A Novel Bifunctional Fusion Protein (Anti-IL-17A-sST2) Protects against Acute Liver Failure, Modulating the TLR4/MyD88 Pathway and NLRP3 Inflammasome Activation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Animals
2.3. Vector Construction, Protein Expression, and Purification
2.4. Size Exclusion Chromatography–High-Performance Liquid Chromatography (SEC-HPLC)
2.5. Thermal Stability Analysis
2.6. Surface Plasmon Resonance (SPR)
2.7. In Vitro Bioactivity Assay of IL-17A
2.8. In Vitro Bioactivity Assay of sST2-Fc
2.9. Serum Stability Analysis
2.10. Biochemical Analysis
2.11. Western Blot
2.12. RT-qPCR
2.13. Hematoxylin and Eosin (H&E) Staining
2.14. Immunohistochemistry (IHC) Assay
2.15. Statistical Analysis
3. Results
3.1. Generation and Characterization of the Fusion Protein of IL-17A Antibody and sST2
3.2. The Characterization and Bioactivity of the Fusion Protein
3.3. Anti-IL-17A-sST2 Ameliorated the Liver Injury Induced by LPS/D-GalN
3.4. Anti-IL-17A-sST2 Improved the Histopathological Changes and Reduced Inflammatory Factors
3.5. Anti-IL-17A-sST2 Decreased TLR4 Expression in the Liver
3.6. Anti-IL-17A-sST2 Suppressed NLRP3 Inflammasome Activation
3.7. Anti-IL-17A-sST2 Appeared No Significant Toxicity on the Main Organs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bernal, W.; Auzinger, G.; Dhawan, A.; Wendon, J. Acute liver failure. Lancet 2010, 376, 190–201. [Google Scholar] [CrossRef] [PubMed]
- Lefkowitch, J.H. The Pathology of Acute Liver Failure. Adv. Anat. Pathol. 2016, 23, 144–158. [Google Scholar] [CrossRef] [PubMed]
- Vento, S.; Cainelli, F. Acute liver failure. Lancet 2020, 395, 1833. [Google Scholar] [CrossRef] [PubMed]
- Stravitz, R.T.; Fontana, R.J.; Karvellas, C.; Durkalski, V.; McGuire, B.; Rule, J.A.; Tujios, S.; Lee, W.M.; for the Acute Liver Failure Study Group. Future directions in acute liver failure. Hepatology 2023, 78, 1266–1289. [Google Scholar] [CrossRef] [PubMed]
- Bernal, W.; Wendon, J. Acute liver failure. N. Engl. J. Med. 2013, 369, 2525–2534. [Google Scholar] [CrossRef] [PubMed]
- Bernal, W.; McPhail, M.J. Acute liver failure. J. Hepatol. 2021, 74, 1489–1490. [Google Scholar] [CrossRef]
- Shingina, A.; Mukhtar, N.; Wakim-Fleming, J.; Alqahtani, S.; Wong, R.J.; Limketkai, B.N.; Larson, A.M.; Grant, L. Acute Liver Failure Guidelines. Am. J. Gastroenterol. 2023, 118, 1128–1153. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yang, F.; Lu, H.; Wang, B.; Chen, Y.; Lei, D.; Wang, Y.; Zhu, B.; Li, L. Characterization of fecal microbial communities in patients with liver cirrhosis. Hepatology 2011, 54, 562–572. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Tang, R.; Li, B.; Ma, X.; Schnabl, B.; Tilg, H. Gut microbiome, liver immunology, and liver diseases. Cell Mol. Immunol. 2021, 18, 4–17. [Google Scholar] [CrossRef]
- Jaeschke, H.; Akakpo, J.Y.; Umbaugh, D.S.; Ramachandran, A. Novel Therapeutic Approaches Against Acetaminophen-induced Liver Injury and Acute Liver Failure. Toxicol. Sci. 2020, 174, 159–167. [Google Scholar] [CrossRef]
- Maes, M.; Vinken, M.; Jaeschke, H. Experimental models of hepatotoxicity related to acute liver failure. Toxicol. Appl. Pharmacol. 2015, 290, 86–97. [Google Scholar] [CrossRef] [PubMed]
- Dong, V.; Nanchal, R.; Karvellas, C.J. Pathophysiology of Acute Liver Failure. Nutr. Clin. Pract. 2019, 35, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Arvelo, M.B.; Cooper, J.T.; Longo, C.; Daniel, S.; Grey, S.T.; Mahiou, J.; Czismadia, E.; Abu-Jawdeh, G.; Ferran, C. A20 protects mice from D-galactosamine/lipopolysaccharide acute toxic lethal hepatitis. Hepatology 2002, 35, 535–543. [Google Scholar] [CrossRef]
- Zhao, E.; Ilyas, G.; Cingolani, F.; Choi, J.H.; Ravenelle, F.; Tanaka, K.E.; Czaja, M.J. Pentamidine Blocks Hepatotoxic Injury in Mice. Hepatology 2017, 66, 922–935. [Google Scholar] [CrossRef]
- Wu, Y.-H.; Hu, S.-Q.; Liu, J.; Cao, H.-C.; Xu, W.; Li, Y.-J.; Li, L.-J. Nature and mechanisms of hepatocyte apoptosis induced by D-galactosamine/lipopolysaccharide challenge in mice. Int. J. Mol. Med. 2014, 33, 1498–1506. [Google Scholar] [CrossRef] [PubMed]
- Hou, F.Q.; Wu, X.Y.; Gong, M.X.; Wei, J.J.; Yi, Y.; Wei, Y.; He, Z.X.; Gong, Q.H.; Gao, J.M. Trilobatin rescues fulminant hepatic failure by targeting COX2: Involvement of ROS/TLR4/NLRP3 signaling. Phytomedicine 2023, 120, 155059. [Google Scholar] [CrossRef]
- Wu, J.; Zhao, Y.; Park, Y.K.; Lee, J.Y.; Gao, L.; Zhao, J.; Wang, L. Loss of PDK4 switches the hepatic NF-κB/TNF pathway from pro-survival to pro-apoptosis. Hepatology 2018, 68, 1111–1124. [Google Scholar] [CrossRef]
- Schmitz, J.; Owyang, A.; Oldham, E.; Song, Y.; Murphy, E.; McClanahan, T.K.; Zurawski, G.; Moshrefi, M.; Qin, J.; Li, X.; et al. IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity 2005, 23, 479–490. [Google Scholar] [CrossRef]
- Rank, M.A.; Kobayashi, T.; Kozaki, H.; Bartemes, K.R.; Squillace, D.L.; Kita, H. IL-33–activated dendritic cells induce an atypical TH2-type response. J. Allergy Clin. Immunol. 2009, 123, 1047–1054. [Google Scholar] [CrossRef]
- Liew, F.Y.; Pitman, N.I.; McInnes, I.B. Disease-associated functions of IL-33: The new kid in the IL-1 family. Nat. Rev. Immunol. 2010, 10, 103–110. [Google Scholar] [CrossRef]
- Fattori, V.; Borghi, S.M.; Verri, W.A. IL-33/ST2 signaling boosts inflammation and pain. Proc. Natl. Acad. Sci. USA 2017, 114, E10034–E10035. [Google Scholar] [CrossRef] [PubMed]
- Sanada, S.; Hakuno, D.; Higgins, L.J.; Schreiter, E.R.; McKenzie, A.N.; Lee, R.T. IL-33 and ST2 comprise a critical biomechanically induced and cardioprotective signaling system. J. Clin. Investig. 2007, 117, 1538–1549. [Google Scholar] [CrossRef] [PubMed]
- Milovanovic, M.; Volarevic, V.; Radosavljevic, G.; Jovanovic, I.; Pejnovic, N.; Arsenijevic, N.; Lukic, M.L. IL-33/ST2 axis in inflammation and immunopathology. Immunol. Res. 2012, 52, 89–99. [Google Scholar] [CrossRef] [PubMed]
- Oshikawa, K.; Yanagisawa, K.; Tominaga, S.; Sugiyama, Y. Expression and function of the ST2 gene in a murine model of allergic airway inflammation. Clin. Exp. Allergy 2002, 32, 1520–1526. [Google Scholar] [CrossRef] [PubMed]
- Pei, C.; Barbour, M.; Fairlie-Clarke, K.J.; Allan, D.; Mu, R.; Jiang, H. Emerging role of interleukin-33 in autoimmune diseases. Immunology 2013, 141, 9–17. [Google Scholar] [CrossRef]
- Nagata, A.; Takezako, N.; Tamemoto, H.; Ohto-Ozaki, H.; Ohta, S.; Tominaga, S.-I.; Yanagisawa, K. Soluble ST2 protein inhibits LPS stimulation on monocyte-derived dendritic cells. Cell. Mol. Immunol. 2012, 9, 399–409. [Google Scholar] [CrossRef] [PubMed]
- Sweet, M.J.; Leung, B.P.; Kang, D.; Sogaard, M.; Schulz, K.; Trajkovic, V.; Campbell, C.C.; Xu, D.; Liew, F.Y. A novel pathway regulating lipopolysaccharide-induced shock by ST2/T1 via inhibition of Toll-like receptor 4 expression. J. Immunol. 2001, 166, 6633–6639. [Google Scholar] [CrossRef]
- Takezako, N.; Hayakawa, M.; Hayakawa, H.; Aoki, S.; Yanagisawa, K.; Endo, H.; Tominaga, S.I. ST2 suppresses IL-6 production via the inhibition of IkappaB degradation induced by the LPS signal in THP-1 cells. Biochem. Biophys. Res. Commun. 2006, 341, 425–432. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Turnquist, H.R.; Hoffman, R.; Billiar, T.R. Role of the IL-33-ST2 axis in sepsis. Mil. Med. Res. 2017, 4, 3. [Google Scholar] [CrossRef]
- Yang, M.; Wang, Y.; Zhang, Y.; Li, Y.; Li, Q.; Tan, J. Role of Interleukin-33 in Staphylococcus epidermidis-Induced Septicemia. Front. Immunol. 2020, 11, 534099. [Google Scholar] [CrossRef]
- Cannavò, S.P.; Bertino, L.; Di Salvo, E.; Papaianni, V.; Ventura-Spagnolo, E.; Gangemi, S. Possible Roles of IL-33 in the Innate-Adaptive Immune Crosstalk of Psoriasis Pathogenesis. Mediat. Inflamm. 2019, 2019, 7158014. [Google Scholar] [CrossRef] [PubMed]
- Vocca, L.; Di Sano, C.; Uasuf, C.G.; Sala, A.; Riccobono, L.; Gangemi, S.; Albano, G.D.; Bonanno, A.; Gagliardo, R.; Profita, M. IL-33/ST2 axis controls Th2/IL-31 and Th17 immune response in allergic airway diseases. Immunobiology 2015, 220, 954–963. [Google Scholar] [CrossRef]
- Moseley, T.; Haudenschild, D.; Rose, L.; Reddi, A. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 2003, 14, 155–174. [Google Scholar] [CrossRef]
- Cua, D.J.; Tato, C.M. Innate IL-17-producing cells: The sentinels of the immune system. Nat. Rev. Immunol. 2010, 10, 479–489. [Google Scholar] [CrossRef] [PubMed]
- Schwandner, R.; Yamaguchi, K.; Cao, Z. Requirement of tumor necrosis factor receptor-associated factor (TRAF)6 in interleukin 17 signal transduction. J. Exp. Med. 2000, 191, 1233–1240. [Google Scholar] [CrossRef]
- Ge, Y.; Huang, M.; Yao, Y.-M. Biology of Interleukin-17 and Its Pathophysiological Significance in Sepsis. Front. Immunol. 2020, 11, 1558. [Google Scholar] [CrossRef]
- Amatya, N.; Garg, A.V.; Gaffen, S.L. IL-17 Signaling: The Yin and the Yang. Trends Immunol. 2017, 38, 310–322. [Google Scholar] [CrossRef]
- Fossiez, F.; Djossou, O.; Chomarat, P.; Flores-Romo, L.; Ait-Yahia, S.; Maat, C.; Pin, J.J.; Garrone, P.; Garcia, E.; Saeland, S.; et al. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med. 1996, 183, 2593–2603. [Google Scholar] [CrossRef]
- Han, L.; Shi, C.; Zeng, X.; Cen, L.; Mei, X.; Fan, J.; Ju, D.; Zhu, H. A Novel Bifunctional Fusion Protein, Vunakizumab-IL22, for Protection Against Pulmonary Immune Injury Caused by Influenza Virus. Front. Immunol. 2021, 12, 7941. [Google Scholar] [CrossRef]
- Shi, C.; Su, C.; Cen, L.; Han, L.; Tang, J.; Wang, Z.; Shi, X.; Ju, D.; Cao, Y.; Zhu, H. Vunakizumab-IL22, a Novel Fusion Protein, Promotes Intestinal Epithelial Repair and Protects against Gut Injury Induced by the Influenza Virus. Biomedicines 2023, 11, 1160. [Google Scholar] [CrossRef]
- Leung, B.P.; Xu, D.; Culshaw, S.; McInnes, I.B.; Liew, F.Y. A novel therapy of murine collagen-induced arthritis with soluble T1/ST2. J. Immunol. 2004, 173, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Meng, F.; Wang, K.; Aoyama, T.; Grivennikov, S.I.; Paik, Y.; Scholten, D.; Cong, M.; Iwaisako, K.; Liu, X.; Zhang, M.; et al. Interleukin-17 signaling in inflammatory, kupffer cells, and hepatic stellate cells exacerbates liver fibrosis in mice. Gastroenterology 2012, 143, 765–776. [Google Scholar] [CrossRef] [PubMed]
- Ogura, H.; Murakami, M.; Okuyama, Y.; Tsuruoka, M.; Kitabayashi, C.; Kanamoto, M.; Nishihara, M.; Iwakura, Y.; Hirano, T. Interleukin-17 promotes autoimmunity by triggering a positive-feedback loop via interleukin-6 induction. Immunity 2008, 29, 628–636. [Google Scholar] [CrossRef]
- Farouk, S.; Sabet, S.; Abu Zahra, F.A.; El-Ghor, A.A. Bone marrow derived-mesenchymal stem cells downregulate IL17A dependent IL6/STAT3 signaling pathway in CCl4-induced rat liver fibrosis. PLoS ONE 2018, 13, e0206130. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; He, G.-Z.; Wang, Y.-K.; Zhu, Q.-K.; Chen, W.; Guo, T. TLR4-HMGB1-, MyD88- and TRIF-dependent signaling in mouse intestinal ischemia/reperfusion injury. World J. Gastroenterol. 2015, 21, 8314–8325. [Google Scholar] [CrossRef]
- Schroder, K.; Tschopp, J. The inflammasomes. Cell 2010, 140, 821–832. [Google Scholar] [CrossRef]
- Gupta, R.K.; Gupta, K.; Dwivedi, P.D. Pathophysiology of IL-33 and IL-17 in allergic disorders. Cytokine Growth Factor Rev. 2017, 38, 22–36. [Google Scholar] [CrossRef]
- Liu, X.; Xiao, Y.; Pan, Y.; Li, H.; Zheng, S.G.; Su, W. The role of the IL-33/ST2 axis in autoimmune disorders: Friend or foe? Cytokine Growth Factor Rev. 2019, 50, 60–74. [Google Scholar] [CrossRef]
- Carriere, V.; Roussel, L.; Ortega, N.; Lacorre, D.A.; Americh, L.; Aguilar, L.; Bouche, G.; Girard, J.P. IL-33, the IL-1-like cytokine ligand for ST2 receptor, is a chromatin-associated nuclear factor in vivo. Proc. Natl. Acad. Sci. USA 2007, 104, 282–287. [Google Scholar] [CrossRef] [PubMed]
- Shao, D.; Perros, F.; Caramori, G.; Meng, C.; Dormuller, P.; Chou, P.-C.; Church, C.; Papi, A.; Casolari, P.; Welsh, D.; et al. Nuclear IL-33 regulates soluble ST2 receptor and IL-6 expression in primary human arterial endothelial cells and is decreased in idiopathic pulmonary arterial hypertension. Biochem. Biophys. Res. Commun. 2014, 451, 8–14. [Google Scholar] [CrossRef]
- Oboki, K.; Nakae, S.; Matsumoto, K.; Saito, H. IL-33 and Airway Inflammation. Allergy Asthma Immunol. Res. 2011, 3, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Kakkar, R.; Lee, R.T. The IL-33/ST2 pathway: Therapeutic target and novel biomarker. Nat. Rev. Drug Discov. 2008, 7, 827–840. [Google Scholar] [CrossRef] [PubMed]
- Mizutani, N.; Nabe, T.; Yoshino, S. IL-17A promotes the exacerbation of il-33–induced airway hyperresponsiveness by enhancing neutrophilic inflammation via cxcr2 signaling in mice. J. Immunol. 2014, 192, 1372–1384. [Google Scholar] [CrossRef] [PubMed]
- de Morales, J.M.G.R.; Puig, L.; Daudén, E.; Cañete, J.D.; Pablos, J.L.; Martín, A.O.; Juanatey, C.G.; Adán, A.; Montalbán, X.; Borruel, N.; et al. Critical role of interleukin (IL)-17 in inflammatory and immune disorders: An updated review of the evidence focusing in controversies. Autoimmun. Rev. 2019, 19, 102429. [Google Scholar] [CrossRef] [PubMed]
- Wynn, J.L.; Wilson, C.S.; Hawiger, J.; Scumpia, P.O.; Marshall, A.F.; Liu, J.-H.; Zharkikh, I.; Wong, H.R.; Lahni, P.; Benjamin, J.T.; et al. Targeting IL-17A attenuates neonatal sepsis mortality induced by IL-18. Proc. Natl. Acad. Sci. USA 2016, 113, E2627–E2635. [Google Scholar] [CrossRef] [PubMed]
- Morrow, K.N.; Coopersmith, C.M.; Ford, M.L. IL-17, IL-27, and IL-33: A Novel Axis Linked to Immunological Dysfunction During Sepsis. Front. Immunol. 2019, 10, 1982. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Yuan, Z.; Zhu, Y.; Yuan, Z.; Wang, J.; Nong, C.; Zhou, S.; Tang, Q.; Zhang, L.; Jiang, Z.; et al. Th17/Treg imbalance mediates hepatic intolerance to exogenous lipopolysaccharide and exacerbates liver injury in triptolide induced excessive immune response. J. Ethnopharmacol. 2022, 295, 115422. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Tang, H.; Guo, J.; Qiu, X.; Yang, Z.; Ren, Z.; Sun, Z.; Bian, Y.; Xu, L.; Xu, H.; et al. Targeting IFNα to tumor by anti-PD-L1 creates feedforward antitumor responses to overcome checkpoint blockade resistance. Nat. Commun. 2018, 9, 4586. [Google Scholar] [CrossRef] [PubMed]
- Engelmann, C.; Sheikh, M.; Sharma, S.; Kondo, T.; Loeffler-Wirth, H.; Zheng, Y.B.; Novelli, S.; Hall, A.; Kerbert, A.J.; Macnaughtan, J.; et al. Toll-like receptor 4 is a therapeutic target for prevention and treatment of liver failure. J. Hepatol. 2020, 73, 102–112. [Google Scholar] [CrossRef]
- Shah, N.; de Oca, M.M.; Jover-Cobos, M.; Tanamoto, K.-I.; Muroi, M.; Sugiyama, K.-I.; Davies, N.A.; Mookerjee, R.P.; Dhar, D.K.; Jalan, R. Role of toll-like receptor 4 in mediating multiorgan dysfunction in mice with acetaminophen induced acute liver failure. Liver Transplant. 2013, 19, 751–761. [Google Scholar] [CrossRef]
- Gehrke, N.; Hövelmeyer, N.; Waisman, A.; Straub, B.K.; Weinmann-Menke, J.; Wörns, M.A.; Galle, P.R.; Schattenberg, J.M. Hepatocyte-specific deletion of IL1-RI attenuates liver injury by blocking IL-1 driven autoinflammation. J. Hepatol. 2018, 68, 986–995. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Tao, S.-S.; Wang, T.; Li, Y.-T.; Chen, H.; Zhan, Y.-Q.; Yu, M.; Ge, C.-H.; Li, C.-Y.; Ren, G.-M.; et al. NLRP3 is dispensable for d-galactosamine/lipopolysaccharide-induced acute liver failure. Biochem. Biophys. Res. Commun. 2020, 533, 1184–1190. [Google Scholar] [CrossRef] [PubMed]
- Zhan, C.; Lin, G.; Huang, Y.; Wang, Z.; Zeng, F.; Wu, S. A dopamine-precursor-based nanoprodrug for in-situ drug release and treatment of acute liver failure by inhibiting NLRP3 inflammasome and facilitating liver regeneration. Biomaterials 2020, 268, 120573. [Google Scholar] [CrossRef]
Primer | Sequence (5′→3′) |
---|---|
sST2-F | AGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGATCTAGCAAGAGCTCTTGGGGCC |
sST2-R | GAGGTCGAGGTCGGGGGATCCCTACTACCGGTGGTCGATAGGCTG |
IL-17A-F | AAACGGATCTCTAGCGAATTCG |
IL-17A-R | TTCCTCCTCCTCCGCTTCCTCCTCCTCCTCCCAGAGACAGAGACAGGCTCTTCTGG |
Primer | Sequence Forward | Sequence Reverse |
---|---|---|
GAPDH | GTCCTCAGTGTAGCCCAAGATG | CAATGTGTCCGTCGTGGATCT |
TNF-α | GCCACCACGCTCTTCTGTCT | GGTCTGGGCCATAGAACTGATG |
IL-6 | CTCATTCTGCTCTGGAGCCC | TGCCATTGCACAACTCTTTTCT |
NLRP3 | CCCTTGGAGACACAGGACTC | GAGGCTGCAGTTGTCTAATTCC |
IL-1β | ACCTGTGTCTTTCCCGTGG | TCATCTCGGAGCCTGTAGTG |
Sample | Tm1 (°C) | Tonset (°C) | Tm2 (°C) | Tagg 266 (°C) | Tagg 473 (°C) |
---|---|---|---|---|---|
anti-IL-17A-sST2 | 68.41 | 57.95 | 78.24 | 67.67 | 66.65 |
anti-IL-17A | 72.01 | 61.83 | / | 65.76 | 69.49 |
sST2-Fc | 81.10 | 68.79 | / | 73.31 | 70.89 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, Y.; Zhou, R.; Xie, X.; Zhu, A.; Nan, Y.; Wu, T.; Hu, X.; Cao, Z.; Ju, D.; Fan, J. A Novel Bifunctional Fusion Protein (Anti-IL-17A-sST2) Protects against Acute Liver Failure, Modulating the TLR4/MyD88 Pathway and NLRP3 Inflammasome Activation. Biomedicines 2024, 12, 1118. https://doi.org/10.3390/biomedicines12051118
Bai Y, Zhou R, Xie X, Zhu A, Nan Y, Wu T, Hu X, Cao Z, Ju D, Fan J. A Novel Bifunctional Fusion Protein (Anti-IL-17A-sST2) Protects against Acute Liver Failure, Modulating the TLR4/MyD88 Pathway and NLRP3 Inflammasome Activation. Biomedicines. 2024; 12(5):1118. https://doi.org/10.3390/biomedicines12051118
Chicago/Turabian StyleBai, Yu, Rongrui Zhou, Xinlei Xie, An Zhu, Yanyang Nan, Tao Wu, Xiaozhi Hu, Zhonglian Cao, Dianwen Ju, and Jiajun Fan. 2024. "A Novel Bifunctional Fusion Protein (Anti-IL-17A-sST2) Protects against Acute Liver Failure, Modulating the TLR4/MyD88 Pathway and NLRP3 Inflammasome Activation" Biomedicines 12, no. 5: 1118. https://doi.org/10.3390/biomedicines12051118