Isolation and Genomic Characterization of a Novel Porcine Reproductive and Respiratory Syndrome Virus 1 from Severely Diseased Piglets in China in 2024
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical Sample Collection and Detection
2.2. Virus Isolation and Immunofluorescence Assay (IFA)
2.3. Western Blotting (WB)
2.4. Genomic Sequencing
2.5. Multiple Alignment, Phylogenetic Analysis and Recombination Detection
2.6. Statistical Analysis
3. Results
3.1. PRRSV-1 Detection
3.2. PRRSV-1 Isolation
3.3. Genomic Comparison
3.4. Phylogenetic Analysis
3.5. Recombination Detection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Cohen, J. Meat from gene-edited pigs could hit the market. Science 2024, 383, 940–941. [Google Scholar] [CrossRef] [PubMed]
- Cavanagh, D. Nidovirales: A new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 1997, 142, 629–633. [Google Scholar]
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Dempsey, D.M.; Dutilh, B.E.; Harrach, B.; Harrison, R.L.; Hendrickson, R.C.; et al. Changes to virus taxonomy and the Statutes ratified by the International Committee on Taxonomy of Viruses (2020). Arch. Virol. 2020, 165, 2737–2748. [Google Scholar] [CrossRef] [PubMed]
- Stadejek, T.; Larsen, L.E.; Podgorska, K.; Botner, A.; Botti, S.; Dolka, I.; Fabisiak, M.; Heegaard, P.M.H.; Hjulsager, C.K.; Huc, T.; et al. Pathogenicity of three genetically diverse strains of PRRSV Type 1 in specific pathogen free pigs. Vet. Microbiol. 2017, 209, 13–19. [Google Scholar] [CrossRef] [PubMed]
- Yim-Im, W.; Anderson, T.K.; Paploski, I.A.D.; VanderWaal, K.; Gauger, P.; Krueger, K.; Shi, M.; Main, R.; Zhang, J. Refining PRRSV-2 genetic classification based on global ORF5 sequences and investigation of their geographic distributions and temporal changes. Microbiol. Spectr. 2023, 11, e0291623. [Google Scholar] [CrossRef] [PubMed]
- Wensvoort, G.; Terpstra, C.; Pol, J.M.; ter Laak, E.A.; Bloemraad, M.; de Kluyver, E.P.; Kragten, C.; van Buiten, L.; den Besten, A.; Wagenaar, F.; et al. Mystery swine disease in The Netherlands: The isolation of Lelystad virus. Vet. Q. 1991, 13, 121–130. [Google Scholar] [CrossRef] [PubMed]
- Collins, J.E.; Benfield, D.A.; Christianson, W.T.; Harris, L.; Hennings, J.C.; Shaw, D.P.; Goyal, S.M.; McCullough, S.; Morrison, R.B.; Joo, H.S.; et al. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. J. Vet. Diagn. Investig. 1992, 4, 117–126. [Google Scholar] [CrossRef] [PubMed]
- Bálint, A.; Jakab, S.; Kaszab, E.; Marton, S.; Bányai, K.; Kecskeméti, S.; Szabó, I. Spatiotemporal Distribution of PRRSV-1 Clades in Hungary with a Focus on the Era of Disease Eradication. Animals 2024, 14, 175. [Google Scholar] [CrossRef]
- Rowland, R.R.R.; Lunney, J.K. Alternative strategies for the control and elimination of PRRS. Vet. Microbiol. 2017, 209, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Albina, E. Epidemiology of porcine reproductive and respiratory syndrome (PRRS): An overview. Vet. Microbiol. 1997, 55, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Kuwahara, H.; Nunoya, T.; Tajima, M.; Kato, A.; Samejima, T. An outbreak of porcine reproductive and respiratory syndrome in Japan. J. Vet. Med. Sci. 1994, 56, 901–909. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Schneider, P.; Zhang, W.P.; Faaberg, K.S.; Nelson, E.A.; Rowland, R.R. Diversity and evolution of a newly emerged North American Type 1 porcine arterivirus: Analysis of isolates collected between 1999 and 2004. Arch. Virol. 2007, 152, 1009–1017. [Google Scholar] [CrossRef]
- Balka, G.; Hornyak, A.; Balint, A.; Kiss, I.; Kecskemeti, S.; Bakonyi, T.; Rusvai, M. Genetic diversity of porcine reproductive and respiratory syndrome virus strains circulating in Hungarian swine herds. Vet. Microbiol. 2008, 127, 128–135. [Google Scholar] [CrossRef] [PubMed]
- Prajapati, M.; Acharya, M.P.; Yadav, P.; Frossard, J.P. Farm characteristics and sero-prevalence of porcine reproductive and respiratory syndrome virus (PRRSV) antibodies in pigs of Nepal. Vet. Med. Sci. 2023, 9, 174–180. [Google Scholar] [CrossRef] [PubMed]
- Donneschi, A.; Recchia, M.; Romeo, C.; Pozzi, P.; Salogni, C.; Maisano, A.M.; Santucci, G.; Scali, F.; Faccini, S.; Boniotti, M.B.; et al. Infectious Agents Associated with Abortion Outbreaks in Italian Pig Farms from 2011 to 2021. Vet. Sci. 2024, 11, 496. [Google Scholar] [CrossRef]
- Balka, G.; Podgórska, K.; Brar, M.S.; Bálint, A.; Cadar, D.; Celer, V.; Dénes, L.; Dirbakova, Z.; Jedryczko, A.; Márton, L.; et al. Genetic diversity of PRRSV 1 in Central Eastern Europe in 1994–2014: Origin and evolution of the virus in the region. Sci. Rep. 2018, 8, 7811. [Google Scholar] [CrossRef] [PubMed]
- Guo, B.Q.; Chen, Z.S.; Liu, W.; Cui, Y.Z. Isolation and identification of porcine reproductive and respiratory syndrome (PRRS) virus from aborted fetuses suspected of “PRRS”. Chin. J. Prev. Vet. Med. 1996, 2, 1–5. [Google Scholar]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef] [PubMed]
- Zhao, K.; Ye, C.; Chang, X.B.; Jiang, C.G.; Wang, S.J.; Cai, X.H.; Tong, G.Z.; Tian, Z.J.; Shi, M.; An, T.Q. Importation and Recombination Are Responsible for the Latest Emergence of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus in China. J. Virol. 2015, 89, 10712–10716. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.L.; Zhang, W.L.; Xiang, L.R.; Leng, C.L.; Tian, Z.J.; Tang, Y.D.; Cai, X.H. Emergence of novel porcine reproductive and respiratory syndrome viruses (ORF5 RFLP 1-7-4 viruses) in China. Vet. Microbiol. 2018, 222, 105–108. [Google Scholar] [CrossRef]
- Chen, N.; Cao, Z.; Yu, X.; Deng, X.; Zhao, T.; Wang, L.; Liu, Q.; Li, X.; Tian, K. Emergence of novel European genotype porcine reproductive and respiratory syndrome virus in mainland China. J. Gen. Virol. 2011, 92, 880–892. [Google Scholar] [CrossRef] [PubMed]
- Hsueh, F.C.; Kuo, K.L.; Hsu, F.Y.; Wang, S.Y.; Chiu, H.J.; Wu, M.T.; Lin, C.F.; Huang, Y.H.; Chiou, M.T.; Lin, C.N. Molecular Characteristics and Pathogenicity of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) 1 in Taiwan during 2019–2020. Life 2023, 13, 843. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Qiu, M.; Li, S.B.; Sun, Z.; Huang, Z.T.; Qi, W.H.; Qiu, Y.J.; Li, J.X.; Feng, B.H.; Zhao, D.S.; et al. Metagenomic and Pathogenic Assessments Identify a Pathogenic Porcine Reproductive and Respiratory Syndrome Virus 1 with New Deletions from Adult Slaughter Pig in 2022. Transbound. Emerg. Dis. 2023, 2023, 1975039. [Google Scholar] [CrossRef]
- Wang, X.; Bai, X.; Wang, Y.; Wang, L.; Wei, L.; Tan, F.; Zhou, Z.; Tian, K. Pathogenicity characterization of PRRSV-1 181187-2 isolated in China. Microb. Pathog. 2023, 180, 106158. [Google Scholar] [CrossRef]
- Xu, H.; Gong, B.J.; Sun, Q.; Li, C.; Zhao, J.; Xiang, L.R.; Li, W.S.; Guo, Z.Y.; Tang, Y.D.; Leng, C.L.; et al. Genomic Characterization and Pathogenicity of BJEU06-1-Like PRRSV-1 ZD-1 Isolated in China. Transbound. Emerg. Dis. 2023, 2023, 6793604. [Google Scholar] [CrossRef]
- Gong, B.J.; Xu, H.; Sun, Q.; Li, C.; Xiang, L.R.; Zhao, J.; Li, W.S.; Guo, Z.Y.; Li, J.H.; Wang, Q.; et al. Dissecting Genetic Diversity and Evolutionary Trends of Chinese PRRSV-1 Based on Whole-Genome Analysis. Transbound. Emerg. Dis. 2024, 2024, 9705539. [Google Scholar] [CrossRef]
- Zheng, J.Y.; Wu, Y.; Gao, X.P.; Lin, L.M.; Chang, H.; Zhu, G.J.; Fang, S.Y.; Li, W.; Ren, B.H.; Li, Q.H.; et al. Characterization and Pathogenicity of the Novel Porcine Reproductive and Respiratory Syndrome Virus 1 Strain SL-01 in China. Transbound. Emerg. Dis. 2024, 2024, 6873468. [Google Scholar] [CrossRef]
- Wang, X.C.; Yang, X.R.; Zhou, R.; Zhou, L.; Ge, X.N.; Guo, X.; Yang, H.C. Genomic characterization and pathogenicity of a strain of type 1 porcine reproductive and respiratory syndrome virus. Virus Res. 2016, 225, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Tan, F.F.; Zhou, Z.; Tian, K.G. Epidemic status and prevention strategies of PRRSV-1 in China. Chin. J. Prev. Vet. Med. 2022, 44, 1125–1130. [Google Scholar]
- Zhao, J.; Zhu, L.; Deng, H.; Li, F.; Xu, L.; Sun, X.; Yin, W.; Kuang, S.; Li, S.; Zhou, Y.; et al. Genetic characterization of a novel porcine reproductive and respiratory syndrome virus type I strain from southwest China. Arch. Virol. 2021, 166, 1769–1773. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Xu, H.; An, T.; Cai, X.; Tian, Z.; Zhang, H. Recent Progress in Studies of Porcine Reproductive and Respiratory Syndrome Virus 1 in China. Viruses 2023, 15, 1528. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Huang, Y.; Ye, M.; Li, S.; Xiao, Y.; Cui, B.; Zhu, J. Co-infection status of classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circoviruses (PCV2 and PCV3) in eight regions of China from 2016 to 2018. Infect. Genet. Evol. 2019, 68, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Feng, B.H.; Li, C.; Qiu, Y.J.; Qi, W.H.; Qiu, M.; Li, J.X.; Lin, H.; Zheng, W.L.; Zhu, J.Z.; Chen, N.H. Genomic Characterizations of Porcine Epidemic Diarrhea Viruses (PEDV) in Diarrheic Piglets and Clinically Healthy Adult Pigs from 2019 to 2022 in China. Animals 2023, 13, 1562. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.H.; Li, S.; Ye, M.X.; Huang, Y.C.; Huang, Y.; Xiao, Y.Z.; Yu, X.; Dong, J.B.; Tian, K.G.; Zhu, J.Z. A novel NADC30-like porcine reproductive and respiratory syndrome virus (PRRSV) plays a limited role in the pathogenicity of porcine circoviruses (PCV2 and PCV3) and PRRSV co-infection. Transbound. Emerg. Dis. 2019, 66, 28–34. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Li, X.; Qiu, M.; Li, J.; Xiao, Y.; Lin, H.; Zheng, W.; Zhu, J.; Chen, N. Transcriptomic profiling reveals different innate immune responses in primary alveolar macrophages infected by two highly homologous porcine reproductive and respiratory syndrome viruses with distinct virulence. Microb. Pathog. 2021, 158, 105102. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Ye, M.; Li, S.; Huang, Y.; Zhou, R.; Yu, X.; Tian, K.; Zhu, J. Emergence of a novel highly pathogenic recombinant virus from three lineages of porcine reproductive and respiratory syndrome virus 2 in China 2017. Transbound. Emerg. Dis. 2018, 65, 1775–1785. [Google Scholar] [CrossRef]
- Karniychuk, U.U.; Geldhof, M.; Vanhee, M.; Van Doorsselaere, J.; Saveleva, T.A.; Nauwynck, H.J. Pathogenesis and antigenic characterization of a new East European subtype 3 porcine reproductive and respiratory syndrome virus isolate. BMC Vet. Res. 2010, 6, 30. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Li, S.; Tian, Y.; Li, X.; Li, S.; Li, J.; Qiu, M.; Sun, Z.; Xiao, Y.; Yan, X.; et al. Chimeric HP-PRRSV2 containing an ORF2-6 consensus sequence induces antibodies with broadly neutralizing activity and confers cross protection against virulent NADC30-like isolate. Vet. Res. 2021, 52, 74. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Ye, M.; Zhang, Y.; Sun, S.; Luo, J.; Jiang, S.; Zhang, J.; Liu, X.; Shao, Q.; Cao, Q.; et al. Screening of Porcine Innate Immune Adaptor Signaling Revealed Several Anti-PRRSV Signaling Pathways. Vaccines 2021, 9, 1176. [Google Scholar] [CrossRef]
- Chen, N.; Liu, Q.; Qiao, M.; Deng, X.; Chen, X.; Sun, M. Whole genome characterization of a novel porcine reproductive and respiratory syndrome virus 1 isolate: Genetic evidence for recombination between Amervac vaccine and circulating strains in mainland China. Infect. Genet. Evol. 2017, 54, 308–313. [Google Scholar] [CrossRef] [PubMed]
- Dortmans, J.C.F.M.; Buter, G.J.; Dijkman, R.; Houben, M.; Duinhof, T.F. Molecular characterization of type 1 porcine reproductive and respiratory syndrome viruses (PRRSV) isolated in the Netherlands from 2014 to 2016. PLoS ONE 2019, 14, e0218481. [Google Scholar] [CrossRef]
- Yim-Im, W.; Huang, H.Y.; Park, J.; Wang, C.; Calzada, G.; Gauger, P.; Harmon, K.; Main, R.; Zhang, J.Q. Comparison of ZMAC and MARC-145 Cell Lines for Improving Porcine Reproductive and Respiratory Syndrome Virus Isolation from Clinical Samples. J. Clin. Microbiol. 2021, 59, e01757-20. [Google Scholar] [CrossRef]
- Qiu, M.; Li, S.; Ye, M.; Li, J.; Sun, Z.; Li, X.; Xu, Y.; Xiao, Y.; Li, C.; Feng, B.; et al. Systemic Homologous Neutralizing Antibodies Are Inadequate for the Evaluation of Vaccine Protective Efficacy against Coinfection by High Virulent PEDV and PRRSV. Microbiol. Spectr. 2022, 10, e0257421. [Google Scholar] [CrossRef]
- Chen, N.; Ye, M.; Xiao, Y.; Li, S.; Huang, Y.; Li, X.; Tian, K.; Zhu, J. Development of universal and quadruplex real-time RT-PCR assays for simultaneous detection and differentiation of porcine reproductive and respiratory syndrome viruses. Transbound. Emerg. Dis. 2019, 66, 2271–2278. [Google Scholar] [CrossRef]
- Fang, Y.; Treffers, E.E.; Li, Y.; Tas, A.; Sun, Z.; van der Meer, Y.; de Ru, A.H.; van Veelen, P.A.; Atkins, J.F.; Snijder, E.J.; et al. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proc. Natl. Acad. Sci. USA 2012, 109, E2920–E2928. [Google Scholar] [CrossRef]
- Fang, Y.; Snijder, E.J. The PRRSV replicase: Exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus Res. 2010, 154, 61–76. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.H.; Kaewprom, K.; Wang, S.Y.; Lin, C.F.; Yang, C.Y.; Chiou, M.T.; Lin, C.N. Outbreak of Porcine Reproductive and Respiratory Syndrome Virus 1 in Taiwan. Viruses 2020, 12, 316. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Song, Z.; Yu, Y.; Huang, J.; Jiang, P.; Shan, H. Genetic analysis of a porcine reproductive and respiratory syndrome virus 1 strain in China with new patterns of amino acid deletions in nsp2, GP3 and GP4. Microb. Pathog. 2020, 149, 104531. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Liu, L.; Tian, X.; Chen, L.; Huang, X.; Sun, Y.; Yan, Y.; Tian, Z.; Cai, X.; Liu, D.; et al. Genomic Analysis of Porcine Reproductive and Respiratory Syndrome Virus 1 Revealed Extensive Recombination and Potential Introduction Events in China. Vet. Sci. 2022, 9, 450. [Google Scholar] [CrossRef]
- Li, S.; Qiu, M.; Li, S.; Li, C.; Lin, H.; Qiu, Y.; Qi, W.; Feng, B.; Cui, M.; Yang, S.; et al. A chimeric porcine reproductive and respiratory syndrome virus 1 strain containing synthetic ORF2-6 genes can trigger T follicular helper cell and heterologous neutralizing antibody responses and confer enhanced cross-protection. Vet. Res. 2024, 55, 28. [Google Scholar] [CrossRef]
- Xie, J.X.; Trus, I.; Oh, D.; Kvisgaard, L.K.; Rappe, J.C.F.; Ruggli, N.; Vanderheijden, N.; Larsen, L.E.; Lefèvre, F.; Nauwynck, H.J. A Triple Amino Acid Substitution at Position 88/94/95 in Glycoprotein GP2a of Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV1) Is Responsible for Adaptation to MARC-145 Cells. Viruses 2019, 11, 36. [Google Scholar] [CrossRef]
- Liu, J.K.; Wei, C.H.; Dai, A.L.; Fan, K.W.; Yang, B.H.; Huang, C.F.; Li, X.H.; Yang, X.Y.; Luo, M.L. Complete genomic characterization of two European-genotype porcine reproductive and respiratory syndrome virus isolates in Fujian province of China. Arch. Virol. 2017, 162, 823–833. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.H.; Xiao, Y.Z.; Ye, M.X.; Li, X.S.; Li, S.B.; Xie, N.J.; Wei, Y.; Wang, J.L.; Zhu, J.Z. High genetic diversity of Chinese porcine reproductive and respiratory syndrome viruses from 2016 to 2019. Res. Vet. Sci. 2020, 131, 38–42. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Xu, Z.W.; Xu, T.; Zhou, Y.C.; Li, J.L.; Deng, H.D.; Li, F.Q.; Xu, L.; Sun, X.A.; Zhu, L. Molecular Characterization of the Nsp2 and ORF5s of PRRSV Strains in Sichuan China during 2012-2020. Animals 2022, 12, 3309. [Google Scholar] [CrossRef]
- Li, C.; Xu, H.; Zhao, J.; Gong, B.J.; Sun, Q.; Xiang, L.R.; Li, W.S.; Guo, Z.Y.; Li, J.H.; Tang, Y.D.; et al. Epidemiological investigation and genetic evolutionary analysis of PRRSV-1 on a pig farm in China. Front. Microbiol. 2022, 13, 1067173. [Google Scholar] [CrossRef]
- Zhai, S.L.; Lin, T.; Zhou, X.; Pei, Z.F.; Wei, Z.Z.; Zhang, H.; Wen, X.H.; Chen, Q.L.; Lv, D.H.; Wei, W.K. Phylogeographic analysis of porcine reproductive and respiratory syndrome virus 1 in Guangdong province, Southern China. Arch. Virol. 2018, 163, 2443–2449. [Google Scholar] [CrossRef] [PubMed]
- Oleksiewicz, M.B.; Botner, A.; Toft, P.; Normann, P.; Storgaard, T. Epitope mapping porcine reproductive and respiratory syndrome virus by phage display: The nsp2 fragment of the replicase polyprotein contains a cluster of B-cell epitopes. J. Virol. 2001, 75, 3277–3290. [Google Scholar] [CrossRef] [PubMed]
- Oleksiewicz, M.B.; Botner, A.; Toft, P.; Grubbe, T.; Nielsen, J.; Kamstrup, S.; Storgaard, T. Emergence of porcine reproductive and respiratory syndrome virus deletion mutants: Correlation with the porcine antibody response to a hypervariable site in the ORF 3 structural glycoprotein. Virology 2000, 267, 135–140. [Google Scholar] [CrossRef]
Region (City, Province) | Sample No. | PRRSV1-Positive No. | Percentage (%) |
---|---|---|---|
Fuyang, Anhui | 3 | 3 | 100 |
Zhumadian, Henan | 329 | 0 | 0 |
Qingdao, Shandong | 213 | 0 | 0 |
Jinchang, Gansu | 108 | 0 | 0 |
Neijiang, Sichuan | 87 | 0 | 0 |
Yangzhou, Jiangsu | 77 | 0 | 0 |
Shuangyashan, Heilongjiang | 62 | 0 | 0 |
Hangzhou, Zhejiang | 40 | 0 | 0 |
Chaozhou, Guangdong | 567 | 0 | 0 |
Beijing | 24 | 0 | 0 |
Xianyang, Shanxi | 4 | 0 | 0 |
Shihezi, Xinjiang | 7 | 0 | 0 |
Total | 1521 | 3 | 0.197 |
Primers | Sequence (5′→3′) | Length (bp) | Region * |
---|---|---|---|
PRRSV1-1F | ATGATGTGTAGGGTATTCCCC | 21 | 1–1375 |
PRRSV1-1R | CCATACCACTTGTGTGTCCC | 20 | |
PRRSV1-2F | TCGATCCTGATGGTCCCAT | 19 | 1195–2588 |
PRRSV1-2R | GTTGTCGGGTGTTTGCTCT | 19 | |
PRRSV1-3F | AAGGTCCTGATGAACAAGCAC | 21 | 2335–3680 |
PRRSV1-3R | GCTCTTTTGCTCTGTCGC | 18 | |
PRRSV1-4F | TTGGAGAGGTCTCATGCTTTC | 21 | 3491–6279 |
PRRSV1-4R | CACTGTTGGTCATAGCAAGG | 20 | |
PRRSV1-5F | GCCTCTCGACTGTTCAACT | 19 | 5908–7371 |
PRRSV1-5R | GGAGTTGACTAATGATGCGC | 20 | |
PRRSV1-6F | GTTGGCACTGTTGTGATCG | 19 | 7176–8533 |
PRRSV1-6R | GAATTTGTTTTTCCCCAAGGC | 21 | |
PRRSV1-7F | CAAGGAGAATTGGCAAACTG | 20 | 8344–9770 |
PRRSV1-7R | GCCCCACTATAAACTTGCTG | 20 | |
PRRSV1-8F | ATAACAAAACAACGGCCCT | 19 | 9573–10,975 |
PRRSV1-8R | TATGCGTCCTGTTGAAACG | 19 | |
PRRSV1-9F | CACCAGAATAATCGGGCG | 18 | 10,766–12,106 |
PRRSV1-9R | ACCATTTCATCAATTAGGTGGG | 22 | |
PRRSV1-10F | CGCCTTCACTGAGTTCCTT | 19 | 11,830–13,284 |
PRRSV1-10R | GATGACTTTGAAGCCTTTCTCG | 22 | |
PRRSV1-11F | CGGCCATTCTTTTCCTCC | 18 | 12,941–14,022 |
PRRSV1-11R | CTTCGAGGACGACATGTTTG | 20 | |
PRRSV1-12F | CTGGGTTTTCTCACAACAAGC | 21 | 13,710–15,074 |
PRRSV1-12R | AATTTCGGTCACATGGTTC | 19 |
Region | Length * | Similarity to AHEU2024-2671 (%) | |||||
---|---|---|---|---|---|---|---|
LV | Amervac | BJEU06-1 | HKEU06 | NMEU09-1 | SC2020-1 | ||
Nucleotides (nt) | |||||||
5′UTR | 221 | 92.34 | 91.89 | 91.44 | 91.44 | 90.54 | 91.44 |
ORF1a | 7185 | 85.18 | 83.41 | 81.82 | 81.88 | 79.82 | 89.23 |
ORF1b | 4392 | 88.39 | 87.30 | 86.13 | 86.20 | 84.45 | 92.94 |
ORFs 2–7 | 3177 | 87.21 | 86.52 | 85.55 | 86.37 | 85.99 | 90.78 |
3′UTR | 114 | 94.74 | 92.11 | 94.74 | 92.98 | 94.74 | 96.49 |
Complete | 15,074 | 86.67 | 85.34 | 84.06 | 84.24 | 82.68 | 90.67 |
Proteins (aa) | |||||||
Nsp1α | 180 | 92.22 | 90.56 | 89.44 | 87.78 | 90.56 | 90.00 |
Nsp1β | 205 | 81.95 | 80.00 | 80.00 | 79.02 | 75.61 | 82.44 |
Nsp2N | 729 | 76.06 | 73.87 | 69.04 | 69.90 | 65.53 | 82.58 |
Nsp2TF | 898 | 64.27 | 62.68 | 58.45 | 73.89 | 70.67 | 84.86 |
Nsp2 | 1076 | 82.00 | 80.24 | 76.60 | 77.46 | 73.84 | 86.73 |
Nsp3 | 230 | 92.61 | 92.61 | 90.43 | 92.17 | 91.74 | 94.78 |
Nsp4 | 203 | 91.13 | 92.12 | 87.68 | 89.66 | 84.24 | 94.09 |
Nsp5 | 170 | 93.53 | 91.76 | 92.94 | 93.53 | 90.00 | 95.29 |
Nsp6 | 16 | 93.75 | 93.75 | 93.75 | 100.00 | 93.75 | 100.00 |
Nsp7α | 149 | 95.97 | 95.30 | 95.97 | 94.63 | 96.64 | 97.32 |
Nsp7β | 108 | 92.59 | 89.81 | 92.59 | 92.59 | 88.89 | 91.67 |
Nsp8 | 45 | 95.56 | 93.33 | 93.33 | 93.33 | 95.56 | 97.78 |
Nsp9 | 685 | 95.62 | 95.33 | 95.18 | 95.18 | 94.74 | 96.06 |
Nsp10 | 442 | 93.44 | 92.99 | 94.57 | 91.18 | 92.31 | 96.38 |
Nsp11 | 224 | 96.88 | 96.88 | 96.88 | 94.64 | 94.64 | 96.88 |
Nsp12 | 152 | 93.42 | 94.08 | 92.76 | 93.42 | 90.13 | 94.74 |
GP2a | 249 | 89.96 | 87.55 | 88.35 | 87.15 | 87.15 | 94.38 |
E | 70 | 94.29 | 94.29 | 94.29 | 90.00 | 94.29 | 98.57 |
GP3 | 261 | 78.60 | 78.60 | 77.12 | 78.87 | 80.07 | 84.87 |
GP4 | 179 | 83.06 | 84.15 | 80.33 | 83.06 | 83.06 | 84.70 |
GP5 | 201 | 84.58 | 86.57 | 88.56 | 88.56 | 85.57 | 88.06 |
GP5a | 43 | 95.35 | 93.02 | 88.37 | 93.02 | 95.35 | 90.70 |
M | 173 | 91.91 | 91.91 | 89.60 | 93.64 | 91.33 | 91.33 |
N | 128 | 92.97 | 92.19 | 85.94 | 89.06 | 88.28 | 90.63 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, S.; Cui, M.; Li, C.; Qiu, M.; Zhu, X.; Lin, Y.; Meng, Y.; Qiu, Y.; Qi, W.; Lin, H.; et al. Isolation and Genomic Characterization of a Novel Porcine Reproductive and Respiratory Syndrome Virus 1 from Severely Diseased Piglets in China in 2024. Vet. Sci. 2025, 12, 61. https://doi.org/10.3390/vetsci12010061
Yang S, Cui M, Li C, Qiu M, Zhu X, Lin Y, Meng Y, Qiu Y, Qi W, Lin H, et al. Isolation and Genomic Characterization of a Novel Porcine Reproductive and Respiratory Syndrome Virus 1 from Severely Diseased Piglets in China in 2024. Veterinary Sciences. 2025; 12(1):61. https://doi.org/10.3390/vetsci12010061
Chicago/Turabian StyleYang, Shuai, Meng Cui, Chen Li, Ming Qiu, Xiaoyang Zhu, Yanhan Lin, Yifan Meng, Yuejia Qiu, Wenhao Qi, Hong Lin, and et al. 2025. "Isolation and Genomic Characterization of a Novel Porcine Reproductive and Respiratory Syndrome Virus 1 from Severely Diseased Piglets in China in 2024" Veterinary Sciences 12, no. 1: 61. https://doi.org/10.3390/vetsci12010061
APA StyleYang, S., Cui, M., Li, C., Qiu, M., Zhu, X., Lin, Y., Meng, Y., Qiu, Y., Qi, W., Lin, H., Zheng, W., Zhu, J., Fan, K., & Chen, N. (2025). Isolation and Genomic Characterization of a Novel Porcine Reproductive and Respiratory Syndrome Virus 1 from Severely Diseased Piglets in China in 2024. Veterinary Sciences, 12(1), 61. https://doi.org/10.3390/vetsci12010061