MicroRNAs Differentially Expressed in Actinic Keratosis and Healthy Skin Scrapings
Abstract
:1. Introduction
2. Materials and Methods
2.1. Clinical Samples Collection
2.2. MicroRNA Extraction and TaqMan Array Human MicroRNA A Card Analysis
2.3. Real Time RT-PCR
2.4. Principal Component Analysis (PCA)
2.5. MiRNA Target Prediction and Enriched Pathways
2.6. Statistical Analysis
3. Results
3.1. MicroRNA Profiling of AK Samples and Matched Healthy Skin
3.2. Pathways Regulated by Target Genes of miRNAs Modulated in AK Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, J.A.; Korgavkar, K.; Weinstock, M.A. Current perspective on actinic keratosis: A review. Br. J. Dermatol. 2017, 177, 350–358. [Google Scholar] [CrossRef]
- Siegel, J.A.; Luber, A.J.; Weinstock, M.A.; Department of Veterans Affairs Topical Tretinoin Chemoprevention Trial and Department of Veterans Affairs Keratinocyte Carcinoma Chemoprevention Trial Groups. Predictors of actinic keratosis count in patients with multiple keratinocyte carcinomas: A cross-sectional study. J. Am. Acad. Dermatol. 2017, 76, 346–349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, D.D.; Borsky, K.; Jani, C.; Crowley, C.; Rodrigues, J.N.; Matin, R.N.; Marshall, D.C.; Salciccioli, J.D.; Shalhoub, J.; Goodall, R. Trends in keratinocyte skin cancer incidence, mortality and burden of disease in 33 countries between 1990 and 2017. Br. J. Dermatol. 2023, 188, 237–246. [Google Scholar] [CrossRef] [PubMed]
- De Oliveira, E.C.V.; da Motta, V.R.V.; Pantoja, P.C.; Ilha, C.S.O.; Magalhães, R.F.; Galadari, H.; Leonardi, G.R. Actinic keratosis—Review for clinical practice. Int. J. Dermatol. 2019, 58, 400–407. [Google Scholar] [CrossRef] [PubMed]
- Rollison, D.E.; Amorrortu, R.P.; Zhao, Y.; Messina, J.L.; Schell, M.J.; Fenske, N.A.; Cherpelis, B.S.; Giuliano, A.R.; Sondak, V.K.; Pawlita, M.; et al. Cutaneous Human Papillomaviruses and the Risk of Keratinocyte Carcinomas. Cancer Res. 2021, 81, 4628–4638. [Google Scholar] [CrossRef] [PubMed]
- Sohel, M.M.H. Circulating microRNAs as biomarkers in cancer diagnosis. Life Sci. 2020, 248, 117473. [Google Scholar] [CrossRef]
- Konicke, K.; López-Luna, A.; Muñoz-Carrillo, J.L.; Servín-González, L.S.; Flores-de la Torre, A.; Olasz, E.; Lazarova, Z. The microRNA landscape of cutaneous squamous cell carcinoma. Drug Discov. Today 2018, 23, 864–870. [Google Scholar] [CrossRef]
- García-Sancha, N.; Corchado-Cobos, R.; Pérez-Losada, J.; Cañueto, J. MicroRNA Dysregulation in Cutaneous Squamous Cell Carcinoma. Int. J. Mol. Sci. 2019, 20, 2181. [Google Scholar] [CrossRef] [Green Version]
- Neagu, M.; Constantin, C.; Cretoiu, S.M.; Zurac, S. miRNAs in the Diagnosis and Prognosis of Skin Cancer. Front. Cell Dev. Biol. 2020, 8, 71. [Google Scholar] [CrossRef] [Green Version]
- Dańczak-Pazdrowska, A.; Pazdrowski, J.; Polańska, A.; Basta, B.; Schneider, A.; Kowalczyk, M.J.; Golusiński, P.; Golusiński, W.; Adamski, Z.; Żaba, R.; et al. Profiling of microRNAs in actinic keratosis and cutaneous squamous cell carcinoma patients. Arch. Dermatol. Res. 2022, 314, 257–266. [Google Scholar] [CrossRef]
- Donà, M.G.; Chiantore, M.V.; Gheit, T.; Fiorucci, G.; Vescio, M.F.; La Rosa, G.; Accardi, L.; Costanzo, G.; Giuliani, M.; Romeo, G.; et al. Comprehensive analysis of β- and γ-human papillomaviruses in actinic keratosis and apparently healthy skin of elderly patients. Br. J. Dermatol. 2019, 181, 620–622. [Google Scholar] [CrossRef]
- Galati, L.; Brancaccio, R.N.; Robitaille, A.; Cuenin, C.; Luzi, F.; Fiorucci, G.; Chiantore, M.V.; Marascio, N.; Matera, G.; Liberto, M.C.; et al. Detection of human papillomaviruses in paired healthy skin and actinic keratosis by next generation sequencing. Papillomavirus Res. 2020, 9, 100196. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Wang, M.; Liu, Y.; Gui, Y. Synthesis of RNA-based gene regulatory devices for redirecting cellular signaling events mediated by p53. Theranostics 2021, 11, 4688–4698. [Google Scholar] [CrossRef] [PubMed]
- Lezina, L.; Aksenova, V.; Fedorova, O.; Malikova, D.; Shuvalov, O.; Antonov, A.V.; Tentler, D.; Garabadgiu, A.V.; Melino, G.; Barlev, N.A. KMT Set7/9 affects genotoxic stress response via the Mdm2 axis. Oncotarget 2015, 6, 25843–25855. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gutekunst, M.; Oren, M.; Weilbacher, A.; Dengler, M.A.; Markwardt, C.; Thomale, J.; Aulitzky, W.E.; van der Kuip, H. p53 hypersensitivity is the predominant mechanism of the unique responsiveness of testicular germ cell tumor (TGCT) cells to cisplatin. PLoS ONE 2011, 6, e19198. [Google Scholar] [CrossRef]
- Liu, G.; Zhao, H.; Ding, Q.; Li, H.; Liu, T.; Yang, H.; Liu, Y. CDK6 is stimulated by hyperthermia and protects gastric cancer cells from hyperthermia-induced damage. Mol. Med. Rep. 2021, 23, 1. [Google Scholar] [CrossRef]
- Yang, P.; Chen, W.; Li, X.; Eilers, G.; He, Q.; Liu, L.; Wu, Y.; Yu, W.; Fletcher, J.A.; Ou, W.B. Downregulation of cyclin D1 sensitizes cancer cells to MDM2 antagonist Nutlin-3. Oncotarget 2016, 7, 32652–32663. [Google Scholar] [CrossRef] [Green Version]
- Metsalu, T.; Vilo, J. ClustVis: A web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nucleic Acids Res. 2015, 43, W566–W570. [Google Scholar] [CrossRef]
- Sand, M.; Hessam, S.; Amur, S.; Skrygan, M.; Bromba, M.; Stockfleth, E.; Gambichler, T.; Bechara, F.G. Expression of oncogenic miR-17-92 and tumor suppressive miR-143-145 clusters in basal cell carcinoma and cutaneous squamous cell carcinoma. J. Dermatol. Sci. 2017, 86, 142–148. [Google Scholar] [CrossRef] [Green Version]
- Mizrahi, A.; Barzilai, A.; Gur-Wahnon, D.; Ben-Dov, I.Z.; Glassberg, S.; Meningher, T.; Elharar, E.; Masalha, M.; Jacob-Hirsch, J.; Tabibian-Keissar, H.; et al. Alterations of microRNAs throughout the malignant evolution of cutaneous squamous cell carcinoma: The role of miR-497 in epithelial to mesenchymal transition of keratinocytes. Oncogene 2018, 37, 218–230. [Google Scholar] [CrossRef]
- Tamas, T.; Baciut, M.; Nutu, A.; Bran, S.; Armencea, G.; Stoia, S.; Manea, A.; Crisan, L.; Opris, H.; Onisor, F.; et al. Is miRNA Regulation the Key to Controlling Non-Melanoma Skin Cancer Evolution? Genes 2021, 12, 1929. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Li, Z. The role of miRNAs in cutaneous squamous cell carcinoma. J. Cell Mol. Med. 2016, 20, 3–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lohcharoenkal, W.; Harada, M.; Lovén, J.; Meisgen, F.; Landén, N.X.; Zhang, L.; Lapins, J.; Mahapatra, K.D.; Shi, H.; Nissinen, L.; et al. MicroRNA-203 Inversely Correlates with Differentiation Grade, Targets c-MYC, and Functions as a Tumor Suppressor in cSCC. J. Investig. Dermatol. 2016, 136, 2485–2494. [Google Scholar] [CrossRef] [Green Version]
- Tian, J.; Shen, R.; Yan, Y.; Deng, L. miR-186 promotes tumor growth in cutaneous squamous cell carcinoma by inhibiting apoptotic protease activating factor-1. Exp. Ther. Med. 2018, 16, 4010–4018. [Google Scholar] [CrossRef]
- Colak, S.; Ten Dijke, P. Targeting TGF-β Signaling in Cancer. Trends Cancer 2017, 3, 56–71. [Google Scholar] [CrossRef] [PubMed]
- Cottonham, C.L.; Kaneko, S.; Xu, L. miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J. Biol. Chem. 2010, 285, 35293–35302. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z. ErbB Receptors and Cancer. Methods Mol. Biol. 2017, 1652, 3–35. [Google Scholar] [CrossRef]
- Mikami, T.; Kitagawa, H. Biosynthesis and function of chondroitin sulfate. Biochim. Biophys. Acta 2013, 1830, 4719–4733. [Google Scholar] [CrossRef]
- Yang, J.; Price, M.A.; Li, G.Y.; Bar-Eli, M.; Salgia, R.; Jagedeeswaran, R.; Carlson, J.H.; Ferrone, S.; Turley, E.A.; McCarthy, J.B. Melanoma proteoglycan modifies gene expression to stimulate tumor cell motility, growth, and epithelial-to-mesenchymal transition. Cancer Res. 2009, 69, 7538–7547. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.R.; Chen, M.; Pandolfi, P.P. The functions and regulation of the PTEN tumour suppressor: New modes and prospects. Nat. Rev. Mol. Cell Biol. 2018, 19, 547–562. [Google Scholar] [CrossRef]
- Li, J.; Yu, L.; Shen, Z.; Li, Y.; Chen, B.; Wei, W.; Chen, X.; Wang, Q.; Tong, F.; Lou, H.; et al. miR-34a and its novel target, NLRC5, are associated with HPV16 persistence. Infect. Genet. Evol. 2016, 44, 293–299. [Google Scholar] [CrossRef] [PubMed]
- Natarajan, S.K.; Stringham, B.A.; Mohr, A.M.; Wehrkamp, C.J.; Lu, S.; Phillippi, M.A.; Harrison-Findik, D.; Mott, J.L. FoxO3 increases miR-34a to cause palmitate-induced cholangiocyte lipoapoptosis. J. Lipid Res. 2017, 58, 866–875. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Wang, F.; Wu, Y.; Zuo, L.; Zhang, S.; Zhou, Q.; Wei, W.; Zhu, H. MicroRNA-126 attenuates palmitate-induced apoptosis by targeting TRAF7 in HUVECs. Mol. Cell. Biochem. 2015, 399, 123–130. [Google Scholar] [CrossRef]
- Chu, M.; Zhao, Y.; Feng, Y.; Zhang, H.; Liu, J.; Cheng, M.; Li, L.; Shen, W.; Cao, H.; Li, Q.; et al. MicroRNA-126 participates in lipid metabolism in mammary epithelial cells. Mol. Cell. Endocrinol. 2017, 454, 77–86. [Google Scholar] [CrossRef]
- Wang, J.J.; Zhang, Y.T.; Tseng, Y.J.; Zhang, J. miR-222 targets ACOX1, promotes triglyceride accumulation in hepatocytes. Hepatobiliary Pancreat. Dis. Int. 2019, 18, 360–365. [Google Scholar] [CrossRef] [PubMed]
- Lai, Y.H.; Liu, H.; Chiang, W.F.; Chen, T.W.; Chu, L.J.; Yu, J.S.; Chen, S.J.; Chen, H.C.; Tan, B.C. MiR-31-5p-ACOX1 Axis Enhances Tumorigenic Fitness in Oral Squamous Cell Carcinoma Via the Promigratory Prostaglandin E2. Theranostics 2018, 8, 486–504. [Google Scholar] [CrossRef]
- Qian, L.; Pi, L.; Fang, B.R.; Meng, X.X. Adipose mesenchymal stem cell-derived exosomes accelerate skin wound healing via the lncRNA H19/miR-19b/SOX9 axis. Lab. Investig. 2021, 101, 1254–1266. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.R.; Du, X.H.; Huang, T.T.; Zheng, Y.C.; Li, Y.L.; Huang, D.Y.; Dai, H.Q.; Li, E.M.; Fang, W.K. Role of Cell-Cell Junctions in Oesophageal Squamous Cell Carcinoma. Biomolecules 2022, 12, 1378. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Wang, H.; Xu, Y.; Li, C.; Lv, X.; Han, X.; Chen, X.; Chen, Y.; Yu, Z. The Role of CTNNA1 in Malignancies: An Updated Review. J. Cancer 2023, 14, 219–230. [Google Scholar] [CrossRef]
- Tommasino, M. HPV and skin carcinogenesis. Papillomavirus Res. 2019, 7, 129–131. [Google Scholar] [CrossRef] [PubMed]
- Chiantore, M.V.; Iuliano, M.; Mongiovì, R.M.; Dutta, S.; Tommasino, M.; Di Bonito, P.; Accardi, L.; Mangino, G.; Romeo, G. The E6 and E7 proteins of beta3 human papillomavirus 49 can deregulate both cellular and extracellular vesicles-carried microRNAs. Infect. Agent. Cancer 2022, 17, 29. [Google Scholar] [CrossRef] [PubMed]
- Chiantore, M.V.; Mangino, G.; Iuliano, M.; Capriotti, L.; Di Bonito, P.; Fiorucci, G.; Romeo, G. Human Papillomavirus and carcinogenesis: Novel mechanisms of cell communication involving extracellular vesicles. Cytokine Growth Factor. Rev. 2020, 51, 92–98. [Google Scholar] [CrossRef] [PubMed]
Gene | FWD 5′–3′ | REV 5′–3′ | Ref. |
---|---|---|---|
TP53 | CCTCAGCATCTTATCCGAGTGG | TGGATGGTGGTACAGTCAGAGC | [14] |
MDM2 | TGGGCAGCTTGAAGCAGTTG | CAGGCTGCCATGTGACCTAAGA | [15] |
CDKN1A | GGCAGACCAGCATGACAGATT | GCGGATTAGGGCTTCCTCTT | [16] |
CDK6 | GCTGACCAGCAGTACGAATG | GCACACATCAAACAACCTGACC | [17] |
CCND1 | CCGTCCATGCGGAAGATC | GAAGACCTCCTCCTCGCACT | [18] |
MicroRNAs | Accession Number | Fold Change | |
---|---|---|---|
1 | hsa-miR-16-5p | MIMAT0000069 | 238.911 |
2 | hsa-miR-150-5p | MIMAT0000451 | 177.837 |
3 | hsa-miR-494-3p | MIMAT0002816 | 177.398 |
4 | hsa-miR-31-5p | MIMAT0000089 | 177.057 |
5 | hsa-miR-203a-5p | MIMAT0031890 | 160.851 |
6 | hsa-miR-191-5p | MIMAT0000440 | 130.259 |
7 | hsa-let-7e-5p | MIMAT0000066 | 110.853 |
8 | hsa-miR-222-3p | MIMAT0000279 | 99.651 |
9 | hsa-miR-146a-5p | MIMAT0000449 | 85.494 |
10 | hsa-miR-19b-3p | MIMAT0000074 | 75.58 |
11 | hsa-miR-200c-3p | MIMAT0000617 | 58.549 |
12 | hsa-miR-320a | MIMAT0000510 | 56.054 |
13 | hsa-let-7b-5p | MIMAT0000063 | 51.857 |
14 | hsa-miR-24-3p | MIMAT0000080 | 48.505 |
15 | hsa-miR-374-5p | MIMAT0000727 | 48.309 |
16 | hsa-miR-126-3p | MIMAT0000445 | 47.816 |
17 | hsa-miR-422a | MIMAT0001339 | 44.507 |
18 | hsa-miR-146b-3p | MIMAT0004766 | 43.107 |
19 | hsa-miR-486-5p | MIMAT0002177 | 40.989 |
20 | hsa-miR-193b-3p | MIMAT0002819 | 40.612 |
21 | hsa-miR-454-3p | MIMAT0003885 | 34.13 |
22 | hsa-miR-484 | MIMAT0002174 | 24.427 |
23 | hsa-miR-186-5p | MIMAT0000456 | 23.968 |
24 | hsa-miR-504-5p | MIMAT0002875 | 20.504 |
25 | hsa-miR-342-3p | MIMAT0000753 | 19.67 |
26 | hsa-miR-487a-3p | MIMAT0002178 | 16.643 |
27 | hsa-miR-195-5p | MIMAT0000461 | 16.126 |
28 | hsa-miR-518f-3p | MIMAT0002842 | 15.495 |
29 | hsa-miR-200a-3p | MIMAT0000682 | 15.161 |
30 | hsa-miR-636 | MIMAT0003306 | 13.205 |
31 | hsa-miR-618 | MIMAT0003287 | 12.183 |
32 | hsa-miR-218-5p | MIMAT0000275 | 11.297 |
33 | hsa-miR-302c-3p | MIMAT0000717 | 7.095 |
34 | hsa-miR-214-3p | MIMAT0000271 | 3.675 |
35 | hsa-miR-145-5p | MIMAT0000437 | 3.417 |
36 | hsa-miR-519e-3p | MIMAT0002829 | 1.342 |
37 | hsa-miR-182-5p | MIMAT0000259 | 1.296 |
38 | hsa-miR-211-5p | MIMAT0000268 | 1.143 |
39 | hsa-miR-518b | MIMAT0002844 | 1.023 |
40 | hsa-miR-208b-3p | MIMAT0004960 | 0.272 |
41 | hsa-miR-34a-5p | MIMAT0000255 | 0.173 |
42 | hsa-miR-127-5p | MIMAT0004604 | 0.108 |
43 | hsa-miR-370-3p | MIMAT0000722 | 0.083 |
KEGG Pathway | p-Value | # Genes * | # miRNAs ** | |
---|---|---|---|---|
1. | TGF-beta signaling pathway (hsa04350) | 7.30 × 10−10 | 62 | 34 |
2. | Proteoglycans in cancer (hsa05205) | 7.30 × 10−10 | 136 | 36 |
3. | Pathways in cancer (hsa05200) | 3.36 × 10−9 | 251 | 37 |
4. | Adherens junction (hsa04520) | 1.84 × 10−8 | 58 | 35 |
5. | Axon guidance (hsa04360) | 1.84 × 10−8 | 91 | 37 |
6. | Hippo signaling pathway (hsa04390) | 2.70 × 10−7 | 99 | 37 |
7. | Fatty acid biosynthesis (hsa00061) | 1.62 × 10−6 | 7 | 12 |
8. | Ras signaling pathway (hsa04014) | 4.68 × 10−6 | 142 | 36 |
9. | ErbB signaling pathway (hsa04012) | 1.32 × 10−5 | 61 | 35 |
10. | Glioma (hsa05214) | 1.65 × 10−5 | 46 | 34 |
11. | Wnt signaling pathway (hsa04310) | 1.78 × 10−5 | 95 | 35 |
12. | Melanoma (hsa05218) | 3.69 × 10−5 | 53 | 32 |
13. | Signaling pathways regulating pluripotency of stem cells (hsa04550) | 3.69 × 10−5 | 94 | 37 |
14. | Rap1 signaling pathway (hsa04015) | 5.55 × 10−5 | 134 | 35 |
15. | GABAergic synapse (hsa04727) | 0.0001604280 | 54 | 35 |
16. | Thyroid hormone signaling pathway (hsa04919) | 0.0001726085 | 77 | 36 |
17. | Estrogen signaling pathway (hsa04915) | 0.0002032496 | 62 | 34 |
18. | MAPK signaling pathway (hsa04010) | 0.0002242160 | 160 | 37 |
19. | Renal cell carcinoma (hsa05211) | 0.0002295720 | 48 | 33 |
20. | Glycosaminoglycan biosynthesis—heparan sulfate/heparin (hsa00534) | 0.0005046348 | 18 | 21 |
21. | Choline metabolism in cancer (hsa05231) | 0.0005046348 | 69 | 34 |
22. | Neurotrophin signaling pathway (hsa04722) | 0.0005046348 | 81 | 37 |
23. | Focal adhesion (hsa04510) | 0.0007711823 | 129 | 36 |
24. | Glycosphingolipid biosynthesis—lacto and neolacto series (hsa00601) | 0.0009080097 | 17 | 19 |
25. | FoxO signaling pathway (hsa04068) | 0.0009080097 | 85 | 35 |
26. | Prostate cancer (hsa05215) | 0.0010195428 | 60 | 33 |
27. | Glutamatergic synapse (hsa04724) | 0.0020494968 | 71 | 34 |
28. | PI3K-Akt signaling pathway (hsa04151) | 0.0020578098 | 199 | 37 |
29. | Regulation of actin cytoskeleton (hsa04810) | 0.0032897905 | 131 | 35 |
30. | Amphetamine addiction (hsa05031) | 0.0033806984 | 43 | 28 |
31. | Thyroid hormone synthesis (hsa04918) | 0.0040209555 | 44 | 31 |
32. | Colorectal cancer (hsa05210) | 0.0040209555 | 42 | 33 |
33. | Oocyte meiosis (hsa04114) | 0.0040209555 | 72 | 35 |
34. | Prolactin signaling pathway (hsa04917) | 0.0043891560 | 47 | 33 |
35. | Insulin secretion (hsa04911) | 0.0052671844 | 56 | 35 |
36. | cAMP signaling pathway (hsa04024) | 0.0059360368 | 120 | 35 |
37. | Chronic myeloid leukemia (hsa05220) | 0.0060741359 | 48 | 35 |
38. | Pancreatic cancer (hsa05212) | 0.0066389106 | 45 | 32 |
39. | Thyroid cancer (hsa05216) | 0.0068643563 | 22 | 28 |
40. | Endometrial cancer (hsa05213) | 0.0078889298 | 35 | 31 |
41. | Phosphatidylinositol signaling system (hsa04070) | 0.0078889298 | 52 | 34 |
42. | Adrenergic signaling in cardiomyocytes (hsa04261) | 0.0078889298 | 89 | 34 |
43. | Vasopressin-regulated water reabsorption (hsa04962) | 0.0079518053 | 31 | 26 |
44. | Oxytocin signaling pathway (hsa04921) | 0.0081386021 | 99 | 35 |
45. | Non-small-cell lung cancer (hsa05223) | 0.0082341417 | 37 | 32 |
46. | cGMP-PKG signaling pathway (hsa04022) | 0.0082341417 | 100 | 36 |
47. | Transcriptional misregulation in cancer (hsa05202) | 0.0083247611 | 104 | 38 |
48. | Long-term potentiation (hsa04720) | 0.0097964993 | 45 | 32 |
49. | mTOR signaling pathway (hsa04150) | 0.0104774872 | 42 | 32 |
50. | Endocytosis (hsa04144) | 0.0105456910 | 121 | 36 |
51. | Long-term depression (hsa04730) | 0.011338320 | 39 | 32 |
52. | Viral carcinogenesis (hsa05203) | 0.011338320 | 102 | 36 |
53. | Vascular smooth muscle contraction (hsa04270) | 0.011568669 | 69 | 34 |
54. | Gap junction (hsa04540) | 0.015258034 | 51 | 35 |
55. | Ubiquitin mediated proteolysis (hsa04120) | 0.021158638 | 81 | 37 |
56. | Hepatitis B (hsa05161) | 0.021158638 | 84 | 37 |
57. | Biotin metabolism (hsa00780) | 0.022422627 | 2 | 4 |
58. | Morphine addiction (hsa05032) | 0.027484035 | 53 | 36 |
59. | Inflammatory mediator regulation of TRP channels (hsa04750) | 0.028782594 | 60 | 31 |
60. | N-Glycan biosynthesis (hsa00510) | 0.032645322 | 27 | 24 |
61. | Nicotine addiction (hsa05033) | 0.034469917 | 26 | 28 |
62. | Hedgehog signaling pathway (hsa04340) | 0.035921144 | 34 | 24 |
63. | Gastric acid secretion (hsa04971) | 0.036593705 | 48 | 34 |
64. | Melanogenesis (hsa04916) | 0.038811067 | 63 | 33 |
65. | Tight junction (hsa04530) | 0.038811067 | 81 | 37 |
66. | Bacterial invasion of epithelial cells (hsa05100) | 0.043438632 | 47 | 32 |
Gene | Fold Change | SD | p Value |
---|---|---|---|
TP53 | 39.946 | 3.603 | <0.001 |
MDM2 | 0.898 | 0.234 | 0.224 |
CDKN1A | 161.751 | 0.518 | <0.001 |
CDK6 | 3.371 | 1.417 | <0.001 |
CCND1 | 204.732 | 33.863 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chiantore, M.V.; Iuliano, M.; Mongiovì, R.M.; Luzi, F.; Mangino, G.; Grimaldi, L.; Accardi, L.; Fiorucci, G.; Romeo, G.; Di Bonito, P. MicroRNAs Differentially Expressed in Actinic Keratosis and Healthy Skin Scrapings. Biomedicines 2023, 11, 1719. https://doi.org/10.3390/biomedicines11061719
Chiantore MV, Iuliano M, Mongiovì RM, Luzi F, Mangino G, Grimaldi L, Accardi L, Fiorucci G, Romeo G, Di Bonito P. MicroRNAs Differentially Expressed in Actinic Keratosis and Healthy Skin Scrapings. Biomedicines. 2023; 11(6):1719. https://doi.org/10.3390/biomedicines11061719
Chicago/Turabian StyleChiantore, Maria Vincenza, Marco Iuliano, Roberta Maria Mongiovì, Fabiola Luzi, Giorgio Mangino, Lorenzo Grimaldi, Luisa Accardi, Gianna Fiorucci, Giovanna Romeo, and Paola Di Bonito. 2023. "MicroRNAs Differentially Expressed in Actinic Keratosis and Healthy Skin Scrapings" Biomedicines 11, no. 6: 1719. https://doi.org/10.3390/biomedicines11061719