Antioxidant and Anti-Inflammatory Properties of Hydrolyzed Royal Jelly Peptide in Human Dermal Fibroblasts: Implications for Skin Health and Care Applications
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Hydrolyzed RIP
2.2. Isolation and Cultivation of Primary HDFs
2.3. Cell Viability
2.4. Detection of ROS and Lipid ROS
2.5. Measurement of Malondialdehyde (MDA) and Glutathione (GSH)
2.6. Evaluation of Glutathione Peroxidase 4 (GPX4) and Catalase (CAT) Activity
2.7. Oxygen Radical Absorbance Capacity (ORAC) Assay
2.8. Iron Chelating Assay
2.9. Measurement of Free Iron in HDFs
2.10. IL-1β Measurement by ELISA
2.11. Western Blot
2.12. qPCR
2.13. Statistical Analysis
3. Results
3.1. RJP Inhibits Oxidative Damage Induced by H2O2
3.2. RJP Counteracts Lipid Peroxidation Triggered by AAPH and t-BuOOH
3.3. RJP Restores Antioxidative Capacity and Intracellular Iron Homeostasis in HDFs
3.4. RJP Augments the Activity of the Lipid Peroxidation Inhibitor GPX4
3.5. RJP Suppresses the Expression of NLRP3 Inflammasome Components Initiated by LPS
3.6. RJP Hinders the Activation of NLRP3 Inflammasome
3.7. RJP Represses COX2 and iNOS Expressions in LPS-Stimulated HDFs
3.8. RJP Exhibits Superior Antioxidant and Anti-Inflammatory Properties over Royal Jelly Protein
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Venus, M.; Waterman, J.; McNab, I. Basic physiology of the skin. Surgery 2010, 28, 469–472. [Google Scholar]
- Lai-Cheong, J.E.; McGrath, J.A. Structure and function of skin, hair and nails. Medicine 2021, 49, 337–342. [Google Scholar] [CrossRef]
- Zhao, X.; Psarianos, P.; Ghoraie, L.S.; Yip, K.; Goldstein, D.; Gilbert, R.; Witterick, I.; Pang, H.; Hussain, A.; Lee, J.H.; et al. Metabolic regulation of dermal fibroblasts contributes to skin extracellular matrix homeostasis and fibrosis. Nat. Metab. 2019, 1, 147–157. [Google Scholar] [CrossRef]
- Cole, M.A.; Quan, T.; Voorhees, J.J.; Fisher, G.J. Extracellular matrix regulation of fibroblast function: Redefining our perspective on skin aging. J. Cell Commun. Signal. 2018, 12, 35–43. [Google Scholar] [CrossRef]
- Thulabandu, V.; Chen, D.; Atit, R.P. Dermal fibroblast in cutaneous development and healing. Wires. Dev. Biol. 2018, 7, e307. [Google Scholar] [CrossRef]
- Nakai, K.; Tsuruta, D. What are reactive oxygen species, free radicals, and oxidative stress in skin diseases? Int. J. Mol. Sci. 2021, 22, 10799. [Google Scholar] [CrossRef]
- Wolf, J.; Weinberger, B.; Arnold, C.R.; Maier, A.B.; Westendorp, R.G.; Grubeck-Loebenstein, B. The effect of chronological age on the inflammatory response of human fibroblasts. Exp. Gerontol. 2012, 47, 749–753. [Google Scholar] [CrossRef]
- Lan, C.-C.E.; Hung, Y.-T.; Fang, A.-H.; Ching-Shuang, W. Effects of irradiance on UVA-induced skin aging. J. Dermatol. Sci. 2019, 94, 220–228. [Google Scholar] [CrossRef]
- Meewes, C.; Brenneisen, P.; Wenk, J.; Kuhr, L.; Ma, W.; Alikoski, J.; Poswig, A.; Krieg, T.; Scharffetter-Kochanek, K. Adaptive antioxidant response protects dermal fibroblasts from UVA-induced phototoxicity. Free Radic. Biol. Med. 2001, 30, 238–247. [Google Scholar] [CrossRef]
- Poljšak, B.; Dahmane, R.G.; Godić, A. Intrinsic skin aging: The role of oxidative stress. Acta Dermatoven. Alp. 2012, 21, 33–36. [Google Scholar]
- Shindo, Y.; Witt, E.; Han, D.; Epstein, W.; Packer, L. Enzymic and non-enzymic antioxidants in epidermis and dermis of human skin. J. Investig. Dermatol. 1994, 102, 122–124. [Google Scholar] [CrossRef]
- Avery, S.V. Molecular targets of oxidative stress. Biochem. J. 2011, 434, 201–210. [Google Scholar] [CrossRef]
- Widmer, R.; Ziaja, I.; Grune, T. Protein oxidation and degradation during aging: Role in skin aging and neurodegeneration. Free Radic. Res. 2006, 40, 1259–1268. [Google Scholar] [CrossRef]
- Pfisterer, K.; Shaw, L.E.; Symmank, D.; Weninger, W. The extracellular matrix in skin inflammation and infection. Front. Cell Dev. Biol. 2021, 9, 682414. [Google Scholar] [CrossRef]
- Han, Y.-P.; Tuan, T.-L.; Wu, H.; Hughes, M.; Garner, W.L. TNF-α stimulates activation of pro-MMP2 in human skin through NF-κB mediated induction of MT1-MMP. J. Cell Sci. 2001, 114, 131–139. [Google Scholar] [CrossRef]
- Mavrogonatou, E.; Konstantinou, A.; Kletsas, D. Long-term exposure to TNF-α leads human skin fibroblasts to a p38 MAPK-and ROS-mediated premature senescence. Biogerontology 2018, 19, 237–249. [Google Scholar] [CrossRef]
- Buckley, C.D. Why does chronic inflammation persist: An unexpected role for fibroblasts. Immunol. Lett. 2011, 138, 12–14. [Google Scholar] [CrossRef]
- Davidson, S.; Coles, M.; Thomas, T.; Kollias, G.; Ludewig, B.; Turley, S.; Brenner, M.; Buckley, C.D. Fibroblasts as immune regulators in infection, inflammation and cancer. Nat. Rev. Immunol. 2021, 21, 704–717. [Google Scholar] [CrossRef]
- Bogdanov, S. Royal jelly, bee brood: Composition, health, medicine: A review. Lipids 2011, 3, 8–19. [Google Scholar]
- Furusawa, T.; Rakwal, R.; Nam, H.W.; Shibato, J.; Agrawal, G.K.; Kim, Y.S.; Ogawa, Y.; Yoshida, Y.; Kouzuma, Y.; Masuo, Y.; et al. Comprehensive royal jelly (RJ) proteomics using one-and two-dimensional proteomics platforms reveals novel RJ proteins and potential phospho/glycoproteins. J. Proteome Res. 2008, 7, 3194–3229. [Google Scholar] [CrossRef]
- Li, S.; Tao, L.; Yu, X.; Zheng, H.; Wu, J.; Hu, F. Royal jelly proteins and their derived peptides: Preparation, properties, and biological activities. J. Agric. Food Chem. 2021, 69, 14415–14427. [Google Scholar] [CrossRef]
- Yan, C.-Y.; Sun, J.; Yu, G.-Y.; Huang, R.-P.; Han, S.-C.; Zhang, Q.-Y.; Li, X.-M.; Yan, J.-G.; Kurihara, H.; Li, W.-X.; et al. Tripeptide Leu-Pro-Phe from Corn Protein Hydrolysates Attenuates Hyperglycemia-Induced Neural Tube Defect in Chicken Embryos. Oxid. Med. Cell. Longev. 2022, 2022, 4932304. [Google Scholar] [CrossRef]
- Zitka, O.; Skalickova, S.; Gumulec, J.; Masarik, M.; Adam, V.; Hubalek, J.; Trnkova, L.; Kruseova, J.; Eckschlager, T.; Kizek, R. Redox status expressed as GSH: GSSG ratio as a marker for oxidative stress in paediatric tumour patients. Oncol. Lett. 2012, 4, 1247–1253. [Google Scholar] [CrossRef]
- Guéraud, F.; Atalay, M.; Bresgen, N.; Cipak, A.; Eckl, P.M.; Huc, L.; Jouanin, I.; Siems, W.; Uchida, K. Chemistry and biochemistry of lipid peroxidation products. Free Radic. Res. 2010, 44, 1098–1124. [Google Scholar] [CrossRef]
- Drummen, G.P.; van Liebergen, L.C.; den Kamp, J.A.O.; Post, J.A. C11-BODIPY581/591, an oxidation-sensitive fluorescent lipid peroxidation probe:(micro) spectroscopic characterization and validation of methodology. Free Radic. Biol. Med. 2002, 33, 473–490. [Google Scholar] [CrossRef]
- Dev, S.; Kumari, S.; Singh, N.; Bal, S.K.; Seth, P.; Mukhopadhyay, C.K. Role of extracellular Hydrogen peroxide in regulation of iron homeostasis genes in neuronal cells: Implication in iron accumulation. Free Radic. Biol. Med. 2015, 86, 78–89. [Google Scholar] [CrossRef]
- Maiorino, M.; Conrad, M.; Ursini, F. GPx4, lipid peroxidation, and cell death: Discoveries, rediscoveries, and open issues. Antioxid. Redox Sign. 2018, 29, 61–74. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Ouyang, M.; Qu, Y.; Wang, M.; Huang, X.; Lan, J.; Lai, W.; Xu, Q. Advanced glycation end products promote melanogenesis by activating NLRP3 inflammasome in human dermal fibroblasts. J. Investig. Dermatol. 2022, 142, 2591–2602. [Google Scholar] [CrossRef] [PubMed]
- Swanson, K.V.; Deng, M.; Ting, J.P.-Y. The NLRP3 inflammasome: Molecular activation and regulation to therapeutics. Nat. Rev. Immunol. 2019, 19, 477–489. [Google Scholar] [CrossRef]
- Mangan, M.S.; Olhava, E.J.; Roush, W.R.; Seidel, H.M.; Glick, G.D.; Latz, E. Targeting the NLRP3 inflammasome in inflammatory diseases. Nat. Rev. Drug Discov. 2018, 17, 588–606. [Google Scholar] [CrossRef]
- Cullen, S.P.; Kearney, C.J.; Clancy, D.M.; Martin, S.J. Diverse activators of the NLRP3 inflammasome promote IL-1β secretion by triggering necrosis. Cell Rep. 2015, 11, 1535–1548. [Google Scholar] [CrossRef]
- Perregaux, D.; Gabel, C.A. Interleukin-1 beta maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activity. J. Biol. Chem. 1994, 269, 15195–15203. [Google Scholar] [CrossRef]
- Martinon, F.; Pétrilli, V.; Mayor, A.; Tardivel, A.; Tschopp, J. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature 2006, 440, 237–241. [Google Scholar] [CrossRef]
- Chen, Y.-C.; Yang, L.-L.; Lee, T.J. Oroxylin A inhibition of lipopolysaccharide-induced iNOS and COX-2 gene expression via suppression of nuclear factor-κB activation. Biochem. Pharmacol. 2000, 59, 1445–1457. [Google Scholar] [CrossRef] [PubMed]
- Kendall, A.C.; Nicolaou, A. Bioactive lipid mediators in skin inflammation and immunity. Prog. Lipid Res. 2013, 52, 141–164. [Google Scholar] [CrossRef] [PubMed]
- Chu, C.-C.; Di Meglio, P.; Nestle, F.O. Harnessing dendritic cells in inflammatory skin diseases. Semin. Immunol. 2011, 23, 28–41. [Google Scholar] [CrossRef] [PubMed]
- Fatmawati, F.; Erizka, E.; Hidayat, R. Royal jelly (bee product) decreases inflammatory response in Wistar rats induced with ultraviolet radiation. Open Access Maced. J. Med. Sci. 2019, 7, 2723–2727. [Google Scholar] [CrossRef] [PubMed]
- Park, H.M.; Cho, M.H.; Cho, Y.; Kim, S.Y. Royal jelly increases collagen production in rat skin after ovariectomy. J. Med. Food 2012, 15, 568–575. [Google Scholar] [CrossRef] [PubMed]
- Park, H.M.; Hwang, E.; Lee, K.G.; Han, S.-M.; Cho, Y.; Kim, S.Y. Royal jelly protects against ultraviolet B–induced photoaging in human skin fibroblasts via enhancing collagen production. J. Med. Food 2011, 14, 899–906. [Google Scholar] [CrossRef]
- Li, S.; Tao, L.; Peng, S.; Yu, X.; Ma, X.; Hu, F. Structural and antioxidative properties of royal jelly protein by partial enzymatic hydrolysis. Food Sci. Hum. Wellness 2023, 12, 1820–1827. [Google Scholar] [CrossRef]
- Mo, Q.; Fu, H.; Zhao, D.; Zhang, J.; Wang, C.; Wang, D.; Li, M. Protective effects of mogroside v on oxidative stress induced by H2O2 in skin fibroblasts. Drug Des. Dev. Ther. 2021, 15, 4901–4909. [Google Scholar] [CrossRef] [PubMed]
- Buranasudja, V.; Muangnoi, C.; Sanookpan, K.; Halim, H.; Sritularak, B.; Rojsitthisak, P. Eriodictyol attenuates H2O2-Induced oxidative damage in human dermal fibroblasts through enhanced capacity of antioxidant machinery. Nutrients 2022, 14, 2553. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.-H.; Wu, P.-Y.; Wen, K.-C.; Lin, C.-Y.; Chiang, H.-M. Protective effects and mechanisms of Terminalia catappa L. methenolic extract on hydrogen-peroxide-induced oxidative stress in human skin fibroblasts. BMC Complement. Altern. Med. 2018, 18, 266. [Google Scholar] [CrossRef] [PubMed]
- Munro, D.; Banh, S.; Sotiri, E.; Tamanna, N.; Treberg, J.R. The thioredoxin and glutathione-dependent H2O2 consumption pathways in muscle mitochondria: Involvement in H2O2 metabolism and consequence to H2O2 efflux assays. Free Radic. Biol. Med. 2016, 96, 334–346. [Google Scholar] [CrossRef] [PubMed]
- Ingold, I.; Berndt, C.; Schmitt, S.; Doll, S.; Poschmann, G.; Buday, K.; Roveri, A.; Peng, X.; Freitas, F.P.; Seibt, T.; et al. Selenium utilization by GPX4 is required to prevent hydroperoxide-induced ferroptosis. Cell 2018, 172, 409–422. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.; Wan, X.; Yu, G.-Y.; Jiang, S.; Yi, R.-N.; Wu, Y.-P.; Ouyang, S.-H.; Liang, L.; Kurihara, H.; Sun, W.-Y.; et al. Phospholipid peroxidation-driven modification of chondrogenic transcription factor mediates alkoxyl radicals-induced impairment of embryonic bone development. Redox Biol. 2022, 56, 102437. [Google Scholar] [CrossRef]
- Wenz, C.; Faust, D.; Linz, B.; Turmann, C.; Nikolova, T.; Bertin, J.; Gough, P.; Wipf, P.; Schröder, A.S.; Krautwald, S.; et al. t-BuOOH induces ferroptosis in human and murine cell lines. Arch. Toxicol. 2018, 92, 759–775. [Google Scholar] [CrossRef]
- Liu, L.; Pang, J.; Qin, D.; Li, R.; Zou, D.; Chi, K.; Wu, W.; Rui, H.; Yu, H.; Zhu, W.; et al. Deubiquitinase OTUD5 as a Novel Protector against 4-HNE-Triggered Ferroptosis in Myocardial Ischemia/Reperfusion Injury. Adv. Sci. 2023, 10, 2301852. [Google Scholar] [CrossRef]
- Guo, H.; Ekusa, A.; Iwai, K.; Yonekura, M.; Takahata, Y.; Morimatsu, F. Royal jelly peptides inhibit lipid peroxidation in vitro and in vivo. J. Nutr. Sci. Vitaminol. 2008, 54, 191–195. [Google Scholar] [CrossRef]
- Nagai, T.; Inoue, R.; Suzuki, N.; Nagashima, T. Antioxidant properties of enzymatic hydrolysates from royal jelly. J. Med. Food 2006, 9, 363–367. [Google Scholar] [CrossRef]
- Stoyanovsky, D.; Tyurina, Y.; Shrivastava, I.; Bahar, I.; Tyurin, V.; Protchenko, O.; Jadhav, S.; Bolevich, S.; Kozlov, A.; Vladimirov, Y.; et al. Iron catalysis of lipid peroxidation in ferroptosis: Regulated enzymatic or random free radical reaction? Free Radic. Biol. Med. 2019, 133, 153–161. [Google Scholar] [CrossRef]
- Agrawal, R.; Hu, A.; Bollag, W.B. The Skin and Inflamm-Aging. Biology 2023, 12, 1396. [Google Scholar] [CrossRef] [PubMed]
- Bauernfeind, F.G.; Horvath, G.; Stutz, A.; Alnemri, E.S.; MacDonald, K.; Speert, D.; Fernandes-Alnemri, T.; Wu, J.; Monks, B.G.; Fitzgerald, K.A.; et al. Cutting edge: NF-κB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J. Immunol. 2009, 183, 787–791. [Google Scholar] [CrossRef]
- You, M.-M.; Chen, Y.-F.; Pan, Y.-M.; Liu, Y.-C.; Tu, J.; Wang, K.; Hu, F.-L. Royal jelly attenuates LPS-induced inflammation in BV-2 microglial cells through modulating NF-κB and p38/JNK signaling pathways. Mediat. Inflamm. 2018, 2018, 7834381. [Google Scholar] [CrossRef] [PubMed]
- Feldmeyer, L.; Werner, S.; French, L.E.; Beer, H.-D. Interleukin-1, inflammasomes and the skin. Eur. J. Cell Biol. 2010, 89, 638–644. [Google Scholar] [CrossRef]
- He, Y.; Hara, H.; Núñez, G. Mechanism and regulation of NLRP3 inflammasome activation. Trends Biochem. Sci. 2016, 41, 1012–1021. [Google Scholar] [CrossRef]
- Yan, C.-Y.; Ouyang, S.-H.; Wang, X.; Wu, Y.-P.; Sun, W.-Y.; Duan, W.-J.; Liang, L.; Luo, X.; Kurihara, H.; Li, Y.-F.; et al. Celastrol ameliorates Propionibacterium acnes/LPS-induced liver damage and MSU-induced gouty arthritis via inhibiting K63 deubiquitination of NLRP3. Phytomedicine 2021, 80, 153398. [Google Scholar] [CrossRef] [PubMed]
- Fink, S.L.; Cookson, B.T. Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages. Cell. Microbiol. 2006, 8, 1812–1825. [Google Scholar] [CrossRef]
- Sun, X.; Acquah, C.; Aluko, R.E.; Udenigwe, C.C. Considering food matrix and gastrointestinal effects in enhancing bioactive peptide absorption and bioavailability. J. Funct. Foods 2020, 64, 103680. [Google Scholar] [CrossRef]
- Guo, H.; Kouzuma, Y.; Yonekura, M. Structures and properties of antioxidative peptides derived from royal jelly protein. Food Chem. 2009, 113, 238–245. [Google Scholar] [CrossRef]
Amino Acid | Composition (%) |
---|---|
Asp | 6.97 |
Thr | 1.32 |
Ser | 1.82 |
Glu | 4.21 |
Gly | 1.33 |
Ala | 1.44 |
Val | 2.34 |
Met | 0.40 |
Ile | 3.01 |
Leu | 4.83 |
Tyr | 2.81 |
Phe | 2.20 |
His | 0.59 |
Lys | 1.97 |
Arg | 1.41 |
Pro | 1.75 |
Gene | Species | Sequence (5′-3′) |
---|---|---|
NLRP3 | Human | Forward: TGCCCGTCTGGGTGAGA |
Reverse: CCGGTGCTCCTTGATGAGA | ||
ASC | Human | Forward: GCCAGGCCTGCACTTTATAGA |
Reverse: GTTTGTGACCCTCGCGATAAG | ||
CASP-1 | Human | Forward: ATACCAAGAACTGCCCAAGTTTG |
Reverse: GGCAGGCCTGGATGATGA | ||
IL-1β | Human | Forward: CCACAGACCTTCCAGGAGAATG |
Reverse: GTGCAGTTCAGTGATCGTACAGG | ||
COX2 | Human | Forward: CGGTGAAACTCTGGCTAGACAG |
Reverse: GCAAACCGTAGATGCTCAGGGA | ||
iNOS | Human | Forward: GCTCTACACCTCCAATGTGACC |
Reverse: CTGCCGAGATTTGAGCCTCATG | ||
GAPDH | Human | Forward: GTCTCCTCTGACTTCAACAGCG |
Reverse: ACCACCCTGTTGCTGTAGCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, C.-Y.; Zhu, Q.-Q.; Guan, C.-X.; Xiong, G.-L.; Chen, X.-X.; Gong, H.-B.; Li, J.-W.; Ouyang, S.-H.; Kurihara, H.; Li, Y.-F.; et al. Antioxidant and Anti-Inflammatory Properties of Hydrolyzed Royal Jelly Peptide in Human Dermal Fibroblasts: Implications for Skin Health and Care Applications. Bioengineering 2024, 11, 496. https://doi.org/10.3390/bioengineering11050496
Yan C-Y, Zhu Q-Q, Guan C-X, Xiong G-L, Chen X-X, Gong H-B, Li J-W, Ouyang S-H, Kurihara H, Li Y-F, et al. Antioxidant and Anti-Inflammatory Properties of Hydrolyzed Royal Jelly Peptide in Human Dermal Fibroblasts: Implications for Skin Health and Care Applications. Bioengineering. 2024; 11(5):496. https://doi.org/10.3390/bioengineering11050496
Chicago/Turabian StyleYan, Chang-Yu, Qian-Qian Zhu, Cheng-Xi Guan, Gui-Lan Xiong, Xin-Xing Chen, Hai-Biao Gong, Jia-Wei Li, Shu-Hua Ouyang, Hiroshi Kurihara, Yi-Fang Li, and et al. 2024. "Antioxidant and Anti-Inflammatory Properties of Hydrolyzed Royal Jelly Peptide in Human Dermal Fibroblasts: Implications for Skin Health and Care Applications" Bioengineering 11, no. 5: 496. https://doi.org/10.3390/bioengineering11050496