 18 species’ divergence hotspot, we used DNAsp v.5.10 [44] software to calculate the number of variable sites and nucleotide diversity among the 18 species. Because some Coelogyne species failed to obtain all eight fragments, we created two sequence matrices. One sequence matrix includes four fragments (ndhJ-ndhK, rbcL, accD-psaI, and ycf4-cemA) shared by all 18 species, and another sequence matrix consisting of eight fragments with some missing data (Table A1). We constructed a phylogenetic tree using two sequence matrixes. We selected Bletiall striata, Bletiall ochracea, Pleione formosana, Pleione bulbocodioides as the outgroup species. We extracted the same sequence fragments of the eight primers’ locations after alignment with MAFFT v7.45 [40] from the whole chloroplast genome of the above four species; then, the four or eight fragments of four species were combined like all other sequences using SequenceMatrix v1.7.8 [50]. Gblocks v0.91b [46] was used to refine the alignment with allowed gap positions set as none. Phylogenetic analysis of two sequence matrices was conducted by RAxML-HPC v8.2.11 [48] using the generalised time reversible with shape parameter of the gamma distribution (GTRGAMA) model. We searched for the best trees by starting from 1000 random trees, and bootstrap percentages were obtained with 1000 non-parametric bootstrap replicates.
We also downloaded 239 matK sequences from the NCBI database. After removing too short and duplicate-species sequences, we obtained a total of 89 sequences (including 14 sequences from this study) and aligned these sequences representing 82 Coelogyne species. We chose P. formosana and P. bulbocodioides as the outgroup. After alignment using MAFFT v7.45 [40], Gblocks v0.91b [46] was used to refine the alignment with allowed gap positions set as none. Using the same parameters as the above analysis, we constructed a phylogenetic tree using RAxML-HPC v8.2.11 [48] using the GTRGAMA model. We searched for the best trees by starting from 1000 random trees, and bootstrap percentages were obtained with 1000 non-parametric bootstrap replicates.

5. Conclusions

To our knowledge, this was the first study to characterize the chloroplast genome of the potentially medicinal plants C. fimbriata and C. ovalis. The new cpDNA sequences will provide useful information for developing molecular markers. The results increase Coelogyne’s genomic data and provide fundamental references for further studies of the Coelogyneae tribe. Such genetic information can provide additional knowledge to support the conservation or the horticultural or phytopharmaceutical exploitation of these two Himalayan orchids.

Author Contributions

All authors contributed to the study conception and design. K.J., L.-Y.M., and Z.-W.W. contributed to the material preparation. K.J., Z.-Y.N., X.-H.Z., and C.H. contributed to the data collection. The analysis were performed by K.J., C.H., and W.-C.H. The first draft of the manuscript was written by K.J., L.-Y.M., and W.-C.H., and all authors commented on previous versions of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the project of Shanghai Landscaping and City Appearance Administrative Bureau to Kai Jiang (grant number G182418) and Chao Hu (grant numbers G192424 and G202401). This study was also supported by grants from the Science and Technology Commission, Shanghai Municipality, to Wei-Chang Huang (grant number 19390743600).

Conflicts of Interest

The authors declare that they have no conflict of interest.

Appendix A

Table
Table A1. GenBank Accession of Eight Chloroplast Fragments for 18 Coelogyne Species in the Study.
Table A1. GenBank Accession of Eight Chloroplast Fragments for 18 Coelogyne Species in the Study.
SpeciesGenBank Accession
matKrpoC2ndhJ-ndhKrbcLaccD-psaIycf4-cemAclpP-psbBpsbB-psbT
C. rochussenii--MN512535MN416673MN512468MN512517MN512484-
C. burnhamMN400405MN400397MN512520MN396950MN512453MN512502MN512471MN512487
C. velutingMN416681MN416666MN512537MN416675MN512470MN512519MN512486MN512501
C. mayelianaMN400412MN400404MN512528MN400420MN512461MN512510--
C. peltaslesMN416679 MN512532MN416670MN512465MN512514MN512482MN512498
C. cumingiiMN400407MN400399MN512522MN400414MN512455MN512504MN512473MN512489
C. flavidaMN400409MN400401MN512525MN400417MN512458MN512507MN512476MN512492
C. eberhardtiiMN400408MN400400MN512524MN400416MN512457MN512506MN512475MN512491
C. cristata--MN512523MN400415MN512456MN512505MN512474MN512490
C. tomentosa-MN416665MN512536MN416674MN512469MN512518MN512485MN512500
C. occulataMN416678MN416661MN512531MN416669MN512464MN512513MN512481MN512497
C. flaccidaMN400411MN400403MN512527MN400419MN512460MN512509MN512478MN512494
C. pulverulaMN416680MN416663MN512534MN416672MN512467MN512516MN512483MN512499
C. asperataMN400406MN400398MN512521MN400413MN512454MN512503MN512472MN512488
C. pandurata-MN416662MN512533MN416671MN512466MN512515--
C. nitidaMN416676MN416659MN512529MN416667MN512462MN512511MN512479MN512495
C. fimbriataMN400410MN400402MN512526MN400418MN512459MN512508MN512477MN512493
C. ovalisMN416677MN416660MN512530MN416668MN512463MN512512MN512480MN512496
- indicate the failed PCR.
Table
Table A2. Specimen Information for the Coelogyne Spp. Samples Used in This Study.
Table A2. Specimen Information for the Coelogyne Spp. Samples Used in This Study.
SpeciesCollectorCollection No.Deposited Institutionn
C. fimbriataWei-Chang HuangCS-HWC201606-2CSH1
C. ovalisWei-Chang HuangCS-HWC201606-5CSH1
C. rochusseniiKai JiangCS-JK201806-01CSH1
C. burnhamKai JiangCS-JK201806-02CSH1
C. velutingKai JiangCS-JK201806-03CSH1
C. mayelianaKai JiangCS-JK201806-04CSH1
C. peltaslesKai JiangCS-JK201806-05CSH1
C. cumingiiKai JiangCS-JK201806-06CSH1
C. flavidaKai JiangCS-JK201806-07CSH1
C. eberhardtiiKai JiangCS-JK201806-08CSH1
C. cristataKai JiangCS-JK201806-09CSH1
C. tomentosaKai JiangCS-JK201806-10CSH1
C. occulataKai JiangCS-JK201806-11CSH1
C. flaccidaKai JiangCS-JK201806-12CSH1
C. pulverulaKai JiangCS-JK201806-13CSH1
C. asperataKai JiangCS-JK201806-14CSH1
C. pandurataKai JiangCS-JK201806-15CSH1
C. nitidaKai JiangCS-JK201806-16CSH1
All voucher specimens were deposited in shanghai chenshan herbarium (CSH), shanghai, China. all the materials were collected in living plants from Shanghai Chenshan Botanical Garden. n showed the number of collected sample.
Table
Table A3. Best model selection based on the Maximum Likelihood method.
Table A3. Best model selection based on the Maximum Likelihood method.
ModelParamBICAICclnLInvariantGammaR
GTR + G140.00582,962.94581,155.75−290,437.87n/a0.941.39
GTR + G + I141.00582,977.87581,157.77−290,437.880.000.941.39
T92 + G134.00585,265.34583,535.60−291,633.79n/a0.931.48
TN93 + G137.00585,287.36583,518.89−291,622.44n/a0.931.48
HKY + G136.00585,287.51583,531.95−291,629.97n/a0.931.48
T92 + G + I135.00585,403.95583,661.30−291,695.640.000.931.57
TN93 + G + I138.00585,425.88583,644.51−291,684.250.000.921.57
HKY + G + I137.00585,426.37583,657.91−291,691.950.000.931.57
GTR + I140.00587,343.22585,536.03−292,628.010.31n/a1.37
T92 + I134.00589,665.50587,935.76−293,833.870.31n/a1.34
HKY + I136.00589,688.10587,932.55−293,830.270.31n/a1.34
TN93 + I137.00589,690.94587,922.48−293,824.230.31n/a1.34
K2 + G133.00591,575.20589,858.37−294,796.18n/a0.841.56
K2 + G + I134.00591,756.46590,026.72−294,879.350.000.831.65
GTR139.00592,361.70590,567.41−295,144.70n/an/a1.33
T92133.00594,707.63592,990.80−296,362.39n/an/a1.32
HKY135.00594,729.93592,987.28−296,358.63n/an/a1.32
TN93136.00594,733.26592,977.71−296,352.85n/an/a1.32
K2 + I133.00596,345.39594,628.56−297,181.270.33n/a1.45
JC + G132.00600,630.85598,926.93−299,331.46n/a0.870.50
JC + G + I133.00600,645.77598,928.94−299,331.460.000.870.50
K2132.00602,173.44600,469.52−300,102.75n/an/a1.39
JC + I132.00605,419.13603,715.21−301,725.600.32n/a0.50
JC131.00610,996.30609,305.29−304,521.64n/an/a0.50
Models with the lowest Bayesian Information Criterion (BIC scores) are considered to describe the substitution pattern the best. For each model, the Akaike Information Criterion, corrected (AICc) value, Maximum Likelihood value (lnL), and the number of parameters (including branch lengths) are also presented. Non-uniformity of evolutionary rates among sites may be modeled by using a discrete Gamma distribution (+G) with five rate categories and by assuming that a certain fraction of sites is evolutionarily invariable (+I). Whenever applicable, estimates of the gamma shape parameter and the estimated fraction of invariant sites are shown. Assumed or estimated values of transition/transversion bias (R) are shown for each model, as well. For estimating ML values, a tree topology was automatically computed. This analysis involved 67 nucleotide sequences. There were a total of 44,582 positions in the final dataset. Evolutionary analyses were conducted in MEGA X.
Plants 09 01332 g0a1 550
Figure A1. The cp genome sequence comparison of two Coelogyne species with Calanthe sylvatica as a reference. Dark grey arrows show the direction and position of genes. Pink and dark blue areas show Conserved Non-coding Sequences (CNS) and exon regions, respectively. The untranslated regions (UTRs) are colored with light-blue, including tRNA and rRNA regions. The peaks and valleys show the percent of conservation with an identity cutoff of 50%.
Figure A1. The cp genome sequence comparison of two Coelogyne species with Calanthe sylvatica as a reference. Dark grey arrows show the direction and position of genes. Pink and dark blue areas show Conserved Non-coding Sequences (CNS) and exon regions, respectively. The untranslated regions (UTRs) are colored with light-blue, including tRNA and rRNA regions. The peaks and valleys show the percent of conservation with an identity cutoff of 50%.
Plants 09 01332 g0a1
Plants 09 01332 g0a2 550
Figure A2. Phylogenetic tree based on 89 matK sequences representing 82 Coelogyne species using two Pleione species as outgroup. The number in the node showed the bootstrap support in the ML method using RAxML.
Figure A2. Phylogenetic tree based on 89 matK sequences representing 82 Coelogyne species using two Pleione species as outgroup. The number in the node showed the bootstrap support in the ML method using RAxML.
Plants 09 01332 g0a2

References

  1. Dyall, S.D.; Brown, M.T.; Johnson, P.J. Ancient invasions: From endosymbionts to organelles. Science 2004, 304, 253–257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Chumley, T.W.; Palmer, J.D.; Mower, J.P.; Fourcade, H.M.; Calie, P.J.; Boore, J.L.; Jansen, R.K. The complete chloroplast genome sequence of Pelargonium × hortorum: Organization and evolution of the largest and most highly rearranged chloroplast genome of land plants. Mol. Biol. Evol. 2006, 23, 2175–2190. [Google Scholar] [CrossRef] [PubMed]
  3. Palmer, J.D.; Jansen, R.K.; Michaels, H.J.; Chase, M.W.; Manhart, J.R. Chloroplast DNA variation and plant phylogeny. Ann. Mo. Bot. Gard. 1988, 1180–1206. [Google Scholar] [CrossRef]
  4. Corriveau, J.L.; Goff, L.J.; Coleman, A.W. Plastid DNA is not detectable in the male gametes and pollen tubes of an angiosperm (Antirrhinum majus) that is maternal for plastid inheritance. Curr. Genet. 1990, 17, 439–444. [Google Scholar] [CrossRef]
  5. Chen, X.Q.; Clayton, D. Coelogyne Lindley. In Flora of China; Wu, Z.Y., Raven, P.H., Eds.; 25; Science Press, Beijing & Missouri Botanical Garden Press: St. Louis, MO, USA, 2009; pp. 315–325. [Google Scholar]
  6. Cheng, J.; Shi, J.; Shangguan, F.Z.; Dafni, A.; Deng, Z.H.; Luo, Y.B. The pollination of a self-incompatible, food-mimic orchid, Coelogyne fimbriata (Orchidaceae), by female Vespula wasps. Ann. Bot. 2009, 104, 565–571. [Google Scholar] [CrossRef]
  7. Satake, M.; Ijung, L. Flowers in Myanmar (Part II): Wild orchid and medicinal orchid. Aroma Res. 2004, 5, 83–89. [Google Scholar]
  8. Pramanick, D.D. Pharmacognostic studies on the pseudobulb of Coelogyne cristata Lindl.(Orchidaceae)-An epiphytic orchid of ethno-medicinal importance. J. Pharmacogn. Phytochem. 2016, 5, 120. [Google Scholar]
  9. Singh, N.; Kumaria, S. A Combinational Phytomolecular-Mediated Assessment in Micropropagated Plantlets of Coelogyne ovalis Lindl.: A Horticultural and Medicinal Orchid. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2020, 90, 455–466. [Google Scholar] [CrossRef]
  10. Teoh, E.S. Medicinal orchids of Asia; Springer: Cham, Switzerland, 2016. [Google Scholar]
  11. Wu, X.R. A Concise Edition of Medicinal Plants in China; Guangdong Higher Education Publication House: Guangdong, China, 1994. (In Chinese) [Google Scholar]
  12. Gravendeel, B.; Chase, M.W.; de Vogel, E.F.; Roos, M.C.; Mes, T.H.; Bachmann, K. Molecular phylogeny of Coelogyne (Epidendroideae; Orchidaceae) based on plastid RFLPs, matK, and nuclear ribosomal ITS sequences: Evidence for polyphyly. Am. J. Bot. 2001, 88, 1915–1927. [Google Scholar] [CrossRef] [PubMed]
  13. Lin, C.S.; Chen, J.J.; Chiu, C.C.; Hsiao, H.C.; Yang, C.J.; Jin, X.H.; Leebens-Mack, J.; de Pamphilis, C.W.; Huang, Y.T.; Yang, L.H.; et al. Concomitant loss of NDH complex-related genes within chloroplast and nuclear genomes in some orchids. Plant J. 2017, 90, 994–1006. [Google Scholar] [CrossRef] [Green Version]
  14. Hiratsuka, J.; Shimada, H.; Whittier, R.; Ishibashi, T.; Sakamoto, M.; Mori, M.; Kondo, C.; Honji, Y.; Sun, C.R.; Meng, B.Y. The complete sequence of the rice (Oryza sativa) chloroplast genome: Intermolecular recombination between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Mol. Gen. Genet. MGG 1989, 217, 185–194. [Google Scholar] [CrossRef]
  15. Maier, R.M.; Neckermann, K.; Igloi, G.L.; Kössel, H. Complete sequence of the maize chloroplast genome: Gene content, hotspots of divergence and fine tuning of genetic information by transcript editing. J. Mol. Biol. 1995, 251, 614–628. [Google Scholar] [CrossRef]
  16. Gantt, J.S.; Baldauf, S.L.; Calie, P.J.; Weeden, N.F.; Palmer, J.D. Transfer of rpl22 to the nucleus greatly preceded its loss from the chloroplast and involved the gain of an intron. EMBO J. 1991, 10, 3073–3078. [Google Scholar] [CrossRef] [PubMed]
  17. Thomas, F.; Massenet, O.; Dome, A.M.; Briat, J.F.; Mache, R. Expression of the rpl23, rpl2 and rps19 genes in spinach chloroplasts. Nucleic Acids Res. 1988, 16, 2461–2472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Nagano, Y.; Matsuno, R.; Sasaki, Y. Sequence and transcriptional analysis of the gene cluster trnQ-zfpA-psaI-ORF231-petA in pea chloroplasts. Curr. Genet. 1991, 20, 431–436. [Google Scholar] [CrossRef] [PubMed]
  19. Wu, F.H.; Chan, M.T.; Liao, D.C.; Hsu, C.T.; Lee, Y.W.; Daniell, H.; Duvall, M.R.; Lin, C.S. Complete chloroplast genome of Oncidium Gower Ramsey and evaluation of molecular markers for identification and breeding in Oncidiinae. BMC Plant Biol. 2010, 10, 68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Roma, L.; Cozzolino, S.; Schlüter, P.M.; Scopece, G.; Cafasso, D. The complete plastid genomes of Ophrys iricolor and O. sphegodes (Orchidaceae) and comparative analyses with other orchids. PLoS ONE 2018, 13, e0204174. [Google Scholar] [CrossRef] [Green Version]
  21. Pan, I.C.; Liao, D.C.; Wu, F.H.; Daniell, H.; Singh, N.D.; Chang, C.; Shih, M.C.; Chan, M.T.; Lin, C.S. Complete chloroplast genome sequence of an orchid model plant candidate: Erycina pusilla apply in tropical Oncidium breeding. PLoS ONE 2012, 7, e34738. [Google Scholar] [CrossRef]
  22. Yang, J.B.; Tang, M.; Li, H.T.; Zhang, Z.R.; Li, D.Z. Complete chloroplast genome of the genus Cymbidium: Lights into the species identification, phylogenetic implications and population genetic analyses. BMC Evol. Biol. 2013, 13, 84. [Google Scholar] [CrossRef] [Green Version]
  23. Li, J.; Chen, C.; Wang, Z.Z. The complete chloroplast genome of the Dendrobium strongylanthum (Orchidaceae: Epidendroideae). Mitochondrial DNA Part A 2016, 27, 3048–3049. [Google Scholar] [CrossRef] [PubMed]
  24. Kim, H.T.; Kim, J.S.; Moore, M.J.; Neubig, K.M.; Williams, N.H.; Whitten, W.M.; Kim, J.H. Seven new complete plastome sequences reveal rampant independent loss of the ndh gene family across orchids and associated instability of the inverted repeat/small single-copy region boundaries. PLoS ONE 2015, 10, e0142215. [Google Scholar] [CrossRef] [PubMed]
  25. Cavalier-Smith, T. Chloroplast evolution: Secondary symbiogenesis and multiple losses. Curr. Biol. 2002, 12, R62–R64. [Google Scholar] [CrossRef] [Green Version]
  26. Yao, X.; Tang, P.; Li, Z.; Li, D.; Liu, Y.; Huang, H. The first complete chloroplast genome sequences in Actinidiaceae: Genome structure and comparative analysis. PLoS ONE 2015, 10, e0129347. [Google Scholar] [CrossRef] [PubMed]
  27. Small, R.L.; Ryburn, J.A.; Cronn, R.C.; Seelanan, T.; Wendel, J.F. The tortoise and the hare: Choosing between noncoding plastome and nuclear Adh sequences for phylogeny reconstruction in a recently diverged plant group. Am. J. Bot. 1998, 85, 1301–1315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Provan, J.; Powell, W.; Hollingsworth, P.M. Chloroplast microsatellites: New tools for studies in plant ecology and evolution. Trends Ecol. Evol. 2001, 16, 142–147. [Google Scholar] [CrossRef]
  29. Jakobsson, M.; Säll, T.; Lind-Halldén, C.; Halldén, C. Evolution of chloroplast mononucleotide microsatellites in Arabidopsis thaliana. Theor. Appl. Genet. 2007, 114, 223. [Google Scholar] [CrossRef]
  30. Kim, K.J.; Lee, H.L. Complete chloroplast genome sequences from Korean ginseng (Panax schinseng Nees) and comparative analysis of sequence evolution among 17 vascular plants. DNA Res. 2004, 11, 247–261. [Google Scholar] [CrossRef]
  31. Vu, H.T.; Tran, N.; Nguyen, T.-D.; Vu, Q.L.; Bui, M.H.; Le, M.T.; Le, L. Complete chloroplast genome of Paphiopedilum delenatii and phylogenetic relationships among Orchidaceae. Plants 2020, 9, 61. [Google Scholar] [CrossRef] [Green Version]
  32. Kim, Y.K.; Jo, S.; Cheon, S.H.; Joo, M.J.; Hong, J.R.; Kwak, M.; Kim, K.J. Plastome evolution and phylogeny of Orchidaceae, with 24 new sequences. Front. Plant Sci. 2020, 11, 22. [Google Scholar] [CrossRef]
  33. Shi, C.; Hu, N.; Huang, H.; Gao, J.; Zhao, Y.J.; Gao, L.Z. An improved chloroplast DNA extraction procedure for whole plastid genome sequencing. PLoS ONE 2012, 7, e31468. [Google Scholar] [CrossRef]
  34. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Egan, R. Kmernator: An MPI Toolkit for Large Scale Genomic Analysis. 2014. Available online: https://github.com/JGI-Bioinformatics/Kmernator (accessed on 8 October 2020).
  36. Miao, L.Y.; Hu, C.; Huang, W.C.; Jiang, K. Chloroplast genome structure and phylogenetic position of Calanthe sylvatica (Thou.) Lindl. (Orchidaceae). Mitochondrial DNA Part B 2019, 4, 2625–2626. [Google Scholar] [CrossRef] [Green Version]
  37. Li, H.; Durbin, R. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 2010, 26, 589–595. [Google Scholar] [CrossRef] [Green Version]
  38. Wyman, S.K.; Jansen, R.K.; Boore, J.L. Automatic annotation of organellar genomes with DOGMA. Bioinformatics 2004, 20, 3252–3255. [Google Scholar] [CrossRef] [Green Version]
  39. Lowe, T.M.; Eddy, S.R. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25, 955–964. [Google Scholar] [CrossRef]
  40. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  41. Stephan, G.; Pascal, L.; Ralph, B. OrganellarGenomeDRAW (OGDRAW) version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, 59–64. [Google Scholar] [CrossRef] [Green Version]
  42. Thiel, T.; Michalek, W.; Varshney, R.; Graner, A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet. 2003, 106, 411–422. [Google Scholar] [CrossRef]
  43. Kurtz, S.; Choudhuri, J.V.; Ohlebusch, E.; Schleiermacher, C.; Stoye, J.; Giegerich, R. REPuter: The manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001, 29, 4633–4642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Frazer, K.A.; Pachter, L.; Poliakov, A.; Rubin, E.M.; Dubchak, I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 2004, 32, W273–W279. [Google Scholar] [CrossRef]
  46. Talavera, G.; Castresana, J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  48. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
  49. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [Green Version]
  50. Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
Plants 09 01332 g001 550
Figure 1. Physical maps of the complete chloroplast genomes in Coelogyne fimbriata and Coelogyne ovalis. The inner circle’s genes are transcribed in the clockwise direction, while outside genes are counterclockwise. The areas with light and dark gray coloration in the internal circle suggest guanine-cytosine (GC) content of its genome.
Figure 1. Physical maps of the complete chloroplast genomes in Coelogyne fimbriata and Coelogyne ovalis. The inner circle’s genes are transcribed in the clockwise direction, while outside genes are counterclockwise. The areas with light and dark gray coloration in the internal circle suggest guanine-cytosine (GC) content of its genome.
Plants 09 01332 g001
Plants 09 01332 g002 550
Figure 2. The distribution, type, and presence of simple sequence repeats (SSRs) in the chloroplast genomes of C. fimbriata (left) and C. ovalis (right). (a) Presence of SSRs in the regions of large single-copy region (LSC), small single-copy region (SSC) and inverted regions (IRs). (b) Presence of SSRs in the intergenic spacer (IGS), coding region (CDS), and Intron of LSC, SSC, and IRs regions. (c) Presence of the numbers of polymers.
Figure 2. The distribution, type, and presence of simple sequence repeats (SSRs) in the chloroplast genomes of C. fimbriata (left) and C. ovalis (right). (a) Presence of SSRs in the regions of large single-copy region (LSC), small single-copy region (SSC) and inverted regions (IRs). (b) Presence of SSRs in the intergenic spacer (IGS), coding region (CDS), and Intron of LSC, SSC, and IRs regions. (c) Presence of the numbers of polymers.
Plants 09 01332 g002
Plants 09 01332 g003 550
Figure 3. Comparative chloroplast genomes of six Orchidaceae species representing Apostasioideae (Apostasia shenzhenica), Vanilloideae (Vanilla planifolia), Cypridoideae (Paphiopedilum armeniacum), Orchidoideae (Goodyera fumata), and Epidendroideae (Coelogyne fimbriata and Coelogyne ovalis), respectively.
Figure 3. Comparative chloroplast genomes of six Orchidaceae species representing Apostasioideae (Apostasia shenzhenica), Vanilloideae (Vanilla planifolia), Cypridoideae (Paphiopedilum armeniacum), Orchidoideae (Goodyera fumata), and Epidendroideae (Coelogyne fimbriata and Coelogyne ovalis), respectively.
Plants 09 01332 g003
Plants 09 01332 g004 550
Figure 4. Borders comparison of the LSC, SSC, and IRs regions of two Coelogyne species with C. sylvatica as a reference. LSC: large single-copy region; SSC: small single-copy region; IRa: inverted repeat region A; IRb: inverted repeat region B.
Figure 4. Borders comparison of the LSC, SSC, and IRs regions of two Coelogyne species with C. sylvatica as a reference. LSC: large single-copy region; SSC: small single-copy region; IRa: inverted repeat region A; IRb: inverted repeat region B.
Plants 09 01332 g004
Plants 09 01332 g005 550
Figure 5. The phylogenic relationship of 67 Orchidaceae species with Maximum Likelihood (ML) and Bayesian analysis. * indicated 100 percent of bootstrap support using ML analysis.
Figure 5. The phylogenic relationship of 67 Orchidaceae species with Maximum Likelihood (ML) and Bayesian analysis. * indicated 100 percent of bootstrap support using ML analysis.
Plants 09 01332 g005
Plants 09 01332 g006 550
Figure 6. The Phylogenic relationship of 18 Coelogyne species with Maximum Likelihood (ML) analysis using four (left) and eight (right) chloroplast fragments, respectively. The number in the node showed the bootstrap support in the ML method using the RAxML software.
Figure 6. The Phylogenic relationship of 18 Coelogyne species with Maximum Likelihood (ML) analysis using four (left) and eight (right) chloroplast fragments, respectively. The number in the node showed the bootstrap support in the ML method using the RAxML software.
Plants 09 01332 g006
Plants 09 01332 g007 550
Figure 7. The relative positions of eight designed primers in two Coelogyne species. The arrow indicates the location and direction of the primer, which is amplified specifically. The rectangles in the red indicate the length of those products.
Figure 7. The relative positions of eight designed primers in two Coelogyne species. The arrow indicates the location and direction of the primer, which is amplified specifically. The rectangles in the red indicate the length of those products.
Plants 09 01332 g007
Table
Table 1. Characteristics and Basic Assembly Parameters of Two Coelogyne Chloroplast Genomes.
Table 1. Characteristics and Basic Assembly Parameters of Two Coelogyne Chloroplast Genomes.
Characteristics and ParametersC. fimbriataC. ovalis
Raw reads (bp)3,142,5693,763,406
Clean reads (bp)3,041,7193,624,370
Average read length (bp)300300
Number of contigs11
Total length of contigs (bp)159,795160,040
N50 length of contigs (bp)159,795160,040
Total cp genome size (bp)159,795160,040
LSC length (bp)87,60687,759
SSC length (bp)18,83918,851
IR length (bp)26,67526,715
Total CDS length (bp)79,89178,258
Total tRNA length (bp)28652911
Total rRNA length (bp)90389041
Total GC content (%)37.3937.35
GC content for LSC (%)35.3035.20
GC content for SSC (%)30.5030.40
GC content for IR (%)43.3043.30
Total number of genes136133
Protein-coding genes9087
rRNAs genes3838
tRNAs genes88
Duplicated genes1717
Note, cp: Chloroplast; LSC: large single-copy region; SSC: small single-copy region; IR: inverted region; CDS: coding region; GC: guanine-cytosine.
Table
Table 2. Gene Composition of the Coelogyne Chloroplast Genome.
Table 2. Gene Composition of the Coelogyne Chloroplast Genome.
Categories of GenesGroups of GenesName of Genes
RNA genesRibosomal RNAsrrn5a, rrn4.5a, rrn16a, rrn23a
Transfer RNAstrnK-UUUb, trnQ-UUG, trnS-GCU, trnG-GCCb, trnR-UCU, trnC-GCA, trnD-GUC, trnA-UGC, trnY-GUA, trnE-UUC, trnF-GAA, trnT-GGU, trnS-UGA, trnG-UCC, trnfM-CAU, trnS-GGA, trnT-UGU, trnL-UAAb, trnF-GAA, trnV-UACb, trnM-CAU, trnW-CCA, trnP-UGG, trnH-GUGa, trnI-CAUa, trnL-CAAa, trnV-GACa, trnI-GAUa,b, trnA-UGCa,b, trnR-ACGa, trnN-GUUa, trnL-UAG, trnS-GCU
Transcription- and translation-related genesSmall subunit of ribosomerps2, rps3, rps4, rps7a, rps8, rps11, rps12c, rps14, rps15, rps16b, rps18, rps19a
Large subunit of ribosomerpl2a,b, rpl14, rpl16b, rpl20, rpl22, rpl23a, rpl32, rpl33, rpl36
TranscriptionrpoA, rpoB, rpoC1b, rpoC2
Translation initiation factorinfA
Photosynthesis-related genesNADH dehydrogenasendhAb, ndhBa,b, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK
Photosystem IpsaA, psaB, psaC, psaI, psaJ
Photosystem IIpsbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbK, psbL, psbJ, psbN, psbT, psbZ, psbM
RubisCO large subunitrbcL
Cytochrome b/f complexpetA, petBb, petD, petG, petL, petN
ATP synthaseatpA, atpB, atpE, atpFb, atpH, atpI
Cytochrome c synthesisccsA
OthersRNA processingmatK
Carbon metabolismcemA
Fatty acid synthesisaccD
ProteolysisclpPc
Genes of unknown functionConserved reading framesycf1, ycf2a, ycf4, ycf3c, ycf15, ycf68d
a Gene with two copies; b Gene with one intron; c Gene with two introns. d Gene existed in which species chloroplast genome and copy number and intron number in each chloroplast (cp) genome. NADH: Nicotinamide adenine dinucleotide.
Table
Table 3. Location and Length of Intron-Containing Genes in the Coelogyne Chloroplast Genome.
Table 3. Location and Length of Intron-Containing Genes in the Coelogyne Chloroplast Genome.
GeneLocationNucleotides in Base Pairs
Exon IIntron IExon IIIntron IIExon III
atpFLSC144/144965/964411/411
clpPLSC69/69963/950291/291675/673252/252
ndhASSC552/5521235/1235540/540
ndhBIR777/777701/710756/756
petBLSC6/6739/736642/642
rpl16LSC9/91007/1248399/399
rpl2IR387/387663/663432/432
rpoC1LSC435/435766/7781617/1617
rps12aLSC126/126-232/232549/54926/26
rps16LSC40/40894/893248/248
ycf3LSC126/126721/723228/228672/672152/152
trnG-GCCLSC23/23700/70047/47
trnI-GAUIR42/42948/94835/35
trnK-UUULSC37/372915/291726/26
trnL-UAALSC35/35574/57450/50
trnV-UACLSC39/39577/57735/35
a The rps12 is a trans-spliced gene with the 5′ end located in the LSC region and duplicated in the 3′ end in the IR regions. LSC: large single-copy region; SSC: small single-copy region; IR: inverted repeat region.
Table
Table 4. Basic Information of Eight Chloroplast Primers.
Table 4. Basic Information of Eight Chloroplast Primers.
LocusPrimer Sequence (5′-3′)LocationProduct Length (bp)Annealing Temperature/Tm (°C)
matKF: CACCAGATCATTGATACGGACDS139555
R: CCTGTGGAAATTCTCGGTTA
rpoC2F: TATTGTCCATGCCTCTTCACCDS101455
R: CATTTTTCTGGAGAGGTGGA
ndhJ-ndhKF: CCTATCCAACTTTCAGGCATIGS66755
R: ATCACAAGTTTGACCTTCGA
rbcLF: TCGAGTAGACCTTGTTGTTGIGS72455
R: CGGCACAAAATAAGAAACGA
accD-psaIF: TGTTTTCTTTGGGGACATCAIGS94055
R: CGGAAAGGCCACATATCATA
ycf4-cemAF: TGAGAATTTGACTCCACGAGIGS97055
R: ATTTCGGATTGCCTGGTATT
clpP-psbBF: ACACCAATGGGCATTAAGATIGS61055
R: ACCTGTTCGGTAGATTTTGT
psbB-psbNF: ATGCTCAAGTGGAATTTGGAIGS65255
R: GAACTTTAGGTGGTTCTCGA
CDS: coding region; IGS: intergenic spacer.

Share and Cite

MDPI and ACS Style

Jiang, K.; Miao, L.-Y.; Wang, Z.-W.; Ni, Z.-Y.; Hu, C.; Zeng, X.-H.; Huang, W.-C. Chloroplast Genome Analysis of Two Medicinal Coelogyne spp. (Orchidaceae) Shed Light on the Genetic Information, Comparative Genomics, and Species Identification. Plants 2020, 9, 1332. https://doi.org/10.3390/plants9101332

AMA Style

Jiang K, Miao L-Y, Wang Z-W, Ni Z-Y, Hu C, Zeng X-H, Huang W-C. Chloroplast Genome Analysis of Two Medicinal Coelogyne spp. (Orchidaceae) Shed Light on the Genetic Information, Comparative Genomics, and Species Identification. Plants. 2020; 9(10):1332. https://doi.org/10.3390/plants9101332

Chicago/Turabian Style

Jiang, Kai, Li-Yuan Miao, Zheng-Wei Wang, Zi-Yi Ni, Chao Hu, Xin-Hua Zeng, and Wei-Chang Huang. 2020. "Chloroplast Genome Analysis of Two Medicinal Coelogyne spp. (Orchidaceae) Shed Light on the Genetic Information, Comparative Genomics, and Species Identification" Plants 9, no. 10: 1332. https://doi.org/10.3390/plants9101332

APA Style

Jiang, K., Miao, L. -Y., Wang, Z. -W., Ni, Z. -Y., Hu, C., Zeng, X. -H., & Huang, W. -C. (2020). Chloroplast Genome Analysis of Two Medicinal Coelogyne spp. (Orchidaceae) Shed Light on the Genetic Information, Comparative Genomics, and Species Identification. Plants, 9(10), 1332. https://doi.org/10.3390/plants9101332

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop