Next Article in Journal
Nutritional Quality, Techno-Functional Characteristics, and Safety of Biomass Powder and Protein Isolate Produced from Penicillium maximae
Previous Article in Journal
Fruit Wine Obtained from Melon by-Products: Physico-Chemical and Sensory Analysis, and Characterization of Key Aromas by GC-MS
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 11
Issue 22
10.3390/foods11223620
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Differential Expression of Genes Related to Growth and Aflatoxin Synthesis in Aspergillus flavus When Inhibited by Bacillus velezensis Strain B2

by
Qiaoyun Wu
†,
Huanhuan Li
†,
Sunxing Wang
,
Zhongnian Zhang
,
Zhipeng Zhang
,
Tuwei Jin
,
Xiufang Hu
and
Guohong Zeng
*
Zhejiang Province Key Laboratory of Plant Secondary Metabolism and Regulation, College of Life Science and Medicine, Zhejiang Sci-Tech University, Road 2, Xiasha, Hangzhou 310018, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Foods 2022, 11(22), 3620; https://doi.org/10.3390/foods11223620
Submission received: 1 October 2022 / Revised: 2 November 2022 / Accepted: 11 November 2022 / Published: 13 November 2022
(This article belongs to the Section Food Microbiology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Aspergillus flavus is a saprophytic soil fungus that infects and contaminates seed crops with the highly carcinogenic aflatoxin, which brings health hazards to animals and humans. In this study, bacterial strains B1 and B2 isolated from the rhizosphere soil of camellia sinensis had significant antagonistic activities against A. flavus. Based on the phylogenetic analysis of 16SrDNA gene sequence, bacterial strains B1 and B2 were identified as Bacillus tequilensis and Bacillus velezensis, respectively. In addition, the transcriptome analysis showed that some genes related to A. flavus growth and aflatoxin synthesis were differential expressed and 16 genes in the aflatoxin synthesis gene cluster showed down-regulation trends when inhibited by Bacillus velezensis strain B2. We guessed that the Bacillus velezensis strain B2 may secrete some secondary metabolites, which regulate the related gene transcription of A. flavus to inhibit growth and aflatoxin production. In summary, this work provided the foundation for the more effective biocontrol of A. flavus infection and aflatoxin contamination by the determination of differential expression of genes related to growth and aflatoxin synthesis in A. flavus when inhibited by B. velezensis strain B2.

1. Introduction

Aspergillus flavus is a saprophytic soil fungus that infects and contaminates seed crops and it is in the spotlight for the production of aflatoxins that contaminate oil-rich seeds such as maize, peanuts, cotton seeds and treenuts before and after harvest. A. flavus, as the second Aspergillus fumigatus only pathogen, produces secondary metabolites containing polyketones, which are strong carcinogens and can seriously affect human and animal health [1]. Aflatoxins are one of the most harmful mycotoxins, which are produced by A. flavus, A. parasiticus, and other fungi that are commonly found in the production and preservation of grain and feed. Aflatoxins can cause harm to animal and human health due to their toxic (carcinogenic, teratogenic, and mutagenic) effects [2]. Aflatoxins were first discovered and characterized in the early 1960s following a severe livestock poisoning incident in England involving turkeys; they are kinds of polyketide-derived carcinogenic and mutagenic secondary metabolites [3,4,5]. Aflatoxins belong to a class of secondary metabolites of A. flavus and include varieties and the four major types are B1, B2, G1 and G2. Aflatoxin B1 (AFB1) exerts strong mutagenicity and carcinogenicity [6], which is classified as a Group 1 human carcinogen by the International Agency for Research on Cancer [7,8]. It is converted to AFB1-8 and 9-epoxide in the liver, catalyzed by cytochrome P450 associated enzymes after being ingested by animals, forming adducts with the guanine base of DNA, thus resulting in acute and chronic diseases called aflatoxicoses in both human and household animals feeding high levels of aflatoxins-contaminated food [9]. AFB1 biosynthesis was catalyzed by the coordinated cascade of enzymes that are encoded by approximately 30 different genes that group into a cluster located near the telomeric region of chromosome three of the aflatoxinogenic species [10]. The initial stage of aflatoxin biosynthesis is similar to fatty acid biosynthesis, with acetyl-CoA as the starting unit and malonyl-CoA as the elongating unit, which is catalyzed by polyketide synthase (PKSA) to form the aflatoxin of the polyketone backbone [11].
Aflatoxin not only harms the health of human and animals, but also causes economic losses. Human and animals themselves cannot degrade aflatoxin through their own metabolism and so avoid contact with or ingestion of aflatoxin [12]. The pollution of aflatoxin to grain occurs in all stages before harvest, during harvest, storage and processing. Therefore, at each stage, from planting to harvest, there are different methods for the prevention and control of aflatoxin. The prevention and control of aflatoxin can be divided into prenatal and postpartum prevention and control [13]. At present, the main method to control the pollution of A. flavus before harvest is to use the non-toxigenic-strain of A. flavus to compete with the toxigenic-strain of A. flavus for the nutrient substrate to achieve inhibition [14,15]. COTTYPJ et al. [16] applied the non-toxigenic-strain of A. flavus to cotton fields to effectively reduce aflatoxin pollution in cotton seeds. The effect of the field biological control of non-toxin-producing A. flavus strains can last until harvest and storage [17]. At present, large-scale research has led to the rapid development of non-toxigenic-strains of A. flavus in commercial application [18,19]. The control measures of A. flavus and its toxin in post-harvest crops mainly include physical control, chemical control and biological control [20]. Physical methods mainly include ozone, irradiation, high temperature heating and so on, while chemical methods include ammoniation, alkali, oxidation and so on. However, these two methods have some shortcomings, such as an unstable effect, large loss of nutrients and difficulty in large-scale production [21]. The biological control of A. flavus is a method to control A. flavus and its toxin using microorganisms and their secondary metabolites or enzymes is secreted. A large number of studies have shown that many microorganisms can inhibit the growth and toxin production of A. flavus, including bacteria, actinomycetes, yeast, algae and so on [22]. During their growth, they usually produce a series of secondary metabolites, including alcohols, aldehydes, acids, esters and ketones [23,24]. At present, scholars at home and abroad mainly study the volatile substances produced by Bacillus, Pseudomonas and Streptomyces. The volatile compounds produced by plant rhizosphere bacteria can not only inhibit the growth and toxin production of A. flavus, but also have a certain effect on plant growth [25]. For example, volatile substances produced by Bacillus amylolyticus can effectively stimulate the growth and development of plants [26]. Cutierrez found that volatile organic compounds produced by Bacillus could promote root elongation and change the root structure of Arabidopsis thaliana [27]. In addition, the use of microorganisms to detoxify aflatoxins is a promising new technology with broad application prospects [2]. For example, the excellent adsorption capacity and natural fermentation function make the use of Lactobacillaceae and Saccharomyces essential in the process of detoxifying food. Lactobacillus rhamnosus strain is an excellent biosorption species. The combination of heat-treatment and anaerobic solid fermentation can remove 100% of AFB1 [28]. Research proved the capacity of L.acidophilus to bind AB1 and AM1 in cow’s milk [29], which can reduce AFM1 (aflatoxin M1) and potentially decrease toxins in yogurt to a safe concentration for consumption (below 0.05 µg/kg) [30].
Bacillus velezensis is a plant growth-promoting bacterium that can inhibit plant pathogens [31], but can also produce a variety of antibacterial proteins and lipopeptide antibacterial substances with broad-spectrum antibacterial activities. Li et al. demonstrated that lipopolysaccharide produced by B. velezensis can not only inhibit spore of A. flavus germination and cause abnormal mycelium expansion and cell rupture, but can also significantly down-regulate the genes (aflK, aflR, Vea, and omtA) of aflatoxin synthesis pathways [32]. KONGQ et al. carried out in vivo and in vitro experiments on a marine B. velezensis strain isolated from the Yellow Sea in eastern China to test its effect on post-harvest corruption of peanuts caused by A. flavus. The results showed that the B. velezensis had significant biological control effects in vivo, and could reduce the biosynthesis of aflatoxin by inhibiting the transcription of the aflR gene and aflS gene [33]. B. velezensis DY3108, isolated from the soil, could detoxify fungal contamination in food by degrading 90% of aflatoxins B1 [34]. Vahidinasab et al. [35] reported that the B. velezensis UTB96 strain showed the highest antifungal activity against A. flavus and was capable of degrading aflatoxin. B. velezensis as a probiotic can compete with aflatoxigenic strains, either for nutrients and space, or for the degradation of aflatoxins by enzyme production [36].
Thus far, the molecular mechanism of Bacillus against A. flavus is not clear. The aim of this study is to find potential biocontrol agents against A. flavus growth and aflatoxin synthesis and understand the antagonistic mechanism. We found two bacterial strains, B1 and B2, isolated from the rhizosphere soil of camellia sinensis had significant antagonistic activities against A. flavus and identified them as the Bacillus tequilensis strain B1 and Bacillus velezensis strain B2. Transcriptome analysis showed that some genes related to A. flavus growth and aflatoxin synthesis were differentially expressed and 16 genes in the aflatoxin synthesis gene cluster showed down-regulation trends when inhibited by Bacillus velezensis strain B2. This provided the foundation for the more effective biological control of A. flavus and aflatoxin synthesis.

2. Materials and Methods

2.1. Fungal Strain

The fungal strain Aspergillus flavus was obtained from Prof. Xiufang Hu at the microbiology lab of Zhejiang Sci-Tech University. A. flavus was cultured on a PDA (Potato Dextrose Agar) medium and incubated at 28 °C [32,37,38] for 10 days.

2.2. Isolation of Bacterial Isolates from Camellia sinensis

The rhizosphere soil of Camellia sinensis was collected from tea garden in Meijiawu, Hangzhou, Zhejiang province. Samples were collected aseptically into Ziplock bags and marked labels, respectively, which were then transported to the laboratory for analysis. We weighed 10 g of rhizosphere soil and added a conical flask containing 90 mL sterile water to make a 10−1 soil suspension, and then we made 10−2~10−9 soil suspensions by serial dilution. 100 μL of 10−7, 10−8, and 10−9 soil suspensions were, respectively, spread on the LB (Luria Bertani) medium and then incubated at 37 °C for 4 days. Finally, 10 bacterial strains were obtained by isolation and purification.

2.3. Screen for Potential Biocontrol Agents against A. flavus

Using a sterile cork-bore, mycelial disc (7 mm in diameter) of A. flavus from a 10-days-old culture on a PDA plate was placed in the center of a freshly prepared PDA plate (9 cm in diameter). Additionally, bacterial isolates were inoculated in an LB liquid culture and incubated at 37 °C for 16 h with shaking at 200 rpm, and 20 μL of the bacterial suspensions were, respectively, added to the three aseptic filter paper pieces at a distance of 3 cm from the mycelial discs. Control tests were carried out by only inoculating A. flavus. All the plates were placed in a 28 °C incubator, and the diameters of A. flavus were measured everyday from 2 d to 7 d. The relative inhibition rates were calculated as (C-T)/C × 100% [39], where C denotes the radius of A. flavus in the control and T denotes the radius of A. flavus in the treatment. All the experiments were done in triplicate.

2.4. Identification of Bacterial Isolates That Show Antagonism against A. flavus

The antagonistic bacterial isolates were identified both morphologically and genetically. For morphology, the isolates were cultured on plates at 37 °C for 4 days for colony morphology observation, and the pure colonies were stained with gram and observed using light microscopes. At the same time, the pure cultures were used to extract genomic DNA using Wizard Genomic DNA Purification Kit (Solario) according to the manufacturer’s instructions. 16SrDNA sequences of bacterial isolates were amplified by using the forward primer (TCCGTAGGTGAACCTGCGG) and reverse primer (TCCTCCGCTTATTGATATGC) and sequenced by the Sangon Biotech Company (Shanghai, China). Phylogenetic trees were constructed using the neighbor-joining method (MEGA 7) based on 16SrDNA gene sequences. Bootstrap resampling analysis was performed to estimate the confidence of the tree topologies.

2.5. Conidiation Assays of A. flavus Antagonized by B1 and B2

Conidial yields were determined, as previously described [40]. Briefly, 10 μL of the conidial suspension (1 × 107 conidia mL−1) of A. flavus were inoculated on the center of PDA plates (90 mm in diameter). Additionally, three asptic filter paper pieces equidistantly spaced around 2.5 cm with A. flavus were then inoculated with 10 μL bacterial suspension of B1 and B2, which were cultured in LB at 37 °C for 16 h (200 rpm), while treatments inoculated with 10 μL of sterile LB were used as negative controls. All the PDA plates were placed in a 28 °C incubator. After 7 days culture, three agar discs (5 mm) of A. flavus were cut using a sterile cork-bore and respectively put into 1 mL 0.01%TitonX-100 (v/v). Conidial yields of A. flavus were determined after ultrasonication (30 Hz for 10 min) of the agar discs (JXFSTPRP-24 Shanghai Jingxin, Shanghai, China).

2.6. Transcriptomic Analysis of A. flavus Inhibited by B2 Using RNA-Seq

RNA-seq was used to profile transcriptomes of A. flavus inhibited by the B. velezensis strain B2. Briefly, B2 was inoculated in LB liquid culture and incubated at 37 °C for 16 h with shaking 200 rpm, and 20 μL of the bacterial suspensions were inoculated in the center of a freshly prepared PDA plate (9 cm in diameter), mycelial discs (7 mm in diameter) of A. flavus from a 10-days-old culture on a PDA plate and were respectively placed at a distance of 3 cm from the B2. Treatment of A. flavus without B2 inhibition was used as a negative control. After 4 days incubation at 28 °C, the fungal biomass of A. flavus were, respectively, subjected to RNA extraction with TRIzol reagent (Life Technologies, Carlsbad, CA, USA).
Construction of cDNA libraries and sequencing with the Illumina HiSeq 2000 platform were performed by Frasergen (Shanghai, China). After paired-end sequencing, clean reads were used for gene expression quantification using the RPKM method. Differential expression analysis was performed with edgeR v 3.24 software using the cut-offs of the adjusted p-value 0.05 and a greater than or equal to twofold change [41].

3. Results

3.1. Screen for Potential Biocontrol Agents against A. flavus

To screen for potential biocontrol agents, we isolated 10 bacterial strains from the oilseed plant of Camellia sinensis, which is very susceptible to be infected and contaminated by A. flavus and its production of aflatoxins (Figure S1). All strains (B1~B10) were tested to determine if they could inhibit the growth of A. flavus using the plate confrontation antagonism test. Only strains of B1 and B2 showed significant inhibiting effects on A. flavus (Figure 1A,B), and their relative inhibition rates were 34.22% and 35.72%, respectively (Table S1).

3.2. Identification of Strains of B1 and B2

The resulting colony of B1 was 2.0–3.0 mm in diameter, smooth, circular, flat and white after being grown on LB media at 37 °C for four days, and B2 was 2.0–3.0 mm in diameter, smooth, circular but with an irregular edge, convex and white. B1 and B2 were both Gram-positive (Figure 2A). BLASTn searches based on the 16SrDNA gene sequences of B1 and B2 appeared that they matched Bacillus tequilensis and Bacillus velezensis with 99% similarity, respectively. Phylogenetic trees constructed by the neighbor-joining method showed that B1 and B2, respectively, clustered with the Bacillus tequilensis strain 10b (NR 118290.1) and Bacillus velezensis strain CBMB205 (NR 116240.1), indicating that B1 and B2 are likely isolates belonging to Bacillus (Figure 2B,C).

3.3. Conidiation of A. flavus Antagonized by B1 and B2

In A. flavus, conidiation is accompanied by aflatoxin synthesis [32,42]. Compared to the control, conidial yields of A. flavus antagonized by B1 and B2 significantly decreased (p < 0.05) (Figure 3). Therefore, it was speculated that B1 and B2 may secrete some compounds that inhibit the conidiation of A. flavus, and then reduce the synthesis of aflatoxin.

3.4. Overview of RNA-Seq Analysis and DEGs Identification of A. flavus Antagonized by B2

To find the genes that may be related to the synthesize of aflatoxins and regulated by bacterial isolate B2, the transcriptomes of A. flavus, which was inhibited by B2, were profiled by Illumina Hiseq 2000 RNA-Seq (A. flavus without antagonism as a negative control), three biological replicates and eight datasets were established. In this section, we compared a set of differentially expressed genes (DEGs) between A. flavus antagonized by B2 and A. flavus alone. Additionally, ‘up-regulated genes’ are genes with higher expression levels when A. flavus antagonized by B2, ‘down-regulated genes’, are those with lower expression levels under the same conditions. When A. flavus was antagonized by B2, there were a total of 185 DEGs, including 151 up-regulated and 34 down-regulated genes (Figure 4).

3.5. GO Terms Analysis of DEGs

Among the 185 genes that were differentially expressed in A. flavus inhibited by B2, 30 GO (Gene Ontology) terms were enriched, including ten in biological process, ten in cellular component and ten in molecular function (Figure 5). A GO term for aflatoxin biosynthesis was enriched for two up-regulated genes of aldo-keto-reductase family and cytochrome P450 related genes (AFLA_3422 and AFLA_860) (Table 1). Aldehyde-ketoreductase family genes synthesize NAD(P)-linked oxidoreductases that catalyze the reduction of NAD(P)H to NAD(P)+. Cytochrome P450 gene synthesizes cytochrome P450 monooxygenase. In the synthesis of aflatoxin, the role of this enzyme is to catalyze the conversion of O-methyl variegated toxin and dihydro-O-methyl variegated toxin into aflatoxins B1, G1, B2, and G2, but the expression of their activities requires NADPH as a cofactor, and the level of intracellular NADPH/NADP+ affects the expression of aflatoxin biosynthesis regulator gene aflR [11]. Therefore, it is speculated that the compound produced by B2 can promote the production of NAD(P)-linked oxidoreductase and catalyze the reduction of intracellular NAD(P)H to NAD(P)+, thereby inhibiting the production of aflatoxin.

3.6. KEGG Enrichment Analysis of DEGs

The results of the KEGG enrichment of 185 DEGs showed that they were involved in 45 metabolic pathways. Among them, genes in the biosynthetic pathway of amino acids and the metabolic pathway of carbohydrates were mainly up-regulated, and they were consistent with the results of the research reported previously [4]. Ribosomes are the cellular factories responsible for making proteins. Additionally, according to the results of transcriptome sequencing, genes related to ribosome synthesis were mainly up-regulated in A. flavus (Table 1). Therefore, it was speculated that the active components secreted by B2 may lead to protein damage and membrane structure destruction in A. flavus, and A. flavus synthesizes proteins from other pathways to maintain its own basic growth. The pathways enriched for down-regulated genes mainly include the biosynthetic process, energy metabolism, transcription, folding, transport, and catabolism (Table 1); these genes were down-regulated may affect ribosome assembly and the protein synthesis of A. flavus, thus resulting in growth that was inhibited and the biosynthesis of aflatoxins was reduced.

4. Discussion

Aspergillus flavus is an universal pathogen of crops and it produces aflatoxin in the seeds of a variety of crops before and after harvest, which poisons humans and animals through the food chains. Currently, many strategies have been commonly used to control aflatoxin production. Preharvest control has relied on identifying resistant crop lines, planting regionally adapted cultivars and planting at appropriate seed densities, thus limiting insect damage and so on. However, these measures are not always efficient to avoid aflatoxin formation [10,43]. More and more biocontrols have been developed. As one strategy, aflatoxin non-producing strains of A. flavus excluded competitive aflatoxin-producing Aspergillus species to decrease crop aflatoxin contamination [9]. Further, aflatoxin biocontrol by beneficial microorganisms, including bacteria, actinomycetes and so on, is considered to be one of the most promising practices [44].
Camellia is a kind of oil plant and seed vulnerable to A. flavus infection and aflatoxin contamination. To screen for potential biocontrol agents that inhibit A. flavus growth and reduce aflatoxin biosynthesis, we isolated 10 bacterial strains from the leaves, flowers, seeds and rhizosphere soil of camellia. We found that only bacterial strains of B1 and B2 can inhibit the growth of A. flavus among the 10 bacterial strains. Some studies showed that volatile organic compounds, such as 2, 3-butanediol produced by soil-borne endophytic bacteria, increase plant pathogen resistance and promote plant growth [45,46]. However, B1 and B2 did not inhibit A. flavus by producing volatile compounds (Figure S2), and they may have other antagonistic mechanisms.
BLASTn searches and phylogentic trees based on the 16SrDNA gene sequences showed that the bacterial strains B1 and B2 clustered well with the Bacillus tequilensis and Bacillus velezensis, respectively. In addition, B1 and B2 had typical morphological characteristics that were similar to those of Bacillus. Therefore, B1 and B2 are both identified as the Bacillus genus. Members of the Bacillus genus produce abundant biologically active molecules, such as lipopeptides (LPs), polyketides, peptides, phosphatides, polyenes and so on, and they play important roles in controlling plant pathogens [47]. In a previous study, an antagonistic strain of Bacillus velezensis, with obvious anti-Aspergillus flavus fungi activity, was isolated from the surface of healthy rice, and the main components of LPs produced by this strain were identified by HPLC-MS analysis as fengycin and iturins, and they had shown that LPs can inhibit spore germination and even cause abnormal hyphal expansion and cell rupture [44]. Therefore, we guessed that B1 and B2 may produce similar antimicrobial compounds to inhibit A. flavus growth.
The study found that the level of intracellular NADPH/NADP+ has a certain effect on the expression of aflR, and NADPH is a cofactor for the expression of cytochrome P450 monooxygenase activity. In A. flavus, cytochrome P450 monooxidase catalyzes the conversion of O-methyl versicolor and dihydro-O-methyl versicolor to aflatoxin B1, G1, B2, and G2, respectively [11]. We found that there were 185 DEGs, including 152 up-regulated genes and 34 down-regulated genes in A flavus antagonized by the Bacillus velezensis strain by the transcriptome analysis. GO term and KEGG enrichment analysis were performed on these DEGs, and we found that the GO term of aflatoxin biosynthesis was enriched for two up-regulated genes. They were namely aldosterone reductase family genes and cytochrome P450 related genes, which synthesize NAD(P)-linked oxidoreductase and cytochrome P450 monooxygenase, respectively. NAD(P)-linked oxidoreductase catalyzes the reduction of NAD(P)H to NAD(P)+. Therefore, it is speculated that the compound produced by B2 can promote the production of NAD(P)-linked oxidoreductase and catalyze the reduction of intracellular NAD(P)H to NAD(P)+, thus inhibiting the monooxygenase activity of cytochrome P450 and even the aflatoxin production. The KEGG enrichment analysis found that related genes in amino acid biosynthesis pathway, carbohydrate metabolism pathway and ribosome synthesis pathway were all up-regulated, and genes in the energy metabolism pathway, transcription, folding, transport pathway, biosynthesis and catabolism pathway were down-regulated. It was speculated that the active components secreted by B2 lead to protein damage and membrane structure disruption in A. flavus and A. flavus synthesizes proteins through other pathways to maintain its own basic growth. However, the down-regulated genes may affect ribosome assembly and protein synthesis, thus resulting in growth that was inhibited and biosynthesis of aflatoxins that was reduced.
Aflatoxins are PKS-derived mycotoxins synthesized from a large cluster, which is composed of approximately 30 different genes. The expression level of each gene in this pathway directly affects the amount of aflatoxins synthesis. AflA, aflB and aflC are required to synthesize norsolorinic acid, which is the first stable aflatoxin precursor [10]. VeA, as the core protein of the velvet complex, regulates the growth and development of A. flavus, including participating in conidiogenesis and the publication of sclerotia [48]. AflR and aflS are the regulatory genes of aflatoxin biosynthesis, which play a key role in the regulation of aflatoxin biosynthesis [49,50]. AflK Paticipates in the conversion of VAL to VERB, which is a key step in the formation of aflatoxin and blocks the bifuran ring of aflatoxin [51]. AflP (omtA) gene encoding protein is a key enzyme in the late stage of aflatoxin synthesis [52]. Transcriptome analysis of A. flavus, when inhibited with B2, indicated that 16 genes in the gene cluster of aflatoxin synthesis show down-regulation trends (Table S2). This further indicates that the secondary metabolites produced by B2 can down-regulate the transcription of related genes and reduce the production of aflatoxin.
At present, non-toxigenic-strain of A. flavus or non-toxingenic-strain of Parasitic Aspergillus are often applied to the soil to competitively inhibit the growth of aflatoxin-producing strains, so as to effectively prevent aflatoxin pollution before and after harvest [53]. Jia chang Li uses starch, sodium alginate and thermosensitive gel as a matrix, and non-toxigenic-strain of A. flavus suspension as the source of biocontrol bacteria and prepares temperature-responsive immobilized microspheres by immobilized microtechnology, which can continuously release biocontrol bacteria at a suitable temperature in the field and effectively prevent aflatoxin contamination [54]. However, in practical application, the requirement of non-toxigenic-strain of A. flavus is very high. It can not only produce toxin but must also have strong vitality and competitiveness. Such strains are not easy to obtain in the environment [55]. Bacillus is a kind of aerobic or facultative anaerobic bacteria. It is not only an important microbial population in soil and plant surface rhizosphere, but also a common endophytic bacterium in plants. It has the characteristics of a wide distribution and is easy to obtain [56]. Secondary metabolites produced by Bacillus in plant rhizosphere can not only inhibit the growth and toxin production of A. flavus, but can also promote plant growth [25]. Previous studies have reported the usefulness of B. velezensis as a probiotic in the aquaculture industry [57,58,59]. Due to its wide distribution in nature and enrichment in its own metabolites [60], B. velezensis may have the potential to be used as a probiotic in animal feed. Compared to non-toxigenic-strains of A. flavus, Bacillus strains are easier to culture and obtain and have stronger environmental adaptability. We can prepare liquid bacterial agent B2 and add a large amount of it to rhizosphere soil of tea to inhibit A. flavus, which is a saprophytic soil fungus, and has a better inhibitory effect on the actual crop groups in the field. Bacillus can also produce a variety of antibacterial proteins and lipopeptide antibacterial substances, which have broad-spectrum antibacterial activity [28]. The lipopeptide produced by B. velezensis B2 can be isolated and purified by the fermentation process and made into a preparation to inhibit the growth of A. flavus and aflatoxin production during grain storage [56]. To sum up, B. velezensis B2 isolated from camellia has great potential to become a biocontrol bacterium for the prevention of aflatoxin pollution.

Supplementary Materials

The following supporting information can be downloaded at: www.mdpi.com/article/10.3390/foods11223620/s1, Figure S1: Morphology of colonies of bacterial isolates obtained from the Camellia sinensis; Figure S2: Inhibition effect of volatile compounds produced by B1 and B2 on the growth of A. flavus; Table S1: Relative inhibition rates of A. flavus inhibited by bacterial isolates B1~B10; Table S2: Expression profiling genes involved in aflatoxin biosynthesis in A. flavus.

Author Contributions

Conceptualization, Q.W. and H.L.; methodology, Q.W. and H.L.; software, S.W. and Z.Z. (Zhongnian Zhang); validation, Q.W. and H.L.; formal analysis, Q.W.; investigation, H.L.; resources, Q.W.; data curation, S.W. and T.J.; writing—original draft preparation, Q.W., H.L. and G.Z.; writing—review and editing, G.Z. and X.H.; visualization, Q.W.; supervision, Z.Z. (Zhipeng Zhang); project administration, G.Z.; funding acquisition, G.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research is supported by Zhejiang Natural Science Foundation of China (LQ20C010006) and the general scientific research project from Zhejiang Sci-Tech University (18042289-Y).

Data Availability Statement

Not applicable.

Acknowledgments

We are grateful to Hu for their initial experiments on this project.

Conflicts of Interest

We declare that we have no conflict of interest in the authorship or publication of this contribution.

References

  1. Hedayati, M.T.; Pasqualotto, A.C.; Warn, P.A.; Bowyer, P.; Denning, D.W. Aspergillus flavus: Human pathogen, allergen and mycotoxin producer. Microbiology 2007, 153, 1677–1692. [Google Scholar] [PubMed] [Green Version]
  2. Guan, Y.; Chen, J.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Aflatoxin Detoxification Using Microorganisms and Enzymes. Toxins 2021, 13, 46. [Google Scholar] [CrossRef] [PubMed]
  3. Keller, N.P. Fungal secondary metabolism: Regulation, function and drug discovery. Nat. Rev. Microbiol. 2019, 17, 167–180. [Google Scholar] [PubMed]
  4. Klich, M.A. Aspergillus flavus: The major producer of aflatoxin. Mol. Plant Pathol. 2007, 8, 713–722. [Google Scholar]
  5. Amaike, S.; Affeldt, K.J.; Yin, W.; Franke, S.; Choithani, A.; Keller, N.P. The bZIP protein MeaB mediates virulence attributes in Aspergillus flavus. PLoS ONE 2013, 8, e74030. [Google Scholar]
  6. Kumar, V.; Bahuguna, A.; Ramalingam, S.; Lee, J.S.; Han, S.S.; Chun, H.S.; Kim, M. Aflatoxin Reduction and Retardation of Aflatoxin Production by Microorganisms in Doenjang during a One-Year Fermentation. Fungi 2022, 8, 190. [Google Scholar]
  7. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans and International Agency for Research on Cancer. Some traditional herbal medicines, some mycotoxins, naphthalene and styrene. IARC Monogr. Eval. Carcinog. Risks Hum. 2002, 82, 171–249. [Google Scholar]
  8. Tian, F.; Lee, S.Y.; Woo, S.Y.; Choi, H.Y.; Park, S.B.; Chun, H.S. Effect of plant-based compounds on the antifungal and antiaflatoxi-genic efficiency of strobilurins against Aspergillus flavus. Hazard. Mater. 2021, 415, 125663. [Google Scholar]
  9. Mishra, H.N.; Das, C. A review on biological control and metabolism of aflatoxin. Crit. Rev. Food Sci. Nutr. 2003, 43, 245–264. [Google Scholar]
  10. Amaike, S.; Keller, N.P. Aspergillus flavus. Annu. Rev. Phytopathol. 2011, 49, 107–133. [Google Scholar]
  11. Xu, J.; Luo, X.Y. Molecular biology of aflatoxin biosynthesis. Health Res. 2003, 6, 628–636. [Google Scholar]
  12. Liu, Y.; Wu, F. Global Burden of Aflatoxin-Induced Hepato cellular Carcinoma: A Risk Assessment. Environ. Health Perspect. 2010, 118, 818–824. [Google Scholar]
  13. Bhatnagar-Mathur, P.; Sunkara, S.; Bhatnagar-Panwar, M.; Waliyar, F.; Sharma, K.K. Biotechnological advances for combating Aspergillus flavus and aflatoxin contamination in crops. Plant Sci. 2015, 234, 119–132. [Google Scholar]
  14. Pitt, J.I.; Hocking, A.D. Mycotoxins in Australia: Biocontral of aflatoxin in peanuts. Mycopathologia 2006, 162, 233–243. [Google Scholar]
  15. Yan, L.Y.; Kang, Y.P.; Lei, Y. Studies on the Molecular Characteristics and Biological Control of Aspergillus Flavus in Peanut; Chinese Society of Plant Pathology: Beijing, China, 2015. [Google Scholar]
  16. Cotty, P.J. Effect of atoxigenic strains of Aspergillus flavus on aflatoxin contamination of developing cottonseed. Plant Dis. 1990, 74, 233–235. [Google Scholar] [CrossRef] [Green Version]
  17. Dorner, J.W.; Cole, R.J. Effect of application of nontoxigenic strains of Aspergillus flavus and A. parasiticus on subsequent aflatoxin contamination of peanuts in storage. J. Stored Prod. Res. 2002, 38, 329–339. [Google Scholar]
  18. Moore, G.; Singh, R.; Horn, B. Recombination and lineage specific gene loss in the aflatoxin gene cluster of Aspergillus flavus. Mol. Ecol. 2009, 18, 4870–4887. [Google Scholar]
  19. Shang, B.; Zhou, L.; Wei, D.D.; Xing, F.G.; Liu, Y. Prevention and Control of Peanut aflatoxin by non-toxic Aspergillus flavus. Chin. Soc. Fungi 2015. [Google Scholar]
  20. Cao, M.; Fan, M.G. Research progress of aflatoxin removal technology. Food Mach. 2015, 31, 260–264. [Google Scholar]
  21. Li, P.W.; Zhang, D.H.; Yang, Y.; Cui, Y.H.; Zhang, Q.; Zhang, W.; Ding, X.X.; Wang, X.P.; Jang, J. Prevention and Control of Peanut aflatoxin by non-toxic Aspergillus flavus. Chin. J. Oil Crops 2010, 32, 315–319. [Google Scholar]
  22. Wang, K.; Run, P.S. Research Progress on Biological Control of aflatoxins in Peanut by antagonists. Food Sci. Technol. 2010, 35, 47–51. [Google Scholar]
  23. Lemfack, M.C.; Nickel, J.; Dunkel, M.; Preissner, R.; Piechulla, B. mVOC: Adatabase of microbial volatiles. Nucleic Acids Res. 2014, 42, 744–748. [Google Scholar]
  24. Morath, S.U.; Hung, R.; Bennett, J.W. Fxmgal volatile organic compounds: A review with emphasis on their biotechnollogical potential. Fungal Biol. Rev. 2012, 26, 73–83. [Google Scholar] [CrossRef]
  25. Ryu, C.M.; Farag, M.A.; Hu, C.H.; Reddy, M.S.; Wei, H.X.; Paré, P.W.; Kloepper, J.W. Bacterial volatiles promote growth in Arabidopsis. Proc. Natl. Acad. Sci. USA 2003, 100, 4927–4932. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Wang, H.; Shang, Q.M.; Zhang, Z.G.; Zhang, Y.; Li, P.L. Analysis of Biomass production by Bacillus amylolyticus L-H15 and Optimization of fermentation process. Food Sci. 2017, 38, 74–81. [Google Scholar]
  27. Fernando, W.D.; Ramarathnam, R.; Krishnamoorthy, A.S.; Savchuk, S.C. Identification and use of potential bacterial organic antifungal volatiles in biocontral. Soil Biol. Biochem. 2005, 37, 955–964. [Google Scholar]
  28. Zychowski, K.E.; Hoffmann, A.R.; Ly, H.J.; Pohlenz, C.; Buentello, A.; Romoser, A.; Gatlin, D.M.; Phillips, T.D. The effect of aflatoxin-B1 on red drum (Sciaenops ocellatus) and assessment of dietary supplementation of NovaSil for the prevention of aflatoxicosis. Toxins 2013, 5, 1555–1573. [Google Scholar]
  29. Wochner, K.F.; Moreira, M.C.C.; Kalschne, D.L.; Colla, E.; Drunkler, D.A. Detoxification of Aflatoxin B1 and M1 by Lactobacillus acidophilus and prebiotics in whole cow’s milk. Food Saf. 2019, 39, e12670. [Google Scholar]
  30. Pop, O.L.; Suharoschi, R.; Gabbianelli, R. Biodetoxification and Protective Properties of Probiotics. Microorganisms 2022, 10, 1278. [Google Scholar]
  31. Khalid, F.; Khalid, A.; Fu, Y.; Hu, Q.; Zheng, Y.; Khan, S.; Wang, Z. Potential of Bacillus velezensis as a probiotic in animal feed: A review. Microbiology 2021, 59, 627–633. [Google Scholar]
  32. Li, S.; Xu, X.; Zhao, T.; Ma, J.; Zhao, L.; Song, Q.; Sun, W. Screening of Bacillus velezensis E2 and the inhibitory effect of its antifungal substances on Aspergillus flavus. Foods 2022, 11, 140. [Google Scholar] [CrossRef]
  33. Kong, Q.; Shan, S.; Liu, Q.; Wang, X.; Yu, F. Biocontrol of Aspergillus flavus on peanut kernels by use of a strain of marine Bacillus megaterium. Int. J. Food Microbiol. 2010, 139, 31–35. [Google Scholar] [CrossRef]
  34. Shu, X.; Wang, Y.; Zhou, Q.; Li, M.; Hu, H.; Ma, Y.; Chen, X.; Ni, J.; Zhao, W.; Huang, S.; et al. Biological degradation of aflatoxin B1 by cell-free extracts of Bacillus velezensis DY3108 with broad pH stability and excellent thermostability. Toxins 2018, 10, 330. [Google Scholar]
  35. Vahidinasab, M.; Ahmadzadeh, M.; Henkel, M.; Hausmann, R.; Heravi, K.M. Bacillus velezensis UTB96 is an antifungal soil isolate with a reduced genome size compared to that of Bacillus velezensis FZB42. Microbiol. Resour. Announc. 2019, 8, e00667-19. [Google Scholar]
  36. Hernandez-Patlan, D.; Solis-Cruz, B.; Hargis, B.M.; Tellez, G. The use of probiotics in poultry production for the control of bacterial infections and aflatoxins. In Prebiotics and Probiotics-Potential Benefits in Human Nutrition and Health; IntechOpen: London, UK, 2019. [Google Scholar]
  37. Kong, Q.; Liu, Q.Z.; Yu, F.G.; Wang, X.D.; Shan, S.H. Study on inhibition of growth and toxin synthesis of Aspergillus flavus by a marine Bacillus strain. Agric. Life Sci. Ed. 2010, 36, 387–392. [Google Scholar]
  38. Ji, M.M.; Jang, J.; Fan, L.P.; Li, J. Study on the germicidal effect and mechanism of far infrared on Aspergillus flavus spores. Food Ferment. Ind. 2021, 47, 8–13. [Google Scholar]
  39. Zeng, G.; Zhang, P.; Zhang, Q.; Zhao, H.; Li, Z.; Zhang, X.; Fang, W. Duplication of a Pks gene cluster and subsequent functional diversification facilitate environmental adaptation in Metarhizium species. PLoS Genet. 2018, 14, e1007472. [Google Scholar] [CrossRef]
  40. Zeng, G.; Chen, X.X.; Zhang, X.; Zhang, Q.; Xu, C.; Mi, W.B.; Guo, N.; Zhao, H.; Yue, Y.; Dryburgh, F.; et al. Genome-wide identification of pathogenicity, conidiation and colony sectorization genes in Metarhizium robertsii. Environ. Microbiol. 2017, 19, 3896–3908. [Google Scholar]
  41. Benjamini, Y.; Drai, D.; Elmer, G.; Kafkafi, N.; Golani, I. Controlling the false discovery rate in behavior genetics research. Behav. Brain Res. 2001, 125, 279–284. [Google Scholar]
  42. Calvo, A.M.; Wilson, R.A.; Bok, J.W. Relationship between secondary metabolism and fungal development. Microbiol. Mol. Biol. Rev. 2002, 66, 447–459. [Google Scholar]
  43. Ehrlich, K.C.; Cotty, P.J. An isolate of Aspergillus flavus used to reduce aflatoxin contamination in cottonseed has a defective polyketide synthase gene. Appl. Microbiol. Biotechnol. 2004, 65, 473–478. [Google Scholar] [PubMed]
  44. Piechulla, B.; Degenhardt, J. The emerging importance of microbial volatile organic compounds. Plant Cell Environ. 2014, 37, 811–812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. D’alessandro, M.; Erb, M.; Ton, J.; Brandenburg, A.; Karlen, D.; Zopfi, J.; Turlings, T.C.J. Volatiles produced by soil-borne endophytic bacteria increase plant pathogen resistance and affect tritrophic interactions. Plant Cell Environ. 2014, 37, 813–826. [Google Scholar] [PubMed] [Green Version]
  46. Ongena, M.; Jacques, P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008, 16, 115–125. [Google Scholar] [PubMed]
  47. Rauscher, S.; Pacher, S.; Hedtke, M.; Kniemeyer, O.; Fischer, R. A phosphorylation code of the Aspergillus nidulans global regulator VelvwtA (VeA) determines specific functions. Mol. Microbiol. 2016, 99, 909–924. [Google Scholar] [CrossRef]
  48. Somashekar, D.; Rati, E.R.; Chandrashekar, A. PCR-restriction fragment length analysis of aflR gene for differentiation and detection of Aspergillus flavus and Aspergillus parasiticus in maize. Food Microbiol. 2004, 93, 101–107. [Google Scholar] [CrossRef]
  49. Liang, Y.; Kong, Q.; Yao, Y.; Xu, S.; Xie, X. Fusion expression and anti-Aspergillus flavus activity of a novel inhibitory protein DN-AflR. Food Microbiol. 2019, 290, 184–192. [Google Scholar] [CrossRef]
  50. Yu, J.; Fedorova, N.D.; Montalbano, B.G.; Bhatnagar, D.; Cleveland, T.E.; Bennett, J.W.; Nierman, W.C. Tight control of mycotoxinbiosynthesis gene expression in Aspergillus flavus by temperature as revealed by RNA-Seq. FEMS Microbiol. Lett. 2011, 322, 145–149. [Google Scholar]
  51. Liu, P.; Li, B.; Yin, R.; Weng, Q.; Chen, Q. Development and evaluation of ITS- and aflP-based LAMP assays for rapid detection of Aspergillus flavus in food samples. Can. J. Microbiol. 2014, 60, 579–584. [Google Scholar]
  52. Farzaneh, M.; Shi, Z.Q.; Ahmadzadeh, M.; Hu, L.B.; Ghassempour, A. Inhibition of the Aspergillus flavus grouth and aflatoxin B1 contamination on pistachio nut by fengycin and surfactin-producing Bacillus subtilis UTBSP1. Plant Pathol. J. 2016, 32, 209–215. [Google Scholar]
  53. Dorner, J.W. Biological control of aflatoxin contamination of crops. J. Zhejiang Univ. B 2008, 9, 787–792. [Google Scholar]
  54. Zhang, W. Screening of Non-Toxin-Producing Aspergillus Flavus Strain and Its Application in Peanut Planting; Jilin University: Changchun, China, 2019. [Google Scholar]
  55. Abbas, H.K.; Weaver, M.A.; Horn, B.W.; Carbone, I.; Monacell, J.T.; Shier, W.T. Selection of Aspergillus flavus isolates for biological control of aflatoxins in corn. Toxin Rev. 2011, 30, 59–70. [Google Scholar] [CrossRef]
  56. Qu, L.L. Study on the inhibitory effect of volatile compounds produced by Bacillus on Aspergillus flavus. Cent. South Univ. For. Sci. Technol. 2008, 9, 787–792. [Google Scholar]
  57. Li, J.; Wu, Z.B.; Zhang, Z.; Zha, J.W.; Qu, S.Y.; Qi, X.Z.; Wang, G.X.; Ling, F. Effects of potential probiotic Bacillus velezensis K2 on growth, immunity and resistance to Vibrio harveyi infection of hybrid grouper. Fish Shellfish Immunol. 2019, 93, 1047–1055. [Google Scholar]
  58. Thurlow, C.M.; Williams, M.A.; Carrias, A.; Ran, C.; Newman, M.; Tweedie, J.; Allison, E.; Jescovitch, L.N.; Wilson, A.E.; Terhune, J.S.; et al. Bacillus velezensis AP193 exerts probiotic effects in channel catfish (Ictalurus punctatus) and reduces aquaculture pond eutrophication. Aquaculture 2019, 503, 347–356. [Google Scholar]
  59. Zhang, D.; Gao, Y.; Ke, X.; Yi, M.; Liu, Z.; Han, X.; Shi, C.; Lu, M. Bacillus velezensis LF01: In vitro antimicrobial activity against fish pathogens, growth performance enhancement, and disease resistance against streptococcosis in Nile tilapia (Oreochromis niloticus). Appl. Microbiol. Biotechnol. 2019, 103, 9023–9035. [Google Scholar]
  60. Ye, M.; Tang, X.; Yang, R.; Zhang, H.; Li, F.; Tao, F.; Li, F.; Wang, Z. Characteristics and application of a novel species of Bacillus: Bacillus velezensis. ACS Chem. Biol. 2018, 13, 500–505. [Google Scholar]
Foods 11 03620 g001 550
Figure 1. Inhibitory effect of bacterial isolates against A. flavus. (A) Plate confrontation antagonism test and colony pictures were taken at four days post-inoculation. Scale bars represent 10 mm. (B) Growth of A. flavus when A. flavus only (CK) and inhibited by different bacterial isolates such as B1, B2, B3, B4, B5, B6, B7, B8, B9 and B10. The star (*) indicates that the growth of A. flavus when inhibited by the bacterial isolate is significantly slower than CK (p < 0.05). Inhibitory effect assays were repeated three times with three replicates per repeat.
Figure 1. Inhibitory effect of bacterial isolates against A. flavus. (A) Plate confrontation antagonism test and colony pictures were taken at four days post-inoculation. Scale bars represent 10 mm. (B) Growth of A. flavus when A. flavus only (CK) and inhibited by different bacterial isolates such as B1, B2, B3, B4, B5, B6, B7, B8, B9 and B10. The star (*) indicates that the growth of A. flavus when inhibited by the bacterial isolate is significantly slower than CK (p < 0.05). Inhibitory effect assays were repeated three times with three replicates per repeat.
Foods 11 03620 g001
Foods 11 03620 g002 550
Figure 2. Identification of bacterial isolates B1 and B2 from morphologies and genetics. (A) Morphology and Gram staining of B1 and B2. Colony pictures were taken at four days post-inoculation by applying 5 μL of a bacterial suspension on the center of a LB plate (diameter 9 cm). (C) Phylogenetic trees were constructed by the neighbor-joining method based on 16S rDNA gene sequences (B), respectively showing the phylogenetic relationships of strain B1 (I) and B2 (II) and related species; numbers on branches are the bootstrap values that were based on 1050 replicates, and the scale bar indicates 0.002 substitutions per nucleotide position.
Figure 2. Identification of bacterial isolates B1 and B2 from morphologies and genetics. (A) Morphology and Gram staining of B1 and B2. Colony pictures were taken at four days post-inoculation by applying 5 μL of a bacterial suspension on the center of a LB plate (diameter 9 cm). (C) Phylogenetic trees were constructed by the neighbor-joining method based on 16S rDNA gene sequences (B), respectively showing the phylogenetic relationships of strain B1 (I) and B2 (II) and related species; numbers on branches are the bootstrap values that were based on 1050 replicates, and the scale bar indicates 0.002 substitutions per nucleotide position.
Foods 11 03620 g002
Foods 11 03620 g003 550
Figure 3. Conidial yields (mean ± SE) of A. flavus and A. flavus antagonized by B1 and B2. Conidial yields were determined at 10 days post-inoculation. The star (*) indicates that A. flavus inhibited by B1 and B2 both produce significantly less conidia than the control (p < 0.05).
Figure 3. Conidial yields (mean ± SE) of A. flavus and A. flavus antagonized by B1 and B2. Conidial yields were determined at 10 days post-inoculation. The star (*) indicates that A. flavus inhibited by B1 and B2 both produce significantly less conidia than the control (p < 0.05).
Foods 11 03620 g003
Foods 11 03620 g004 550
Figure 4. DEGs analysis of A. flavus antagonized by B2 compared to no antagonism.
Figure 4. DEGs analysis of A. flavus antagonized by B2 compared to no antagonism.
Foods 11 03620 g004
Foods 11 03620 g005 550
Figure 5. GO terms analysis of DEGs in A. flavus antagonized by B2. Red columns stand for up-regulated genes and blue for down-regulated genes. The GO term enriched for core DEGs was marked with a red box.
Figure 5. GO terms analysis of DEGs in A. flavus antagonized by B2. Red columns stand for up-regulated genes and blue for down-regulated genes. The GO term enriched for core DEGs was marked with a red box.
Foods 11 03620 g005
Table
Table 1. Related genes involved in the growth of A. flavus and aflatoxin synthesis.
Table 1. Related genes involved in the growth of A. flavus and aflatoxin synthesis.
PathwayGene IDGene DescriptionLog2FCStyle
Aflatoxin biosynthetic processAFLA_3422Aldo/keto reductase family9.50up
AFLA_860Cytochrome P4508.23up
Ribosome synthesisAFLA_2355350s ribosome-binding GTPase11.03up
AFLA_1926550s ribosome-binding GTPase11.05up
AFLA_702750s ribosome-binding GTPase9.39up
Biosynthetic processAFLA_1792Biosynthesis of secondary metabolites−2.56down
AFLA_2285Biosynthesis of secondary metabolites−2.24down
Energy metabolismAFLA_2285Glycolysis/gluconeogenesis−2.24down
Folding, sorting and degradationAFLA_18974Protein processing in Endoplasmic reticulum−2.17down
AFLA_12766Protein processing in Endoplasmic reticulum−1.81down
CatabolismAFLA_3999Carbon metabolism−1.65down
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wu, Q.; Li, H.; Wang, S.; Zhang, Z.; Zhang, Z.; Jin, T.; Hu, X.; Zeng, G. Differential Expression of Genes Related to Growth and Aflatoxin Synthesis in Aspergillus flavus When Inhibited by Bacillus velezensis Strain B2. Foods 2022, 11, 3620. https://doi.org/10.3390/foods11223620

AMA Style

Wu Q, Li H, Wang S, Zhang Z, Zhang Z, Jin T, Hu X, Zeng G. Differential Expression of Genes Related to Growth and Aflatoxin Synthesis in Aspergillus flavus When Inhibited by Bacillus velezensis Strain B2. Foods. 2022; 11(22):3620. https://doi.org/10.3390/foods11223620

Chicago/Turabian Style

Wu, Qiaoyun, Huanhuan Li, Sunxing Wang, Zhongnian Zhang, Zhipeng Zhang, Tuwei Jin, Xiufang Hu, and Guohong Zeng. 2022. "Differential Expression of Genes Related to Growth and Aflatoxin Synthesis in Aspergillus flavus When Inhibited by Bacillus velezensis Strain B2" Foods 11, no. 22: 3620. https://doi.org/10.3390/foods11223620

APA Style

Wu, Q., Li, H., Wang, S., Zhang, Z., Zhang, Z., Jin, T., Hu, X., & Zeng, G. (2022). Differential Expression of Genes Related to Growth and Aflatoxin Synthesis in Aspergillus flavus When Inhibited by Bacillus velezensis Strain B2. Foods, 11(22), 3620. https://doi.org/10.3390/foods11223620

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop