Optimization of a Tricalcium Phosphate-Based Bone Model Using Cell-Sheet Technology to Simulate Bone Disorders
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bone Marrow-Derived MSC Isolation and Cultivation
2.2. Fabrication of 3D Bone Models: β-TCP Wrapped with an Osteogenically Induced MSC Sheet
2.3. Live/Dead Staining
2.4. TUNEL Assay
2.5. Scanning Electron Microscopy (SEM)
2.6. (Immun)Histochemistry
2.7. Immunofluorescence Staining
2.8. Gene Expression Analysis
2.9. Statistical Analysis
3. Results
3.1. MSC-Based Cell-Sheet Wrapping Enhanced Survival Rate of MSCs Seeded on β-TCP
3.2. CsTCPs Exhibit Higher MSC Seeding Density than Unwrapped Pre-Seeded TCPs
3.3. Sheet Technology Slightly Enhance Osteogenic Tissue Formation In Vitro
3.4. Deferoxamine Promotes Osteogenesis In Vitro
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alonzo, M.; Primo, F.A.; Kumar, S.A.; Mudloff, J.A.; Dominguez, E.; Fregoso, G.; Ortiz, N.; Weiss, W.M.; Joddar, B. Bone tissue engineering techniques, advances and scaffolds for treatment of bone defects. Curr. Opin. Biomed. Eng. 2021, 17, 100248. [Google Scholar] [CrossRef] [PubMed]
- Pfeiffenberger, M.; Damerau, A.; Lang, A.; Buttgereit, F.; Hoff, P.; Gaber, T. Fracture Healing Research-Shift towards In Vitro Modeling? Biomedicines 2021, 9, 748. [Google Scholar] [CrossRef] [PubMed]
- Einhorn, T.A.; Gerstenfeld, L.C. Fracture healing: Mechanisms and interventions. Nat. Rev. Rheumatol 2015, 11, 45–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collaborators, G.B.D.F. Global, regional, and national burden of bone fractures in 204 countries and territories, 1990–2019: A systematic analysis from the Global Burden of Disease Study 2019. Lancet Healthy Longev. 2021, 2, e580–e592. [Google Scholar] [CrossRef]
- Salari, N.; Darvishi, N.; Bartina, Y.; Larti, M.; Kiaei, A.; Hemmati, M.; Shohaimi, S.; Mohammadi, M. Global prevalence of osteoporosis among the world older adults: A comprehensive systematic review and meta-analysis. J. Orthop. Surg. Res. 2021, 16, 669. [Google Scholar] [CrossRef]
- Banaszkiewicz, P.A.; Kader, D.F. Classic Papers in Orthopaedics; Springer: London, UK, 2014; p. 624. [Google Scholar]
- Zhu, G.; Zhang, T.; Chen, M.; Yao, K.; Huang, X.; Zhang, B.; Li, Y.; Liu, J.; Wang, Y.; Zhao, Z. Bone physiological microenvironment and healing mechanism: Basis for future bone-tissue engineering scaffolds. Bioact. Mater. 2021, 6, 4110–4140. [Google Scholar] [CrossRef] [PubMed]
- Roddy, E.; DeBaun, M.R.; Daoud-Gray, A.; Yang, Y.P.; Gardner, M.J. Treatment of critical-sized bone defects: Clinical and tissue engineering perspectives. Eur. J. Orthop. Surg. Traumatol. 2018, 28, 351–362. [Google Scholar] [CrossRef]
- Leenaars, C.H.C.; Kouwenaar, C.; Stafleu, F.R.; Bleich, A.; Ritskes-Hoitinga, M.; De Vries, R.B.M.; Meijboom, F.L.B. Animal to human translation: A systematic scoping review of reported concordance rates. J. Transl. Med. 2019, 17, 223. [Google Scholar] [CrossRef] [Green Version]
- Bracken, M.B. Why animal studies are often poor predictors of human reactions to exposure. J. R. Soc. Med. 2009, 102, 120–122. [Google Scholar] [CrossRef] [Green Version]
- Fong, E.L.S.; Toh, T.B.; Yu, H.; Chow, E.K. 3D Culture as a Clinically Relevant Model for Personalized Medicine. SLAS Technol. 2017, 22, 245–253. [Google Scholar] [CrossRef] [Green Version]
- Mestas, J.; Hughes, C.C. Of mice and not men: Differences between mouse and human immunology. J. Immunol. 2004, 172, 2731–2738. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seok, J.; Warren, H.S.; Cuenca, A.G.; Mindrinos, M.N.; Baker, H.V.; Xu, W.; Richards, D.R.; McDonald-Smith, G.P.; Gao, H.; Hennessy, L.; et al. Genomic responses in mouse models poorly mimic human inflammatory diseases. Proc. Natl. Acad. Sci. USA 2013, 110, 3507–3512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scheinpflug, J.; Pfeiffenberger, M.; Damerau, A.; Schwarz, F.; Textor, M.; Lang, A.; Schulze, F. Journey into Bone Models: A Review. Genes 2018, 9, 247. [Google Scholar] [CrossRef] [Green Version]
- Roseti, L.; Parisi, V.; Petretta, M.; Cavallo, C.; Desando, G.; Bartolotti, I.; Grigolo, B. Scaffolds for Bone Tissue Engineering: State of the art and new perspectives. Mater. Sci. Eng. C Mater. Biol. Appl. 2017, 78, 1246–1262. [Google Scholar] [CrossRef] [PubMed]
- Yorukoglu, A.C.; Kiter, A.E.; Akkaya, S.; Satiroglu-Tufan, N.L.; Tufan, A.C. A Concise Review on the Use of Mesenchymal Stem Cells in Cell Sheet-Based Tissue Engineering with Special Emphasis on Bone Tissue Regeneration. Stem Cells Int. 2017, 2017, 2374161. [Google Scholar] [CrossRef]
- Owaki, T.; Shimizu, T.; Yamato, M.; Okano, T. Cell sheet engineering for regenerative medicine: Current challenges and strategies. Biotechnol. J. 2014, 9, 904–914. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.B.; Suzuki, R.K.; Sand, T.T.; Chaput, C.D.; Gregory, C.A. Short Term Culture of Human Mesenchymal Stem Cells with Commercial Osteoconductive Carriers Provides Unique Insights into Biocompatibility. J. Clin. Med. 2013, 2, 49–66. [Google Scholar] [CrossRef] [Green Version]
- Lomelino Rde, O.; Castro, S., II; Linhares, A.B.; Alves, G.G.; Santos, S.R.; Gameiro, V.S.; Rossi, A.M.; Granjeiro, J.M. The association of human primary bone cells with biphasic calcium phosphate (βTCP/HA 70:30) granules increases bone repair. J. Mater. Sci. Mater. Med. 2012, 23, 781–788. [Google Scholar] [CrossRef]
- Bernhardt, A.; Lode, A.; Peters, F.; Gelinsky, M. Optimization of culture conditions for osteogenically-induced mesenchymal stem cells in β-tricalcium phosphate ceramics with large interconnected channels. J. Tissue Eng. Regen. Med. 2011, 5, 444–453. [Google Scholar] [CrossRef]
- Shimizu, T.; Yamato, M.; Kikuchi, A.; Okano, T. Cell sheet engineering for myocardial tissue reconstruction. Biomaterials 2003, 24, 2309–2316. [Google Scholar] [CrossRef]
- Yang, J.; Yamato, M.; Kohno, C.; Nishimoto, A.; Sekine, H.; Fukai, F.; Okano, T. Cell sheet engineering: Recreating tissues without biodegradable scaffolds. Biomaterials 2005, 26, 6415–6422. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takezawa, T.; Mori, Y.; Yoshizato, K. Cell culture on a thermo-responsive polymer surface. Biotechnology 1990, 8, 854–856. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Ma, J.; Gao, Y.; Yang, L. Cell sheet technology: A promising strategy in regenerative medicine. Cytotherapy 2019, 21, 3–16. [Google Scholar] [CrossRef] [PubMed]
- Moschouris, K.; Firoozi, N.; Kang, Y. The application of cell sheet engineering in the vascularization of tissue regeneration. Regen. Med. 2016, 11, 559–570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, D.; Yao, H.; Tian, W.; Chen, F.; Liu, Y.; Mao, T.; Ren, L. Enhancing bone formation by transplantation of a scaffold-free tissue-engineered periosteum in a rabbit model. Clin. Oral Implants Res. 2011, 22, 1193–1199. [Google Scholar] [CrossRef] [PubMed]
- Gao, Z.; Chen, F.; Zhang, J.; He, L.; Cheng, X.; Ma, Q.; Mao, T. Vitalisation of tubular coral scaffolds with cell sheets for regeneration of long bones: A preliminary study in nude mice. Br. J. Oral Maxillofac. Surg. 2009, 47, 116–122. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Zhou, Y.; Barnabas, S.T.; Woodruff, M.A.; Hutmacher, D.W. Engineering tubular bone constructs. J. Biomech. 2007, 40 (Suppl. S1), S73–S79. [Google Scholar] [CrossRef] [Green Version]
- Probst, F.A.; Fliefel, R.; Burian, E.; Probst, M.; Eddicks, M.; Cornelsen, M.; Riedl, C.; Seitz, H.; Aszodi, A.; Schieker, M.; et al. Bone regeneration of minipig mandibular defect by adipose derived mesenchymal stem cells seeded tri-calcium phosphate- poly(D,L-lactide-co-glycolide) scaffolds. Sci. Rep. 2020, 10, 2062. [Google Scholar] [CrossRef]
- Ullah, I.; Subbarao, R.B.; Rho, G.J. Human mesenchymal stem cells—Current trends and future prospective. Biosci. Rep. 2015, 35, e00191. [Google Scholar] [CrossRef]
- Bartholomew, A.; Sturgeon, C.; Siatskas, M.; Ferrer, K.; McIntosh, K.; Patil, S.; Hardy, W.; Devine, S.; Ucker, D.; Deans, R.; et al. Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Exp. Hematol. 2002, 30, 42–48. [Google Scholar] [CrossRef]
- Di Nicola, M.; Carlo-Stella, C.; Magni, M.; Milanesi, M.; Longoni, P.D.; Matteucci, P.; Grisanti, S.; Gianni, A.M. Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002, 99, 3838–3843. [Google Scholar] [CrossRef] [PubMed]
- Stagg, J. Immune regulation by mesenchymal stem cells: Two sides to the coin. Tissue Antigens 2007, 69, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Ansari, S.; Ito, K.; Hofmann, S. Cell Sources for Human In vitro Bone Models. Curr. Osteoporos. Rep. 2021, 19, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.; Ren, L.; Yang, Y. Engineering vascularized bone grafts by integrating a biomimetic periosteum and β-TCP scaffold. ACS Appl. Mater. Interfaces 2014, 6, 9622–9633. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhou, Y.; Zhang, W.; Wang, K.; Xu, L.; Ma, H.; Deng, Y. Construction of vascularized tissue-engineered bone with a double-cell sheet complex. Acta Biomater. 2018, 77, 212–227. [Google Scholar] [CrossRef] [PubMed]
- Damerau, A.; Pfeiffenberger, M.; Weber, M.C.; Burmester, G.R.; Buttgereit, F.; Gaber, T.; Lang, A. A Human Osteochondral Tissue Model Mimicking Cytokine-Induced Key Features of Arthritis In Vitro. Int. J. Mol. Sci 2020, 22, 128. [Google Scholar] [CrossRef] [PubMed]
- Wan, C.; Gilbert, S.R.; Wang, Y.; Cao, X.; Shen, X.; Ramaswamy, G.; Jacobsen, K.A.; Alaql, Z.S.; Eberhardt, A.W.; Gerstenfeld, L.C.; et al. Activation of the hypoxia-inducible factor-1α pathway accelerates bone regeneration. Proc. Natl. Acad. Sci. USA 2008, 105, 686–691. [Google Scholar] [CrossRef] [Green Version]
- Donneys, A.; Ahsan, S.; Perosky, J.E.; Deshpande, S.S.; Tchanque-Fossuo, C.N.; Levi, B.; Kozloff, K.M.; Buchman, S.R. Deferoxamine restores callus size, mineralization, and mechanical strength in fracture healing after radiotherapy. Plast. Reconstr. Surg. 2013, 131, 711e–719e. [Google Scholar] [CrossRef] [Green Version]
- Donneys, A.; Nelson, N.S.; Page, E.E.; Deshpande, S.S.; Felice, P.A.; Tchanque-Fossuo, C.N.; Spiegel, J.P.; Buchman, S.R. Targeting angiogenesis as a therapeutic means to reinforce osteocyte survival and prevent nonunions in the aftermath of radiotherapy. Head Neck 2015, 37, 1261–1267. [Google Scholar] [CrossRef] [Green Version]
- Donneys, A.; Nelson, N.S.; Perosky, J.E.; Polyatskaya, Y.; Rodriguez, J.J.; Figueredo, C.; Vasseli, C.A.; Ratliff, H.C.; Deshpande, S.S.; Kozloff, K.M.; et al. Prevention of radiation-induced bone pathology through combined pharmacologic cytoprotection and angiogenic stimulation. Bone 2016, 84, 245–252. [Google Scholar] [CrossRef] [Green Version]
- Donneys, A.; Weiss, D.M.; Deshpande, S.S.; Ahsan, S.; Tchanque-Fossuo, C.N.; Sarhaddi, D.; Levi, B.; Goldstein, S.A.; Buchman, S.R. Localized deferoxamine injection augments vascularity and improves bony union in pathologic fracture healing after radiotherapy. Bone 2013, 52, 318–325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Drager, J.; Ramirez-Garcia Luna, J.L.; Kumar, A.; Gbureck, U.; Harvey, E.J.; Barralet, J.E. Hypoxia Biomimicry to Enhance Monetite Bone Defect Repair. Tissue Eng. Part A 2017, 23, 1372–1381. [Google Scholar] [CrossRef] [PubMed]
- Drager, J.; Sheikh, Z.; Zhang, Y.L.; Harvey, E.J.; Barralet, J.E. Local delivery of iron chelators reduces in vivo remodeling of a calcium phosphate bone graft substitute. Acta Biomater. 2016, 42, 411–419. [Google Scholar] [CrossRef] [PubMed]
- Farberg, A.S.; Jing, X.L.; Monson, L.A.; Donneys, A.; Tchanque-Fossuo, C.N.; Deshpande, S.S.; Buchman, S.R. Deferoxamine reverses radiation induced hypovascularity during bone regeneration and repair in the murine mandible. Bone 2012, 50, 1184–1187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guzey, S.; Aykan, A.; Ozturk, S.; Avsever, H.; Karslioglu, Y.; Ertan, A. The Effects of Desferroxamine on Bone and Bone Graft Healing in Critical-Size Bone Defects. Ann. Plast. Surg. 2016, 77, 560–568. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, T.; Sato, S. Stimulating angiogenesis mitigates the unloading-induced reduction in osteogenesis in early-stage bone repair in rats. Physiol. Rep. 2015, 3, e12335. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shen, X.; Wan, C.; Ramaswamy, G.; Mavalli, M.; Wang, Y.; Duvall, C.L.; Deng, L.F.; Guldberg, R.E.; Eberhart, A.; Clemens, T.L.; et al. Prolyl hydroxylase inhibitors increase neoangiogenesis and callus formation following femur fracture in mice. J. Orthop. Res. Off. Publ. Orthop. Res. Soc. 2009, 27, 1298–1305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stewart, R.; Goldstein, J.; Eberhardt, A.; Chu, G.T.; Gilbert, S. Increasing vascularity to improve healing of a segmental defect of the rat femur. J. Orthop. Trauma 2011, 25, 472–476. [Google Scholar] [CrossRef] [Green Version]
- Yao, Q.; Liu, Y.; Tao, J.; Baumgarten, K.M.; Sun, H. Hypoxia-Mimicking Nanofibrous Scaffolds Promote Endogenous Bone Regeneration. ACS Appl. Mater. Interfaces 2016, 8, 32450–32459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, W.; Li, G.; Deng, R.; Deng, L.; Qiu, S. New bone formation in a true bone ceramic scaffold loaded with desferrioxamine in the treatment of segmental bone defect: A preliminary study. J. Orthop. Sci. Off. J. Jpn. Orthop. Assoc. 2012, 17, 289–298. [Google Scholar] [CrossRef]
- Kang, H.; Yan, Y.; Jia, P.; Yang, K.; Guo, C.; Chen, H.; Qi, J.; Qian, N.; Xu, X.; Wang, F.; et al. Desferrioxamine reduces ultrahigh-molecular-weight polyethylene-induced osteolysis by restraining inflammatory osteoclastogenesis via heme oxygenase-1. Cell Death Dis. 2016, 7, e2435. [Google Scholar] [CrossRef] [PubMed]
- Kusumbe, A.P.; Ramasamy, S.K.; Adams, R.H. Coupling of angiogenesis and osteogenesis by a specific vessel subtype in bone. Nature 2014, 507, 323–328. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Fan, L.; Yu, Z.; Dang, X.; Wang, K. The effect of deferoxamine on angiogenesis and bone repair in steroid-induced osteonecrosis of rabbit femoral heads. Exp. Biol. Med. 2015, 240, 273–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, X.; Tu, Y.; Zhang, L.; Qi, J.; Ma, T.; Deng, L. Prolyl hydroxylase inhibitors protect from the bone loss in ovariectomy rats by increasing bone vascularity. Cell Biochem. Biophys. 2014, 69, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Jia, P.; Shan, Y.; Hao, Y.; Wang, X.; Jiang, Y.; Yuan, Y.; Du, Q.; Zhang, H.; Yang, F.; et al. Synergistic protection of bone vasculature and bone mass by desferrioxamine in osteoporotic mice. Mol. Med. Rep. 2017, 16, 6642–6649. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Donneys, A.; Yang, Q.; Forrest, M.L.; Nelson, N.S.; Zhang, T.; Ettinger, R.; Ranganathan, K.; Snider, A.; Deshpande, S.S.; Cohen, M.S.; et al. Implantable hyaluronic acid-deferoxamine conjugate prevents nonunions through stimulation of neovascularization. NPJ Regen. Med. 2019, 4, 11. [Google Scholar] [CrossRef] [PubMed]
- Wagegg, M.; Gaber, T.; Lohanatha, F.L.; Hahne, M.; Strehl, C.; Fangradt, M.; Tran, C.L.; Schonbeck, K.; Hoff, P.; Ode, A.; et al. Hypoxia promotes osteogenesis but suppresses adipogenesis of human mesenchymal stromal cells in a hypoxia-inducible factor-1 dependent manner. PLoS ONE 2012, 7, e46483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfeiffenberger, M.; Damerau, A.; Ponomarev, I.; Bucher, C.H.; Chen, Y.; Barnewitz, D.; Thone-Reineke, C.; Hoff, P.; Buttgereit, F.; Gaber, T.; et al. Functional Scaffold-Free Bone Equivalents Induce Osteogenic and Angiogenic Processes in a Human In Vitro Fracture Hematoma Model. J. Bone Miner. Res. 2021, 36, 1189–1201. [Google Scholar] [CrossRef]
- Stokovic, N.; Ivanjko, N.; Erjavec, I.; Milosevic, M.; Oppermann, H.; Shimp, L.; Sampath, K.T.; Vukicevic, S. Autologous bone graft substitute containing rhBMP6 within autologous blood coagulum and synthetic ceramics of different particle size determines the quantity and structural pattern of bone formed in a rat subcutaneous assay. Bone 2020, 141, 115654. [Google Scholar] [CrossRef] [PubMed]
- Kazemzadeh-Narbat, M.; Kindrachuk, J.; Duan, K.; Jenssen, H.; Hancock, R.E.; Wang, R. Antimicrobial peptides on calcium phosphate-coated titanium for the prevention of implant-associated infections. Biomaterials 2010, 31, 9519–9526. [Google Scholar] [CrossRef]
- Shimizu, K.; Ito, A.; Yoshida, T.; Yamada, Y.; Ueda, M.; Honda, H. Bone tissue engineering with human mesenchymal stem cell sheets constructed using magnetite nanoparticles and magnetic force. J. Biomed. Mater. Res. B Appl. Biomater. 2007, 82, 471–480. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.; Ren, L.; Liu, Y.; Chen, F.; Zhang, J.; Xue, Z.; Mao, T. Engineering scaffold-free bone tissue using bone marrow stromal cell sheets. J. Orthop. Res. 2010, 28, 697–702. [Google Scholar] [CrossRef] [PubMed]
- Ueyama, Y.; Yagyuu, T.; Maeda, M.; Imada, M.; Akahane, M.; Kawate, K.; Tanaka, Y.; Kirita, T. Maxillofacial bone regeneration with osteogenic matrix cell sheets: An experimental study in rats. Arch. Oral Biol. 2016, 72, 138–145. [Google Scholar] [CrossRef] [PubMed]
- Xie, Q.; Wang, Z.; Huang, Y.; Bi, X.; Zhou, H.; Lin, M.; Yu, Z.; Wang, Y.; Ni, N.; Sun, J.; et al. Characterization of human ethmoid sinus mucosa derived mesenchymal stem cells (hESMSCs) and the application of hESMSCs cell sheets in bone regeneration. Biomaterials 2015, 66, 67–82. [Google Scholar] [CrossRef]
- Wang, F.; Hu, Y.; He, D.; Zhou, G.; Ellis, E., 3rd. Scaffold-free cartilage cell sheet combined with bone-phase BMSCs-scaffold regenerate osteochondral construct in mini-pig model. Am. J. Transl. Res. 2018, 10, 2997–3010. [Google Scholar]
- Nakamura, A.; Akahane, M.; Shigematsu, H.; Tadokoro, M.; Morita, Y.; Ohgushi, H.; Dohi, Y.; Imamura, T.; Tanaka, Y. Cell sheet transplantation of cultured mesenchymal stem cells enhances bone formation in a rat nonunion model. Bone 2010, 46, 418–424. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, G.; Moghaddam, A. Allograft bone matrix versus synthetic bone graft substitutes. Injury 2011, 42 (Suppl. S2), S16–S21. [Google Scholar] [CrossRef]
- Kasten, P.; Beyen, I.; Niemeyer, P.; Luginbuhl, R.; Bohner, M.; Richter, W. Porosity and pore size of β-tricalcium phosphate scaffold can influence protein production and osteogenic differentiation of human mesenchymal stem cells: An in vitro and in vivo study. Acta Biomater. 2008, 4, 1904–1915. [Google Scholar] [CrossRef]
- Zhang, H.; Mao, X.; Du, Z.; Jiang, W.; Han, X.; Zhao, D.; Han, D.; Li, Q. Three dimensional printed macroporous polylactic acid/hydroxyapatite composite scaffolds for promoting bone formation in a critical-size rat calvarial defect model. Sci. Technol. Adv. Mater. 2016, 17, 136–148. [Google Scholar] [CrossRef] [Green Version]
- Lee, D.J.; Kwon, J.; Kim, Y.I.; Wang, X.; Wu, T.J.; Lee, Y.T.; Kim, S.; Miguez, P.; Ko, C.C. Effect of pore size in bone regeneration using polydopamine-laced hydroxyapatite collagen calcium silicate scaffolds fabricated by 3D mould printing technology. Orthod. Craniofac. Res. 2019, 22 (Suppl. S1), 127–133. [Google Scholar] [CrossRef]
- Takahashi, Y.; Tabata, Y. Effect of the fiber diameter and porosity of non-woven PET fabrics on the osteogenic differentiation of mesenchymal stem cells. J. Biomater. Sci. Polym. Ed. 2004, 15, 41–57. [Google Scholar] [CrossRef] [PubMed]
- Keaveny, T.M.; Morgan, E.F.; Niebur, G.L.; Yeh, O.C. Biomechanics of trabecular bone. Annu. Rev. Biomed. Eng. 2001, 3, 307–333. [Google Scholar] [CrossRef] [Green Version]
- Kronemberger, G.S.; Matsui, R.A.M.; Miranda, G.d.A.S.d.C.E.; Granjeiro, J.M.; Baptista, L.S. Cartilage and bone tissue engineering using adipose stromal/stem cells spheroids as building blocks. World J. Stem Cells 2020, 12, 110–122. [Google Scholar] [CrossRef] [PubMed]
- Shen, F.H.; Werner, B.C.; Liang, H.; Shang, H.; Yang, N.; Li, X.; Shimer, A.L.; Balian, G.; Katz, A.J. Implications of adipose-derived stromal cells in a 3D culture system for osteogenic differentiation: An in vitro and in vivo investigation. Spine J. 2013, 13, 32–43. [Google Scholar] [CrossRef]
- Laschke, M.W.; Schank, T.E.; Scheuer, C.; Kleer, S.; Shadmanov, T.; Eglin, D.; Alini, M.; Menger, M.D. In vitro osteogenic differentiation of adipose-derived mesenchymal stem cell spheroids impairs their in vivo vascularization capacity inside implanted porous polyurethane scaffolds. Acta Biomater. 2014, 10, 4226–4235. [Google Scholar] [CrossRef] [PubMed]
- Murata, D.; Tokunaga, S.; Tamura, T.; Kawaguchi, H.; Miyoshi, N.; Fujiki, M.; Nakayama, K.; Misumi, K. A preliminary study of osteochondral regeneration using a scaffold-free three-dimensional construct of porcine adipose tissue-derived mesenchymal stem cells. J. Orthop. Surg. Res. 2015, 10, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fennema, E.M.; Tchang, L.A.H.; Yuan, H.; van Blitterswijk, C.A.; Martin, I.; Scherberich, A.; de Boer, J. Ectopic bone formation by aggregated mesenchymal stem cells from bone marrow and adipose tissue: A comparative study. J. Tissue Eng. Regen. Med. 2018, 12, e150–e158. [Google Scholar] [CrossRef]
- Brochado, A.C.B.; de Souza, V.H.; Correa, J.; Dos Anjos, S.A.; de Almeida Barros Mourao, C.F.; Cardarelli, A.; Montemezzi, P.; Gameiro, V.S.; Pereira, M.R.; Mavropoulos, E.; et al. Osteosphere Model to Evaluate Cell-Surface Interactions of Implantable Biomaterials. Materials 2021, 14, 5858. [Google Scholar] [CrossRef]
- Ishaug-Riley, S.L.; Crane, G.M.; Gurlek, A.; Miller, M.J.; Yasko, A.W.; Yaszemski, M.J.; Mikos, A.G. Ectopic bone formation by marrow stromal osteoblast transplantation using poly(DL-lactic-co-glycolic acid) foams implanted into the rat mesentery. J. Biomed. Mater. Res. 1997, 36, 1–8. [Google Scholar] [CrossRef]
- Chen, L.J.; Wang, M. Production and evaluation of biodegradable composites based on PHB-PHV copolymer. Biomaterials 2002, 23, 2631–2639. [Google Scholar] [CrossRef]
- Yaszemski, M.J.; Payne, R.G.; Hayes, W.C.; Langer, R.; Mikos, A.G. Evolution of bone transplantation: Molecular, cellular and tissue strategies to engineer human bone. Biomaterials 1996, 17, 175–185. [Google Scholar] [CrossRef]
- Hu, Y.; Grainger, D.W.; Winn, S.R.; Hollinger, J.O. Fabrication of poly(α-hydroxy acid) foam scaffolds using multiple solvent systems. J. Biomed. Mater. Res. 2002, 59, 563–572. [Google Scholar] [CrossRef] [PubMed]
- Sheikh, F.A.; Ju, H.W.; Moon, B.M.; Lee, O.J.; Kim, J.-H.; Park, H.J.; Kim, D.W.; Kim, D.-K.; Jang, J.E.; Khang, G.; et al. Hybrid scaffolds based on PLGA and silk for bone tissue engineering. J. Tissue Eng. Regen. Med. 2016, 10, 209–221. [Google Scholar] [CrossRef] [PubMed]
- Yao, Q.; Cosme, J.G.; Xu, T.; Miszuk, J.M.; Picciani, P.H.; Fong, H.; Sun, H. Three dimensional electrospun PCL/PLA blend nanofibrous scaffolds with significantly improved stem cells osteogenic differentiation and cranial bone formation. Biomaterials 2017, 115, 115–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bose, S.; Tarafder, S. Calcium phosphate ceramic systems in growth factor and drug delivery for bone tissue engineering: A review. Acta Biomater. 2012, 8, 1401–1421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsuno, T.; Hashimoto, Y.; Adachi, S.; Omata, K.; Yoshitaka, Y.; Ozeki, Y.; Umezu, Y.; Tabata, Y.; Nakamura, M.; Satoh, T. Preparation of injectable 3D-formed β-tricalcium phosphate bead/alginate composite for bone tissue engineering. Dent. Mater. J. 2008, 27, 827–834. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, R.; Gao, Z.; Geng, W.; Yan, X.; Chen, F.; Liu, Y. Engineering vascularized bone graft with osteogenic and angiogenic lineage differentiated bone marrow mesenchymal stem cells. Artif. Organs 2012, 36, 1036–1046. [Google Scholar] [CrossRef]
- Kawamura, M.; Miyagawa, S.; Fukushima, S.; Saito, A.; Miki, K.; Funakoshi, S.; Yoshida, Y.; Yamanaka, S.; Shimizu, T.; Okano, T.; et al. Enhanced Therapeutic Effects of Human iPS Cell Derived-Cardiomyocyte by Combined Cell-Sheets with Omental Flap Technique in Porcine Ischemic Cardiomyopathy Model. Sci. Rep. 2017, 7, 8824. [Google Scholar] [CrossRef]
- Bohner, M.; Santoni, B.L.G.; Dobelin, N. Beta-Tricalcium phosphate for bone substitution: Synthesis and properties. Acta Biomater. 2020, 113, 23–41. [Google Scholar] [CrossRef]
- Liu, G.; Zhao, L.; Cui, L.; Liu, W.; Cao, Y. Tissue-Engineered bone formation using human bone marrow stromal cells and novel beta-tricalcium phosphate. Biomed. Mater. 2007, 2, 78–86. [Google Scholar] [CrossRef]
- Gao, P.; Zhang, H.; Liu, Y.; Fan, B.; Li, X.; Xiao, X.; Lan, P.; Li, M.; Geng, L.; Liu, D.; et al. Beta-Tricalcium phosphate granules improve osteogenesis in vitro and establish innovative osteo-regenerators for bone tissue engineering in vivo. Sci. Rep. 2016, 6, 23367. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ueha, T.; Akahane, M.; Shimizu, T.; Uchihara, Y.; Morita, Y.; Nitta, N.; Kido, A.; Inagaki, Y.; Kawate, K.; Tanaka, Y. Utility of tricalcium phosphate and osteogenic matrix cell sheet constructs for bone defect reconstruction. World J. Stem Cells 2015, 7, 873–882. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, K.; Lu, X.; Li, M.; Liu, H.; Xie, C.; Meng, F.; Jiang, O.; Li, C.; Zhi, W. BMP-2 encapsulated polysaccharide nanoparticle modified biphasic calcium phosphate scaffolds for bone tissue regeneration. J. Biomed. Mater. Res. A 2015, 103, 1520–1532. [Google Scholar] [CrossRef]
- Zhang, H.; Migneco, F.; Lin, C.Y.; Hollister, S.J. Chemically-Conjugated bone morphogenetic protein-2 on three-dimensional polycaprolactone scaffolds stimulates osteogenic activity in bone marrow stromal cells. Tissue Eng. Part A 2010, 16, 3441–3448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blumenfeld, I.; Srouji, S.; Lanir, Y.; Laufer, D.; Livne, E. Enhancement of bone defect healing in old rats by TGF-beta and IGF-1. Exp. Gerontol. 2002, 37, 553–565. [Google Scholar] [CrossRef]
- Seeherman, H.; Wozney, J.M. Delivery of bone morphogenetic proteins for orthopedic tissue regeneration. Cytokine Growth Factor Rev. 2005, 16, 329–345. [Google Scholar] [CrossRef] [PubMed]
- Dimar, J.R.; Glassman, S.D.; Burkus, K.J.; Carreon, L.Y. Clinical outcomes and fusion success at 2 years of single-level instrumented posterolateral fusions with recombinant human bone morphogenetic protein-2/compression resistant matrix versus iliac crest bone graft. Spine 2006, 31, 2534–2539; discussion 2540. [Google Scholar] [CrossRef]
Donor | Age | Sex | Donor | Age | Sex |
---|---|---|---|---|---|
1 | 56 | male | 6 | 62 | female |
2 | 69 | female | 7 | 77 | male |
3 | 71 | male | 8 | 64 | female |
4 | 81 | female | 9 | 65 | male |
5 | 75 | female | 10 | 58 | male |
Gene | Sequence of Forward Primer | Sequence of Reverse Primer |
---|---|---|
EF1A | GTTGATATGGTTCCTGGCAAGC | TTGCCAGCTCCAGCAGCCT |
RUNX2 | TTACTTACACCCCGCCAGTC | TATGGAGTGCTGCTGGTCTG |
SPP1 | GCCGAGGTGATAGTGTGGTT | TGAGGTGATGTCCTCGTCTG |
COL1A1 | CAGCCGCTTCACCTACAGC | TTTTGTATTCAATCACTGTCTTGCC |
ON | ACCAGCACCCCATTGACG | AGGTCACAGGTCTCGAAAAAGC |
SOX9 | CGCCTTGAAGATGGCGTTG | GCTCTGGAGACTTCTGAACGA |
PPARγ2 | CAAACCCCTATTCCATGCTGTT | AATGGCATCTCTGTGTCAACC |
IL6 | TACCCCCAGGAGAAGATTCC | TTTTCTGCCAGTGCCTCTTT |
IL8 | GAATGGGTTTGCTAGAATGTGATA | CAGACTAGGGTTGCCAGATTTAAC |
LDHA | ACCCAGTTTCCACCATGATT | CCCAAAATGCAAGGAACACT |
VEGFA | AGCCTTGCCTTGCTGCTCTA | GTGCTGGCCTTGGTGAGG |
PGK1 | ATGGATGAGGTGGTGAAAGC | CAGTGCTCACATGGCTGACT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Damerau, A.; Buttgereit, F.; Gaber, T. Optimization of a Tricalcium Phosphate-Based Bone Model Using Cell-Sheet Technology to Simulate Bone Disorders. Processes 2022, 10, 550. https://doi.org/10.3390/pr10030550
Damerau A, Buttgereit F, Gaber T. Optimization of a Tricalcium Phosphate-Based Bone Model Using Cell-Sheet Technology to Simulate Bone Disorders. Processes. 2022; 10(3):550. https://doi.org/10.3390/pr10030550
Chicago/Turabian StyleDamerau, Alexandra, Frank Buttgereit, and Timo Gaber. 2022. "Optimization of a Tricalcium Phosphate-Based Bone Model Using Cell-Sheet Technology to Simulate Bone Disorders" Processes 10, no. 3: 550. https://doi.org/10.3390/pr10030550