Spirobenzofuran Mitigates Ochratoxin A-Mediated Intestinal Adverse Effects in Pigs through Regulation of Beta Defensin 1
Abstract
:1. Introduction
2. Materials and Methods
2.1. Culture and Treatment in IPEC-J2 Cells
2.2. Cell Viability
2.3. Scratch Assay
2.4. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)
2.5. Vector Construction
2.6. Cell Selection
2.7. HTS Assay and Validation for the Discovery of AMP-Induced Natural Products
2.8. Statistical Analysis
3. Results
3.1. Effects of Ochratoxin A Treatment on Cytotoxicity, Migration, and Inflammatory Markers in IPEC-J2 Cells
3.2. Alleviative Effect of Ochratoxin A Exposure in pcBD1 Cells
3.3. High-Throughput Screening for Identifying Candidate Natural Products against Ochratoxin A Toxicity in IPEC-J2 Cells
3.4. Cytotoxicity Validation of Candidate Natural Products in IPEC-J2 Cells
3.5. DEFB1-Inducing Natural Products in IPEC-J2 Cells
3.6. Regulatory Effects of the Selected Natural Products on OTA Toxicity in IPEC-J2 Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liang, Z.; Huang, K.; Luo, Y. Ochratoxin A and ochratoxin-producing fungi on cereal grain in China: A review. Food Addit. Contam. Part A 2015, 32, 461–470. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, J.; Jiang, Y.; Duan, X.; Qu, H.; Yang, B.; Chen, F.; Sivakumar, D. Natural occurrence, analysis, and prevention of mycotoxins in fruits and their processed products. Crit. Rev. Food Sci. Nutr. 2014, 54, 64–83. [Google Scholar] [CrossRef] [PubMed]
- Duarte, S.C.; Lino, C.M.; Pena, A. Ochratoxin A in feed of food-producing animals: An undesirable mycotoxin with health and performance effects. Vet. Microbiol. 2011, 154, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, I.; Naehrer, K. Three-year survey on the worldwide occurrence of mycotoxins in feedstuffs and feed. Toxins 2012, 4, 663–675. [Google Scholar] [CrossRef] [PubMed]
- Kuiper-Goodman, T.; Scott, P.M. Risk assessment of the mycotoxin ochratoxin A. Biomed. Environ. Sci. BES 1989, 2, 179–248. [Google Scholar] [PubMed]
- Yang, C.; Song, G.; Lim, W. Effects of mycotoxin-contaminated feed on farm animals. J. Hazard. Mater. 2020, 389, 122087. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Meng, L.; Liu, H.; Wang, J.; Zheng, N. The Compromised Intestinal Barrier Induced by Mycotoxins. Toxins 2020, 12, 619. [Google Scholar] [CrossRef] [PubMed]
- Vancamelbeke, M.; Vermeire, S. The intestinal barrier: A fundamental role in health and disease. Expert Rev. Gastroenterol. Hepatol. 2017, 11, 821–834. [Google Scholar] [CrossRef] [PubMed]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
- Camilleri, M.; Madsen, K.; Spiller, R.; Van Meerveld, B.G.; Verne, G.N. Intestinal barrier function in health and gastrointestinal disease. Neurogastroenterol. Motil. 2012, 24, 503–512. [Google Scholar] [CrossRef]
- Shao, L.; Serrano, D.; Mayer, L. The role of epithelial cells in immune regulation in the gut. Semin. Immunol. 2001, 13, 163–175. [Google Scholar] [CrossRef] [PubMed]
- Parkos, C.; Colgan, S.; Delp, C.; Arnaout, M.; Madara, J. Neutrophil migration across a cultured epithelial monolayer elicits a biphasic resistance response representing sequential effects on transcellular and paracellular pathways. J. Cell Biol. 1992, 117, 757–764. [Google Scholar] [CrossRef] [PubMed]
- Jenssen, H.; Hamill, P.; Hancock, R.E.W. Peptide Antimicrobial Agents. Clin. Microbiol. Rev. 2006, 19, 491–511. [Google Scholar] [CrossRef] [PubMed]
- Blach-Olszewska, Z.; Leszek, J. Mechanisms of over-activated innate immune system regulation in autoimmune and neurodegenerative disorders. Neuropsychiatr. Dis. Treat. 2007, 3, 365–372. [Google Scholar]
- Mowat, A.M.; Agace, W.W. Regional specialization within the intestinal immune system. Nat. Rev. Immunol. 2014, 14, 667–685. [Google Scholar] [CrossRef]
- Ha, T.H. Recent Advances for the Detection of Ochratoxin A. Toxins 2015, 7, 5276–5300. [Google Scholar] [CrossRef]
- Zhai, S.; Zhu, Y.; Feng, P.; Li, M.; Wang, W.; Yang, L.; Yang, Y. Ochratoxin A: Its impact on poultry gut health and microbiota, an overview. Poult. Sci. 2021, 100, 101037. [Google Scholar] [CrossRef]
- Yoon, J.W.; Shin, S.; Park, J.; Lee, B.R.; Lee, S.I. TLR/MyD88-Mediated Inflammation Induced in Porcine Intestinal Epithelial Cells by Ochratoxin A Affects Intestinal Barrier Function. Toxics 2023, 11, 437. [Google Scholar] [CrossRef] [PubMed]
- Hirsch, T.; Metzig, M.; Niederbichler, A.; Steinau, H.-U.; Eriksson, E.; Steinstraesser, L. Role of host defense peptides of the innate immune response in sepsis. Shock 2008, 30, 117–126. [Google Scholar] [CrossRef]
- Wan, M.L.-Y.; Woo, C.-S.J.; Allen, K.J.; Turner, P.C.; El-Nezami, H. Modulation of porcine β-defensins 1 and 2 upon individual and combined fusarium toxin exposure in a swine jejunal epithelial cell line. Appl. Environ. Microbiol. 2013, 79, 2225–2232. [Google Scholar] [CrossRef]
- Ramasundara, M.; Leach, S.T.; A Lemberg, D.; Day, A.S. Defensins and inflammation: The role of defensins in inflammatory bowel disease. J. Gastroenterol. Hepatol. 2009, 24, 202–208. [Google Scholar] [CrossRef]
- Yamasaki, K.; Gallo, R.L. Antimicrobial peptides in human skin disease. Eur. J. Dermatol. 2008, 18, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Lyu, W.; Zhang, W.; Chen, Y.; Luo, F.; Wang, Y.; Ji, H.; Zhang, G. Discovery of natural products capable of inducing porcine host defense peptide gene expression using cell-based high throughput screening. J. Anim. Sci. Biotechnol. 2021, 12, 14. [Google Scholar] [CrossRef]
- Wu, J.; Ma, N.; Johnston, L.J.; Ma, X. Dietary Nutrients Mediate Intestinal Host Defense Peptide Expression. Adv. Nutr. Int. Rev. J. 2020, 11, 92–102. [Google Scholar] [CrossRef] [PubMed]
- Robinson, K.; Deng, Z.; Hou, Y.; Zhang, G. Regulation of the Intestinal Barrier Function by Host Defense Peptides. Front. Vet.-Sci. 2015, 2, 57. [Google Scholar] [CrossRef] [PubMed]
- Lan, J.; Dou, X.; Li, J.; Yang, Y.; Xue, C.; Wang, C.; Gao, N.; Shan, A. l-Arginine Ameliorates Lipopolysaccharide-Induced Intestinal Inflammation through Inhibiting the TLR4/NF-κB and MAPK Pathways and Stimulating β-Defensin Expression in Vivo and in Vitro. J. Agric. Food Chem. 2020, 68, 2648–2663. [Google Scholar] [CrossRef] [PubMed]
- Wehkamp, J.; Fellermann, K.; Herrlinger, K.R.; Bevins, C.L.; Stange, E.F. Mechanisms of Disease: Defensins in gastrointestinal diseases. Nat. Clin. Pract. Gastroenterol. Hepatol. 2005, 2, 406–415. [Google Scholar] [CrossRef]
- Bhandari, D.; Rafiq, S.; Gat, Y.; Gat, P.; Waghmare, R.; Kumar, V. A review on bioactive peptides: Physiological functions, bioavailability and safety. Int. J. Pept. Res. Ther. 2020, 26, 139–150. [Google Scholar] [CrossRef]
- Zaky, A.A.; Simal-Gandara, J.; Eun, J.-B.; Shim, J.-H.; El-Aty, A.M.A. Bioactivities, Applications, Safety, and Health Benefits of Bioactive Peptides From Food and By-Products: A Review. Front. Nutr. 2021, 8, 815640. [Google Scholar] [CrossRef]
- Bechaux, J.; Gatellier, P.; Le Page, J.-F.; Drillet, Y.; Sante-Lhoutellier, V. A comprehensive review of bioactive peptides obtained from animal byproducts and their applications. Food Funct. 2019, 10, 6244–6266. [Google Scholar] [CrossRef]
- Yoon, J.W.; Lee, S.I. Gene expression profiling after ochratoxin A treatment in small intestinal epithelial cells from pigs. J. Anim. Sci. Technol. 2022, 64, 842–853. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Yan, A.; Liu, X.; Ma, Y.; Zhao, F.; Wang, M.; Loor, J.J.; Wang, H. Melatonin ameliorates ochratoxin A induced liver inflammation, oxidative stress and mitophagy in mice involving in intestinal microbiota and restoring the intestinal barrier function. J. Hazard. Mater. 2021, 407, 124489. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhai, N.; Chen, Y.; Fu, C.; Huang, K. OTA induces intestinal epithelial barrier dysfunction and tight junction disruption in IPEC-J2 cells through ROS/Ca2+-mediated MLCK activation. Environ. Pollut. 2018, 242, 106–112. [Google Scholar] [CrossRef] [PubMed]
- Pierron, A.; Alassane-Kpembi, I.; Oswald, I.P. Impact of mycotoxin on immune response and consequences for pig health. Anim. Nutr. 2016, 2, 63–68. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.I.; Kim, I.H. Nucleotide-mediated SPDEF modulates TFF3-mediated wound healing and intestinal barrier function during the weaning process. Sci. Rep. 2018, 8, 4827. [Google Scholar] [CrossRef] [PubMed]
- Heath, J.P. Epithelial cell migration in the intestine. Cell Biol. Int. 1996, 20, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Mangoni, M.L.; McDermott, A.M.; Zasloff, M. Antimicrobial peptides and wound healing: Biological and therapeutic considerations. Exp. Dermatol. 2016, 25, 167–173. [Google Scholar] [CrossRef]
- Sturm, A.; Dignass, A.U. Epithelial restitution and wound healing in inflammatory bowel disease. World J. Gastroenterol. 2008, 14, 348–353. [Google Scholar] [CrossRef]
- Koch, S.; Nava, P.; Addis, C.; Kim, W.; Denning, T.L.; Li, L.; Parkos, C.A.; Nusrat, A. The wnt antagonist dkk1 regulates intestinal epithelial homeostasis and wound repair. Gastroenterology 2011, 141, 259–268.e8. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Ye, Q.; Bao, X.; Huang, X.; Wang, J.; Zheng, N. Transcriptomic and proteomic profiling reveals the intestinal immunotoxicity induced by aflatoxin M1 and ochratoxin A. Toxicon 2020, 180, 49–61. [Google Scholar] [CrossRef]
- Wang, S.; Thacker, P.A.; Watford, M.; Qiao, S. Functions of Antimicrobial Peptides in Gut Homeostasis. Curr. Protein Pept. Sci. 2015, 16, 582–591. [Google Scholar] [CrossRef] [PubMed]
- Hancock, R.E.W.; Haney, E.F.; Gill, E.E. The immunology of host defence peptides: Beyond antimicrobial activity. Nat. Rev. Immunol. 2016, 16, 321–334. [Google Scholar] [CrossRef]
- Zhao, X.; Wang, L.; Zhu, C.; Xia, X.; Zhang, S.; Wang, Y.; Zhang, H.; Xu, Y.; Chen, S.; Jiang, J.; et al. The Antimicrobial Peptide Mastoparan X Protects Against Enterohemorrhagic Escherichia coli O157:H7 Infection, Inhibits Inflammation, and Enhances the Intestinal Epithelial Barrier. Front. Microbiol. 2021, 12, 644887. [Google Scholar] [CrossRef] [PubMed]
- Iimura, M.; Gallo, R.L.; Hase, K.; Miyamoto, Y.; Eckmann, L.; Kagnoff, M.F. Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J. Immunol. 2005, 174, 4901–4907. [Google Scholar] [CrossRef] [PubMed]
- Ren, M.; Zhang, S.; Liu, X.; Li, S.; Mao, X.; Zeng, X.; Qiao, S. Different Lipopolysaccharide Branched-Chain Amino Acids Modulate Porcine Intestinal Endogenous β-Defensin Expression through the Sirt1/ERK/90RSK Pathway. J. Agric. Food Chem. 2016, 64, 3371–3379. [Google Scholar] [CrossRef]
- Wang, C.; Yang, Y.; Gao, N.; Lan, J.; Dou, X.; Li, J.; Shan, A. l-Threonine upregulates the expression of beta-defensins by activating the NF-kappa B signaling pathway and suppressing SIRT1 expression in porcine intestinal epithelial cells. Food Funct. 2021, 12, 5821–5836. [Google Scholar] [CrossRef] [PubMed]
- Saba, E.; Yun, B.-S.; Lee, I.-K.; Rhee, M.H. Spirobenzofuran (SBF): An isolate from Acremonium sp. HKI 0230 and Coprinus echinosporus suppresses inflammation in RAW 264.7 cells. Pak. J. Pharm. Sci. 2019, 32, 1919–1925. [Google Scholar]
- Popović, M.; Vukmirović, S.; Stilinović, N.; Čapo, I.; Jakovljević, V. Anti-oxidative activity of an aqueous suspension of commercial preparation of the mushroom Coprinus comatus. Molecules 2010, 15, 4564–4571. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Li, H.; Lai, Q.; Yang, Q.; Dong, Y.; Liu, X.; Wang, W.; Zhang, J.; Jia, L. Antioxidant and hepatoprotective activities of modified polysaccharides from Coprinus comatus in mice with alcohol-induced liver injury. Int. J. Biol. Macromol. 2019, 127, 476–485. [Google Scholar] [CrossRef]
- Nowakowski, P.; Naliwajko, S.K.; Markiewicz-Żukowska, R.; Borawska, M.H.; Socha, K. The two faces of Coprinus comatus—Functional properties and potential hazards. Phyther. Res. 2020, 34, 2932–2944. [Google Scholar] [CrossRef]
Genes | Description | Accession No. | Sequence (5′–3′) | |
---|---|---|---|---|
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | NM_001206359 | Forward | ACACCGAGCATCTCCTGACT |
Reverse | GACGAGGCAGGTCTCCCTAA | |||
TNF-α | Tumor necrosis factor α | NM_214022 | Forward | TTTCTGTGAAAACGGAGCTG |
Reverse | CAGCGATGTAGCGACAAGTT | |||
IL-1β | Interleukin-1β | NM_001305893 | Forward | GAACAAGAGCATCAGGCAGA |
Reverse | TGGCATCACAGACAAAGTCA | |||
IL-6 | Interleukin-6 | NM_001252429 | Forward | GCTTCCAATCTGGGTTCAAT |
Reverse | ATTCTTTCCCTTTTGCCTCA | |||
NF-kB | Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | NM_001048232 | Forward | TCTCTGACGGTGAAGTGTCC |
Reverse | AAGTTGGCATTTTTGGAAGG | |||
DEFB1 | Beta-defensin 1 | NM_213838 | Forward | TCCTCCTTGTATTCCTCCTCA |
Reverse | TCTGTGGGGTTGTTTCTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yoon, J.W.; Kim, M.O.; Shin, S.; Kwon, W.-S.; Kim, S.H.; Kwon, Y.-J.; Lee, S.I. Spirobenzofuran Mitigates Ochratoxin A-Mediated Intestinal Adverse Effects in Pigs through Regulation of Beta Defensin 1. Toxics 2024, 12, 487. https://doi.org/10.3390/toxics12070487
Yoon JW, Kim MO, Shin S, Kwon W-S, Kim SH, Kwon Y-J, Lee SI. Spirobenzofuran Mitigates Ochratoxin A-Mediated Intestinal Adverse Effects in Pigs through Regulation of Beta Defensin 1. Toxics. 2024; 12(7):487. https://doi.org/10.3390/toxics12070487
Chicago/Turabian StyleYoon, Jung Woong, Myoung Ok Kim, Sangsu Shin, Woo-Sung Kwon, Soo Hyun Kim, Yun-Ju Kwon, and Sang In Lee. 2024. "Spirobenzofuran Mitigates Ochratoxin A-Mediated Intestinal Adverse Effects in Pigs through Regulation of Beta Defensin 1" Toxics 12, no. 7: 487. https://doi.org/10.3390/toxics12070487